שיטות לעור פציעה ומבחנים לתגובות פצע ב

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ג elegans האפידרמיס וציפורן ליצור שכבת עור אך מתוחכמת פשוטה שיכול לתקן את הנזק מקומי כתוצאה מפציעתם. מחקרים של תגובות פצע ותיקון במודל זה מואר ההבנה של cytoskeletal ותגובות הגנומי לנזק לרקמות שלנו. שתי השיטות הנפוצות ביותר לפצע ג עור בוגר elegans הם דקירות במחטי microinjection, והקרנת לייזר מקומית. מחט פצעה מקומי משבשת את הציפורן, האפידרמיס, ומטריצת חוץ-תאית הקשורים, וגם עלול לגרום נזק לרקמות פנימיות. תוצאות קרינת לייזר בנזק יותר מקומי. פציעה מפעילה רצף של תגובות assayed בקלות כולל אפידרמיס הגבוה Ca 2 + (שניות-דקות), היווצרות וסגירת טבעת המכיל אקטין באתר הפצע (1-2 שעות), שעתוק מוגבר של גני פפטיד מיקרוביאלית (2-24 שעה), והיווצרות צלקת. בעיקרו של דבר את כל בעלי החיים המבוגרים הסוג בר לשרוד פציעה, שבוכמוטציות פגומות תיקון פצע או תגובות אחרות מראים ירידה בהישרדות. פרוטוקולים מפורטים למחט ופציעת לייזר, ומבחנים לכימות והדמיה של תגובות פצע ותהליכי תיקון (דינמיקת Ca, אקטין דינמיקה, אינדוקציה פפטיד מיקרוביאלית, והישרדות) מוצגים.

Introduction

מנגנוני ריפוי עור פצע הם עניין ביולוגי בסיסי ורלוונטיים לבריאות אדם. ריפוי פצעים בבעלי חוליות ויונקים כולל סדרה מורכבת של תגובות מתואמות של רקמות רבות ואיתות 1. אורגניזמים מודל גנטי פשוטים רבים הם גם מסוגלים ריפוי פצעי עור 2. לכן זה עניין לנתח מודלים גנטיים צייתנים של תיקון פצע עור. אנו ואחרים החלו להשתמש elegans Caenorhabditis כמודל חדש לפצע עור ריפוי 3,4. המטרה של פרוטוקול זה היא לאפשר למגוון רחב יותר של חוקרים להשתמש בג elegans ככלי לחקור מנגנונים מולקולריים ותאיים של ריפוי הפצע באפידרמיס.

ג עור elegans כולל את האפידרמיס (הידוע גם בבהיפודרמיס) וציפורן תאית 5. האפידרמיס המבוגר נוצר ממספר קטן של syncytia multinucleate, מתוכם הגדול ביותר הוא k syncytiumnown כhyp7. האפידרמיס הוא אפיתל פשוט שמפריש לציפורן על משטח הפסגה שלה. העור יכול באופן פעיל בהגנה מפני פתוגנים-חודר עור ולתקן פצעים קטנים 4. תיקון פצע של ג עור elegans הוא איתן, שכן כמעט כל בעלי החיים מהסוג בר לשרוד יכולים לשרוד פצעי דקירה קטנים הנגרמים על ידי מחטים, או נזק לעור מקומי הנגרם על ידי קרינת לייזר. ג פציעת עור elegans מפעילה חבילה של תגובות, כולל תגובת אפידרמיס מולדת חיסונית, סגירת פצע, והיווצרות צלקת 4. האפידרמיס המבוגר הוא שלאחר mitotic-, וריפוי פצעים כרוך תגובות הסלולר מקומיות בניגוד לריבוי אפידרמיס או נדידת תאים. הראינו כי פציעת העור גורמת עלייה גדולה ומתמשכת באפידרמיס Ca 2 +, המחייבת את ערוץ TRPM קרום GTL-2 וCa 2 + חנויות פנימיות 3. אות אפידרמיס 2 + Ca נדרשת להיווצרות וסגירת טבעות F- אקטין בוואתר und. פציעה גם גורמת תגובה חיסונית מולדת המפעילה את השעתוק של מגברים כגון NLP-29. השעתוק מושרה פציעתם של אמפר תלוי בTIR-1 מפל kinase MAP p38 / PMK-1 פועל באופן עצמאי באפידרמיס 4. פגמים באו מסלול איתות Ca 2 + או בתגובה החיסונית המולדת יובילו להישרדות נמוכה לאחר פציעה. המבנה פשוט יחסית של ג elegans האפידרמיס, נְהִילוּת הגנטית ויתרונות לin vivo הדמיה לעשות את זה מערכת מצוינת ללמוד היבטים רבים של תיקון פצע.

