में घाव प्रतिक्रियाएँ त्वचा लोग घायल हो गए के लिए तरीके और assays

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

सी. एलिगेंस epidermis और छल्ली लोग घायल हो गए जिसके परिणामस्वरूप से स्थानीय क्षति की मरम्मत कर सकते हैं कि एक सरल अभी तक परिष्कृत त्वचा की परत के रूप में। इस मॉडल में घाव प्रतिक्रियाएं और मरम्मत के अध्ययन cytoskeletal और ऊतकों को नुकसान करने के लिए जीनोमिक प्रतिक्रियाओं के बारे में हमारी समझ के प्रबुद्ध है। दो सबसे अधिक इस्तेमाल किया तरीकों सी घाव एलिगेंस वयस्क त्वचा microinjection सुई, और स्थानीय लेजर विकिरण के साथ चुभन हैं। स्थानीय रूप से घायल हो गए सुई छल्ली, एपिडर्मिस, और संबंधित बाह्य मैट्रिक्स बाधित है, और भी आंतरिक ऊतकों को नुकसान पहुंचा सकता है। अधिक स्थानीयकृत क्षति में लेजर विकिरण का परिणाम है। लोग घायल हो गए ऊंचा एपिडर्मल सीए 2 + (सेकंड मिनट), गठन और घाव साइट (1-2 मानव संसाधन), रोगाणुरोधी पेप्टाइड जीन का ऊंचा प्रतिलेखन में एक एक्टिन युक्त अंगूठी को बंद करने सहित आसानी से assayed प्रतिक्रियाओं की एक उत्तराधिकार (2-24 से चलाता है मानव संसाधन), और निशान गठन। अनिवार्य रूप से सभी जंगली प्रकार वयस्क जानवर, जहां लोग घायल हो गए जीवित रहनेघाव की मरम्मत या अन्य प्रतिक्रियाओं में दोषपूर्ण म्यूटेंट के रूप में अस्तित्व में कमी आई दिखा। विस्तृत सुई और लेजर लोग घायल हो गए के लिए प्रोटोकॉल, और quantitation और घाव प्रतिक्रियाएं और मरम्मत प्रक्रियाओं (सीए गतिशीलता, एक्टिन गतिशीलता, रोगाणुरोधी पेप्टाइड प्रेरण, और अस्तित्व) के दृश्य के लिए assays के प्रस्तुत कर रहे हैं।

Introduction

त्वचा घाव भरने तंत्र बुनियादी जैविक ब्याज की हैं और मानव स्वास्थ्य के लिए प्रासंगिक है। रीढ़ और स्तनधारियों में घाव भरने समन्वित प्रतिक्रिया कई ऊतकों की और एक संकेत के एक जटिल श्रृंखला शामिल है। कई सरल आनुवंशिक मॉडल जीवों भी त्वचा के घाव दो को उपचार के लिए सक्षम हैं। यह त्वचा के घाव की मरम्मत की आनुवंशिक रूप से विनयशील मॉडल का विश्लेषण करने के लिए इसलिए ब्याज की है। हम और दूसरों को त्वचा के घाव के लिए नए मॉडल 3,4 चिकित्सा के रूप में Caenorhabditis एलिगेंस उपयोग करने के लिए शुरू कर दिया है। इस प्रोटोकॉल का लक्ष्य सी का उपयोग करने के शोधकर्ताओं के एक व्यापक सेट सक्षम करने के लिए है एक उपकरण के रूप में एलिगेंस एपिडर्मल घाव भरने की आणविक और सेलुलर तंत्र की जांच करने के लिए।