כאן אנו מציגים פרוטוקולים לשתי שיטות נפוצות של פציעה: פציעת מחט ופציעת לייזר. פציעת מחט לא דורשת ציוד מיוחד (למעט חולץ המחט), ועם ניסיון יכולה להתבצע על מאות תולעים בכל יום. פציעת מחט מתבצעת על בעלי חיים גדלו על צלחות אגר. בניגוד לכך, פציעת לייזר מבוצעת על anesבעלי החיים thetized רכובים על אגר כריות מתחת coverslip, והוא מתאים להדמית חיה של התגובות התאיות לנזק.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

הפרוטוקולים הבאים מתארים את הנוהל מפורט לג עור elegans פצע ולמנסה לאמוד את תגובות פצע.

1. מחט פציעת 3,4

  1. לגדול תולעי unstarved בריאים על NGM הסטנדרטי (מדיום גידול נמטודות) צלחות עם E. חיידקי coli OP50 כמזון, נשמרו בחממה C ° 20.
    הערה: שיטות לצלחות אגר NGM וטיפוח שיגרתי של ג ניתן למצוא elegans בשעה 6 www.wormbook.org.
  2. פיק 25 תולעי שלב L4 ליום 1 צלחת טרי נזרע לפני פצעת והתרבות ב 20 ° CO / N.
  3. לפני פצע, למשוך מחטים מנימים באמצעות חולץ מחט. המחטים המשמשות בפציעה זהות לאלה המשמשים לmicroinjection של ג elegans.
  4. ודא שכל התולעים נמצאים בשלב בוגר צעיר. מניחים את הצלחת של תולעים על קרח למשך כ -30 דקות. קירור גורם לבעלי החיים להיות איטיים, להקל על פציעת מחט.
  5. הסר את הצלחת אגר מהקרח לסטראו לנתח. באמצעות איסוף תולעת, להעביר 25 תולעים למרכז הצלחת אגר.
  6. מניחים את המחט לתוך קצה פיפטה 100 μl להחזיק את המחט בקלות רבה יותר. לנקב את החלק הקדמי או אחורי של הגוף של התולעת עם המחט, הימנעות בלוטת המין. באופן כללי, תנסה לפצוע בין בלוטת מין הלוע האחורי וקדמי, או בין בלוטת המין האחורית ופי הטבעת. מחטי שימוש חוזרים פעמים רבות, עד שהם ישברו.
    הערה: ודא פצעי דקירות הם קצרות, עדינות שלנקב את הציפורן ועור, חודר ~ 5-10 מיקרומטר לבעלי החיים. המחט צריכה להיכנס לעניםאל בזווית של כ זכות העור. הפצעים לא צריכים לגרום לניזק ברור לאיברים פנימיים, או קרע מיידי של הגוף. שים לב כמות קטנה של ציטופלסמה נוטף החוצה לכמה שניות לאחר שהפצע; עם זאת, אם תוכן סלולארי לדלוף החוצה במשך זמן ממושך בעלי החיים לא ישרדו. עבור הדמיה אופטימלית, פצע syncytium רוחב אפידרמיס (hyp7) או התפר לרוחב.
    הערה: הליך זה כולל את השימוש במחט זכוכית.
  7. לאפשר תולעים להתאושש בRT אז תרבות ב 20 ° C. לשפוט את ההצלחה של פציעת מחט על ידי מספר מבחני שיתוארו להלן. יותר מ 95% של בעלי חיים מסוג בר לשרוד 24 שעות לאחר המחט פצעה בשלב הבוגר הצעיר. ההשפעה פצע בזחלים בוגרים או מבוגרים טרם ניתחה בהרחבה.

2. לייזר פציעת 3

השתמש בהקרנת לייזר פמטו-שנייה (800 ננומטר) לבצע פציעה מדויקת יותר.

  1. הכן p אגרמודעות בשקופיות זכוכית עם אגר 2% מותכים 7. ודא הרפידות דומות לרפידות אגר המשמשות להדמית חיה של ג elegans.
  2. העבר את 10 תולעים בוגרות צעירות על כרית agarose עם בחירת תולעת, ולהוסיף טיפת 2 μl של 12 מ"מ פתרון levamisole. לכסות את בעלי החיים ואת הנוזל עם להחליק את המכסה. חכה 1-2 דקות לתולעים לשתק.
  3. מניחים את שקף הזכוכית על מיקרוסקופ confocal הדיסק מסתובב. הזז את הבמה כדי למצוא את התולעים ולהתמקד באפידרמיס הרוחב הקדמי או האחורי syncytial עם מטרת 100X (NA 1.4-1.46).
  4. הגדר את הכח של לייזר פמטו-השני ל -140 mW (נמדד לפני האובייקטיבי). השתמש בליזר פמטו-השני בשיעור החזרה של 80 מגה-הרץ.
    הערה: שתי פעימות של 200 אלפיות שניים כל אחת (מופרדים על ידי 20 אלפיות שני) מספיקות לפציעתם בידיים שלנו.
  5. פוקוס על משטח הפסגה של תאי אפידרמיס ופצע האפידרמיס. שים לב שיבוש מקומי של ציטופלסמה (מבעבעת), או o הלבנה המקומיתf כל סמן פלואורסצנטי משמש.
    הערה: בצע נהלי בטיחות לייזר מתאימים בעת שימוש בליזר פמטו-השני. סריקות קו או נקודה באמצעות לייזרי femtosecond כגון אלה בשני מיקרוסקופי פוטון אמורות לספק מספיק כוח לפציעת לייזר.
    הערה: למרות שאין לנו חוויה ישירה של שימוש בלייזרים אחרים, בפציעת עיקרון צריך להיות אפשרי באמצעות לייזרי UV קונבנציונליים (כפי שהוא משמש C. elegans כריתת תא). לחלופין, השתמש בשחזור הקרינה לאחר photobleaching מודול (FRAP) על ספינינג confocal דיסק לפצוע את האפידרמיס (נ Pujol, תקשורת אישית).