सी. एलिगेंस त्वचा (भी हाइपोडर्मिस के रूप में जाना जाता है) एपिडर्मिस और बाह्य छल्ली 5 शामिल हैं। वयस्क एपिडर्मिस सबसे बड़ा syncytium कश्मीर है, जिनमें से multinucleate syncytia की एक छोटी संख्या से बनाई हैNown रूप hyp7। एपिडर्मिस अपने शिखर सतह पर छल्ली स्रावित करता है कि एक साधारण उपकला है। त्वचा को सक्रिय रूप से त्वचा मर्मज्ञ रोगजनकों के खिलाफ की रक्षा और छोटे घाव चार मरम्मत कर सकते हैं। सी के घाव की मरम्मत एलिगेंस त्वचा सभी जंगली प्रकार के पशुओं सुई, या लेजर विकिरण की वजह से स्थानीय त्वचा को नुकसान की वजह से छोटे पंचर घाव जीवित रह सकते हैं जीवित रहने के रूप में लगभग, मजबूत है। सी एलिगेंस त्वचा लोग घायल हो गए एक एपिडर्मल सहज प्रतिरक्षा प्रतिक्रिया, घाव बंद करने, और निशान गठन 4 सहित प्रतिक्रियाओं का एक सूट, चलाता है। वयस्क एपिडर्मिस बाद mitotic है, और घाव भरने एपिडर्मल प्रसार या सेल प्रवास के लिए विरोध के रूप में स्थानीय सेलुलर प्रतिक्रियाओं शामिल है। हम चाहते हैं कि त्वचा लोग घायल हो गए झिल्ली TRPM चैनल जीटीएल-2 और आंतरिक सीए 2 + भंडार 3 की आवश्यकता होती है, सीए 2 + एपिडर्मल में एक बड़े और निरंतर वृद्धि से चलाता दिखाया है। एपिडर्मल सीए 2 + संकेत पर एफ actin के छल्ले के गठन और बंद wo के लिए आवश्यक हैअंड साइट। घायल भी ऐसे एनएलपी-29 के रूप में amps के प्रतिलेखन को सक्रिय कि सहज प्रतिरक्षा प्रतिक्रिया को प्रेरित करता है। amps के लोग घायल हो गए प्रेरित प्रतिलेखन एक तिर-एक एपिडर्मिस 4 में स्वायत्त अभिनय / पीएमके एक p38 एमएपी काइनेज झरना पर निर्भर है। या तो सीए 2 + संकेतन मार्ग में या सहज प्रतिरक्षा प्रतिक्रिया में दोष कम अस्तित्व के बाद लोग घायल हो गए करने के लिए नेतृत्व करेंगे। सी के अपेक्षाकृत सरल संरचना एलिगेंस एपिडर्मिस, vivo इमेजिंग के लिए अपने आनुवंशिक Tractability और फायदे के घाव की मरम्मत के कई पहलुओं का अध्ययन करने के लिए यह एक उत्कृष्ट प्रणाली बनाते हैं।

सुई लोग घायल हो गए और लेजर लोग घायल हो गए: यहाँ हम लोग घायल हो गए के दो आम तरीकों के लिए प्रोटोकॉल प्रस्तुत करते हैं। सुई लोग घायल हो गए (सुई खींचने के अलावा) कोई विशेष उपकरणों की आवश्यकता है, और अनुभव के साथ प्रति दिन कीड़े के सैकड़ों पर प्रदर्शन किया जा सकता है। सुई लोग घायल हो गए अगर प्लेटों पर बढ़ जानवरों पर किया जाता है। इसके विपरीत, लेजर लोग घायल हो गए Anes पर किया जाता हैthetized जानवरों एक coverslip के तहत पैड अगर पर मुहिम शुरू की है, और नुकसान के लिए सेलुलर प्रतिक्रियाओं का जीना इमेजिंग के लिए अनुकूल है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

निम्नलिखित प्रोटोकॉल सी के लिए विस्तृत प्रक्रिया का वर्णन एलिगेंस त्वचा लोग घायल हो गए और घाव प्रतिक्रियाओं परख करने की क्रिया के लिए।