3. ויזואליזציה של תגובות 2 + Ca עוריות לפציעה

  1. השתמש ג המהונדס זני elegans המבטאים Ca 2 + חיישנים (כמו אלה של סדרת GCaMP) באפידרמיס, תחת השליטה של האמרגן הספציפי אפידרמיס המבוגר col-19 (איור 1 א; transgenes מפורטים ב הערה: יש לנו להשתמש tdTomato כבקרה פנימית לביטוי transgene כקרינת tdTomato אפידרמיס היא יציבה יחסית ואינו מפריעים להדמית GCaMP.
  2. מחט והן לייזר ופצע את הדק העלאת Ca 2 + באפידרמיס. עם זאת, כפי שפציעת מחט לא ניתן לבצע בקלות על confocal דיסק ספינינג, פציעת לייזר עדיפה לניתוח כמותי של תגובת Ca 2 + (איור 1).
  3. לרכוש תמונות זמן לשגות במצב רב-ממדי רכישה (מרווח זמן 2 שניות ל -114 חשיפת לייזר עירור msec) באמצעות דיסק מסתובב confocal עם מטרת 100X (NA 1.4-1.46) ומערכות סינון מתאימות (מסנני GFP יעבדו עבור GCaMP3).
    הערה: רכישת הזמן לשגות תמונות בכל 30 שניות בערך 2 שעות לבחון את שו"ת Ca 2 +onse לפצע מעל כמובן זמן ארוך יותר.
  4. שימוש בתוכנת ניתוח תמונה למדוד את הקרינה GCaMP הממוצעת בעשרת אזורים מקבילים של עניין (ROI), בם חמש התמקדו בcytosol תא אפידרמיס וחמישה ברקע.
  5. להשיג הקרינה בסיס (F 0) על ידי חישוב ממוצע הקרינה ב5 ROIs באפידרמיס אז הפחתה הממוצעת של 5 ROIs ברקע לפני פציעה. הגעה השינוי בΔF הקרינה כיחס בין השינוי ביחס לנקודת ההתחלה [(-f F t 0) / F 0].

4. ויזואליזציה של F- אקטין Dynamics לאחר הפציעה

  1. הערה: בתגובה לפציעת מחט, להתבונן טבעת אקטין באתר הפצע שסוגר בהדרגה סביב הפצע. מבחני סעיף פרוטוקול זה פצע סגירה על ידי מדידת קוטר הטבעת אקטין.
  2. צור תולעים מהונדסים המבטאים סמן F- אקטין כגון תחום תסיסנית אקטין moesin מחייב התמזגGFP, הביע תחת שליטתו של אמרגן ספציפי אפידרמיס כגון col-19 (איור 2 א) (transgene juIs352).
    הערה: יש לנו להשיג תוצאות דומות באמצעות אקטין אחרים מחייבים סמני תחום כגון Lifeact או F-tractin (תוצאות לא פורסמו).
  3. בצע מחט פצע על col-19- תולעים מהונדסים GFP-moesin P. לאחר פציעת מחט, להתבונן טבעת של ה- GFP-moesin סביב אתר הפצע על ידי ~ 5 דקות. הטבעת אקטין הופכת להיות קטנה יותר בקוטר וסופו של דבר נסגרה 2-3 שעות שלאחר פציעתם בחיות בר סוג (איור 2 א).
  4. הכן משטח אגר 2% בשקופית זכוכית ולהעביר 10 תולעים על הכרית בפתרון 2 μl 12 מ"מ levamisole. תמונת טבעות GFP-moesin שעה 1 לאחר פצע באמצעות מיקרוסקופ confocal הקונבנציונלי.
    הערה: מיקרוסקופיה confocal השימוש לרכוש Z- ערימות (13 x 0.5 מיקרומטר) של טבעות אקטין שעה 1 לאחר פציעתם.
  5. מדוד את קוטר טבעת אקטין לאחר פציעתם. כדי לכמת את אפידרמיס GFP-moesin, ראשון לעשות הקרנת עוצמה מקסימלית של Z- המחסנית ולאחר מכן לצייר 4 סריקות קו (ב 45 מעלות זה לזה) על טבעת GFP-moesin. קוטר טבעת מוגדר כשיא הממוצע למרחק שיא של סריקות ארבע קו (איור 2). לטבעות שכבר נסגרו, הקוטר מוגדר כ0 מיקרומטר.
    הערה: טבעות F- אקטין בנוחות נמדדות לאחר שעה 1 פצעו כמו זה היא כמחצית דרך בתהליך סגירת הפצעים בסוג בר. ניתן גם למדוד טבעות F- אקטין בנקודות זמן מרובות כדי להפיק במהלך סגירת פצע זמן. סרטי זמן לשגות של סגירת פצע ניתן לרכוש באמצעות תולעים-משותק levamisole ומסתובב מיקרוסקופיה confocal דיסק.

5. האינדוקציה Assay של פפטידים Antimicrobial עוריות

הערה: פציעה גם מפעילה תגובה חיסונית מולדת בג עור elegans. שעתוק של גני קידוד פפטידים מיקרוביאלית (אמפר) הוא induced באפידרמיס. AMP NLP-29 (החלבון כמו neuropeptide-) מושרה בחום על ידי פצע 4. לassay איך האפידרמיס שולט ביטוי AMP לאחר פציעה, להשתמש כתבים מהונדסים או בזמן אמת PCR לגילוי רמות תמליל AMP בודדים.

  1. assay כתב המהונדס לתגובה חיסונית מולדת פצע 4.
  2. לבצע פציעת מחט (כמו בפרוטוקול 1) על בעלי חיים מבוגרים המבטאים את הכתב המהונדס frIs7, המכיל NLP-P 29. GFP וP col-12 DsRed כבקרה פנימית. תצפיות על בעלי חיים מבוגרים unwounded אדומים או כתומים כהים כמו במסנן מסירה ארוכה GFP.
    הערה: תולעי wild-type פציעה יגרמו NLP-29 -GFP ביטוי P אבל לא ישפיעו col-12 P -dsRed, וכתוצאה מכך תולעים המופיעים כתום, צהוב, ירוק או תחת תאורת מסירה ארוכה GFP. אובדן התפקוד של גנים במסלול MAPK p38, כגון ורוד-1 או nsy-1 יחסום NLP-29 -GFPאינדוקציה לאחר פצע 4. GFP P NLP-29. באו לידי ביטוי ברמות גבוהות בשלבי זחל
  3. לבצע מבחני אינדוקציה AMP בבעלי חיים מבוגרים צעירים. ודא שיש לי חיות שליטת unwounded רמות נמוכות של GFP.
    הערה: NLP-29. ביטוי P GFP גם הנגרם על ידי לחץ האוסמוטי 8, ועלול להיות רגיש ללחצים סביבתיים אחרים.
  4. 6 שעות לאחר פציעה, ציון המספרים של תולעים שיש לי NLP-29 -GFP אינדוקציה P (איור 3) 9 באמצעות הקרינה לנתח היקף עם מסנן ארוך לעבור GFP.
    הערה: בGFP NLP-P 29. לאחר הפציעה-שעה 1 מושרה בעליל, שהגיע לשיא על פוסט פציעה-6 שעות ולאחר מכן נותר גבוהה עד להודעה פציעת 24 שעות. לכמת ביטוי על ידי 4,9 ניקוד חזותי. לחלופין, לכמת רמות ביטוי באמצעות סדרן תולעת הקרינה הופעלה 4. לסדרן התולעת, לפחות 50 בעלי חיים צריכים להיות פצועים.
  5. בזמן אמת assay PCR לקואהntitating רמות תמליל גני AMP הבודדים. רמות תמליל assay עבור מספר גנים: NLP-29, NLP-30, cnc-1, וcnc-5.
  6. בצע מחט פצע על wild-type או תולעי מוטציה (ראה פרוטוקול 1)
  7. לאסוף 50 תולעים נפצעו ו -50 תולעים unwounded בזמנים הרצויים (למשל 3, 6, 24 שעות) לאחר פציעה.
  8. לחלץ RNA באמצעות ערכה מסחרית הבא הוראות היצרן.
  9. לבצע שעתוק לאחור כדי לקבל כולל cDNA 20 μl באמצעות ערכת transcriptase הפוכה מסחרית.
  10. לRT-PCR, להשתמש 0.2 μl cDNA (1/40) מכל מדגם בשילוב עם Supermix ירוק עם העמסה ו -0.2 מיקרומטר פריימרים. כדי להשוות איכות RNA, להשתמש ama-1 או SNB-1 RT-PCR כהתייחסות; להשוות את רמת הביטוי היחסית AMP ידי נרמול לבקרה פנימית (AMA-1 או SNB-1), או להשוות לאחר פציעת אינדוקציה לקפל (אינדוקציה AMP בתולעים פצועים / תולעי unwounded) על ידי נורמהalizing לבקרה פנימית.
    הערה: cnc-1 וcnc-5 הן caenacin פפטידים מיקרוביאלית משפחת השעתוק שמופעל על ידי פצע 10. בדרך כלל, פציעת מחט גורמת ביטוי (~ 500 פי לcnc-1) על קורס של 4 שעות 10 זמן. Primers המשמש בעבודה שפורסמה שמותיהם מופיעים בטבלה 2.