1. सुई लोग घायल हो गए 3,4

  1. मानक एन जी एम (निमेटोड विकास मध्यम) के साथ प्लेटों पर स्वस्थ unstarved कीड़े बढ़ो एक 20 डिग्री सेल्सियस इनक्यूबेटर में रखा भोजन के रूप में कोलाई OP50 बैक्टीरिया,।
    नोट: एन जी एम अगर प्लेट और सी की दिनचर्या की खेती के लिए तरीके एलिगेंस www.wormbook.org 6 पर पाया जा सकता है।
  2. 20 डिग्री सीओ / एन में लोग घायल हो गए और संस्कृति से पहले एक हौसले वरीयता प्राप्त थाली एक दिन के लिए 25 L4 मंच कीड़े उठाओ।
  3. घायल करने से पहले, एक सुई खींचने का उपयोग केशिकाओं से सुई खींच। लोग घायल हो गए में इस्तेमाल सुइयों सी के microinjection के लिए इस्तेमाल किया उन लोगों के लिए समान हैं एलिगेंस।
  4. सभी कीड़े युवा वयस्क अवस्था में हैं सुनिश्चित करें। लगभग 30 मिनट के लिए बर्फ पर कीड़े की थाली रखें। शीतलक जानवरों सुई लोग घायल हो गए, सुविधा सुस्त होने का कारण बनता है।
  5. एक विदारक stereomicroscope के लिए बर्फ से अगर प्लेट निकालें। एक कीड़ा लेने का उपयोग करना, अगर प्लेट के केन्द्र में 25 कीड़े चाल है।
  6. और अधिक आसानी से सुई धारण करने के लिए एक 100 μl विंदुक टिप में सुई रखें। जननपिंड से परहेज है, सुई के साथ कृमि के शरीर के पूर्वकाल या पीछे भाग पंचर। सामान्य में, पीछे ग्रसनी और पूर्वकाल जननपिंड के बीच, या पीछे जननपिंड और मलाशय के बीच घाव करने का प्रयास। पुन: उपयोग सुइयों कई बार तो वे तोड़ने तक।
    नोट: जानवर में ~ 5-10 माइक्रोन मर्मज्ञ, घाव छल्ली और त्वचा पंचर कि संक्षिप्त, कोमल चुभन हैं सुनिश्चित करें। सुई anim दर्ज करना चाहिएत्वचा के लिए अल लगभग एक सही कोण। घाव आंतरिक अंगों को स्पष्ट क्षति, या शरीर के तत्काल टूटना कारण नहीं होना चाहिए। कोशिका द्रव्य घाव के बाद कुछ सेकंड के लिए बाहर बह की एक छोटी राशि का निरीक्षण करें; सेलुलर सामग्री को एक लंबे समय तक समय के साथ बाहर रिसाव हालांकि, अगर जानवरों को जीवित नहीं होगी। इष्टतम इमेजिंग के लिए, पार्श्व एपिडर्मल syncytium (hyp7) या पार्श्व सीवन घाव।
    नोट: इस प्रक्रिया एक गिलास सुई का उपयोग भी शामिल है।
  7. कीड़े 20 डिग्री सेल्सियस पर फिर आरटी पर संस्कृति को ठीक करने के लिए अनुमति दें। नीचे वर्णित assays के एक नंबर के द्वारा सुई लोग घायल हो गए की सफलता के न्यायाधीश। जंगली प्रकार के पशुओं के 95% से अधिक सुई युवा वयस्क अवस्था में घायल हो गए बाद 24 घंटा जीवित रहते हैं। लार्वा या पुराने वयस्कों में लोग घायल हो गए का असर अभी तक बड़े पैमाने पर विश्लेषण किया नहीं किया गया है।

2. लेजर लोग घायल हो गए 3

अधिक सटीक लोग घायल हो गए प्रदर्शन करने के लिए femtosecond लेजर विकिरण (800 एनएम) का प्रयोग करें।

  1. अगर पी तैयार करेंपिघल 2% अगर 7 के साथ एक गिलास स्लाइड पर विज्ञापन। पैड सी का जीना इमेजिंग के लिए प्रयोग किया जाता है अगर पैड के समान हैं सुनिश्चित करें एलिगेंस।
  2. कीड़ा लेने के साथ agarose पैड पर 10 युवा वयस्क कीड़े स्थानांतरण, और 12 मिमी levamisole समाधान के 2 μl बूंद जोड़ें। जानवरों और एक कवर पर्ची के साथ तरल कवर। कीड़े पंगु करने के लिए 1-2 मिनट तक प्रतीक्षा करें।
  3. एक कताई डिस्क confocal खुर्दबीन पर कांच स्लाइड रखें। कीड़े खोजने के लिए और एक 100X उद्देश्य के साथ पार्श्व पूर्वकाल या पीछे syncytial एपिडर्मिस (एनए 1.4-1.46) पर ध्यान केंद्रित करने के लिए मंच ले जाएँ।
  4. 140 मेगावाट femtosecond लेजर की सत्ता स्थापित (उद्देश्य से पहले मापा)। 80 मेगाहर्ट्ज की पुनरावृत्ति दर पर femtosecond लेजर का प्रयोग करें।
    नोट: (20 मिसे से विभाजित) 200 मिसे प्रत्येक के दो दालों हमारे हाथ में लोग घायल हो गए के लिए पर्याप्त हैं।
  5. एपिडर्मल सेल के शिखर सतह पर ध्यान दें और एपिडर्मिस घाव। कोशिका द्रव्य (बुदबुदाती) की स्थानीय व्यवधान, या स्थानीय विरंजन ओ का निरीक्षणकिसी भी इस्तेमाल किया फ्लोरोसेंट मार्कर एफ।
    नोट: femtosecond लेजर का उपयोग करते समय उचित लेजर सुरक्षा प्रक्रियाओं का पालन करें। इस तरह के दो फोटॉन सूक्ष्मदर्शी में उन लोगों के रूप में femtosecond लेसरों का उपयोग लाइन या पाइंट स्कैन लेजर लोग घायल हो गए के लिए पर्याप्त शक्ति प्रदान करना चाहिए।
    नोट: हम अन्य पराबैंगनीकिरण का उपयोग करने का प्रत्यक्ष अनुभव नहीं है, जबकि सिद्धांत लोग घायल हो गए में (सी सेल ablations एलिगेंस में इस्तेमाल के रूप में) पारंपरिक यूवी लेसरों का उपयोग संभव होना चाहिए। वैकल्पिक रूप से, एपिडर्मिस (एन पुजोल, व्यक्तिगत संचार) घाव करने के लिए डिस्क confocal कताई पर (FRAP) मॉड्यूल photobleaching के बाद एक प्रतिदीप्ति वसूली का उपयोग करें।