6. Assay הישרדות לאחר הפציעה

  1. הערה: פציעה מפעילה לפחות שני מסלולים עצמאי איתות באפידרמיס: מסלול Ca 2 + פצע תלוי תיקון ומסלול התגובה חיסוני המולדת. שני המסלולים נדרשים להישרדות מלאה של פציעת סטרילי. כדי לבדוק אם מוטציה או טיפול RNAi משפיע ריפוי פצע, למדוד הישרדות בהודעת פציעה 24-48 שעות. לחלופין, להשתמש במבחני תוחלת חיים מקובלים על מנת לקבוע את ההשפעה של פצע על אריכות ימים 4,9.
  2. בצע מחט פצעה במבוגרים צעירים (L4 + 24 שעות) תולעים (50 תולעים, seve חוזרפעמים RAL) בעקבות פרוטוקול 1 לעיל. לשמור על מספר שווה של תולעי unwounded כפקדים.
  3. בדקו הישרדות בכל שעה 24 (תולעים פצועים העברה לצלחת אגר חדשה בכל שעה 24). שים לב ~ 50% הישרדות 24 שעות לאחר פציעתם במוטציות שהם פגומים תיקון פצע כגון GTL-2 או טיר-1, כאשר מנורמל לבעלי חיים שליטה unwounded. מוות מוגדר כחוסר התגובה של תנועה לגעת ידי בחירת תולעת.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

לייזר או פציעת מחט יפעיל העלאה מהירה ומתמשכת ברמות Ca אפידרמיס, כמו דמיין עם חיישני Ca כגון GCaMPs (איור 1). העלאת Ca מתרחשת תוך שניות, ונשארה גבוה במשך עשרות דקות. מחט פצעה reproducibly תוצאות בהיווצרות של טבעות F- אקטין באתרי פצע (איור 2); אלה מופיעים בתוך דקות, ובהדרגה קרובים מעל 1-2 שעות לאחר פציעתם. טבעות אקטין פחות לעתים קרובות נוצרות לאחר פציעת לייזר מדויקת יותר. שתי פציעת המחט והלייזר לגרום לביטוי של פפטידים אפידרמיס מיקרוביאלית (אמפר) כגון NLP-29, שזוהו עם כתבי תעתיק (איור 3). האינדוקציה AMP ניכר בתוך 2-4 שעות לאחר הפציעה ונמשכת כ 24 שעות. פציעת מחט של הסוג בר לא אמורה להשפיע באופן משמעותי את הכדאיות (נמדדה ב 24 שעות לאחר פציעתם) או תוחלת חיים.