घायल को एपिडर्मल सीए 2 + प्रतिक्रियाएँ 3. विज़ुअलाइज़ेशन

  1. ट्रांसजेनिक सी का प्रयोग करें वयस्क एपिडर्मल विशिष्ट प्रमोटर कर्नल-19 (चित्रा 1 ए के नियंत्रण के तहत, epidermis में (जैसे GCaMP श्रृंखला के उन लोगों के रूप में) सीए 2 + सेंसर व्यक्त कि एलिगेंस उपभेदों; ट्रांसजीन में सूचीबद्ध हैं नोट: हम एपिडर्मल tdTomato प्रतिदीप्ति अपेक्षाकृत स्थिर है के रूप में transgene अभिव्यक्ति के लिए एक आंतरिक नियंत्रण के रूप में tdTomato का इस्तेमाल किया है और GCaMP इमेजिंग के साथ हस्तक्षेप नहीं करता है।
  2. एपिडर्मिस में ट्रिगर सीए 2 + ऊंचाई लोग घायल हो गए सुई और लेजर दोनों। सुई लोग घायल हो गए आसानी से एक कताई डिस्क confocal पर नहीं किया जा सकता है लेकिन, जैसा कि लेजर लोग घायल हो गए सीए 2 + प्रतिक्रिया (चित्रा 1) के मात्रात्मक विश्लेषण के लिए बेहतर है।
  3. एक 100X उद्देश्य के साथ कताई डिस्क confocal (एनए 1.4-1.46) और उपयुक्त फिल्टर सेट का उपयोग कर बहु-आयामी अधिग्रहण मोड (अंतराल समय 114 मिसे उत्तेजना लेजर जोखिम के साथ दो सेकंड) में समय व्यतीत हो छवियों का मोल (GFP फिल्टर GCaMP3 के लिए काम करेंगे)।
    नोट: सीए 2 + resp की जांच करने के बारे में दो घंटे के लिए समय चूक छवियों हर 30 सेकंड मोलएक लंबे समय के पाठ्यक्रम पर लोग घायल हो गए करने के लिए onse।
  4. छवि विश्लेषण सॉफ्टवेयर का उपयोग पृष्ठभूमि में एपिडर्मल सेल cytosol और पांच पर केन्द्रित कर रहे हैं जिनमें से पांच ब्याज (आरओआई) के दस बराबर क्षेत्रों में औसत GCaMP प्रतिदीप्ति उपाय।
  5. फिर चोट से पहले पृष्ठभूमि में 5 ROIs की औसत घटाकर epidermis में 5 ROIs में प्रतिदीप्ति के औसत से आधारभूत प्रतिदीप्ति (एफ 0) प्राप्त करते हैं। आधारभूत [(एफ टी एफ 0) / एफ 0] के संबंध में परिवर्तन के अनुपात के रूप में प्रतिदीप्ति ΔF में परिवर्तन व्यक्त करते हैं।

घायल होने के बाद एफ actin गतिशीलता 4. दृश्य

  1. नोट: सुई लोग घायल हो गए के जवाब में, धीरे-धीरे घाव के आसपास बंद कर देता है कि घाव स्थल पर एक एक्टिन अंगूठी निरीक्षण करते हैं। इस प