איור 1
איור 1. פציעת לייזר יוצרת תגובת Ca 2 + C. האפידרמיס elegans. הקרינה עוריות GCaMP3 (-GCaMP3 P col-19 (juIs319)) רמות לאחר פציעת לייזר פמטו-שנייה (). תצוגה לרוחב של האפידרמיס בקדמי-גוף; x, פצע לייזר; N, גרעין אפידרמיס. תמונות מסתובבות דיסק confocal, קוד עוצמה. UW: unwounded, W:. פצוע (B) Quantitation של GCaMP3 ΔF / F 0 בגיל 20, 40, ו -60 מיקרומטר מאתר פצע; עקבות נציג. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
2. פציעת מחט איור מפעילה פילמור אקטין סביב אתר פצע. () col-19- GFP-moesin (juIs352). בקנה מידה: 10 מיקרומטר. UW: unwounded, W:.. Quantitation פצוע (ב) לקוטר טבעת אקטין מסריקות קו, 4 סריקות קו לחיים (מנוקדות קווים אדומים בפנל (), WT) אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. עוריות פציעה מפעילה תגובה חיסונית מולדת. נציג תמונות (WT unwounded, WT פצוע + 3 שעות) של NLP-29 -GFP (frIs7) אינדוקציה P אחרי פציעת מחט. בקנה מידה:. 200 מיקרומטר אנא לחץ כאן לצפייהגרסה גדולה יותר של דמות זו.

כתב Transgene הקרינה אלל
סידן Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 X
אקטין Pcol-19-GFP :: moesin GFP juIs352 אני
NLP-29 Pnlp-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 IV

Transgenes הטבלה 1. השתמשה במבחני תגובת פצע. טבלה זו מפרטת chromosomally משולבת transgenes זמין במרכז Caenorhabditis הגנטיקה (http://www.cbs.umn.edu/research/resources/cgc).

שם גן רצף
NLP-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
NLP-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Primers הטבלה 2. משמש לRT-PCR של תמלילי AMP. העבודה ריכוז היא 0.2 מיקרומטר. SNB-1 משמש כבקרה פנימית.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

השיטות שהוצגו כאן למחט ופציעת לייזר לספק גישות משלימות להערכת היכולת של האפיתל אפידרמיס לתקן את הנזק. פציעת לייזר היא יחסית מקומית ו( בהתאם לתצורת לייזר) יכול להיות מוגבל לאפידרמיס, ואילו פציעת מחט משבשת את האפידרמיס, ציפורן, וקרומים מרתף פנימיים סביר. פציעת מחט עשויה בצורה מדויקת יותר דומה לפצעים שנגרמו על ידי גורמי מחלה או פגיעה מכאנית בסביבה הטבעית. ככלל, פציעת מחט דורשת יותר תרגול כדי להשיג פצעים מדויקים התואמים את ההישרדות של בעלי חיים. התגובות התאיות לדמיון רב מחט ותצוגת פציעת לייזר. עם זאת יש לציין כי ההיווצרות של טבעות אקטין לא נצפתה reproducibly לאחר פציעת לייזר פמטו-שנייה.

הגבלה של ניקור מחט היא שזה לא פצע מדויק: המחט גם רקמות פנימיות נזקים שתרומה לתולעתהישרדות לא נחקרה. שינוי אפשרי של פרוטוקול זה יהיה לשלב מערכת מבוססת microfluidic microinjection 11 וכתבי ניאון לבצע פציעה פיזית מדויקת יותר.

שיטות פציעת המחט ולייזר המפורטות כאן הן פשוט עדיין די עבודה אינטנסיבית, ובמקרה הטוב בינונית-תפוקה, מה שהופך את מאתגר להשתמש בגישות הגנומי או ביוכימי לאפיון תגובת הפצע. ציפורן חודרת פתוגנים כגון פטריות או 12,13 פרוטוזואה יכולים להיות מועברים לאוכלוסייה גדולה יותר של בעלי חיים, ועלולים לעורר תגובות החופפים לתגובה לפציעה, עדיין להציג את מורכבות נוספות של תגובות ספציפיות הפתוגן. עבודה נוספת שתידרש כדי לחקור האם ניתן להתאים שיטות אביוטי אחרות כגון הפצצה בליסטית 14 או מערכים של מבני פירסינג מייקרו-מכאניים 15 לפציעתם בקנה מידה גדולה.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics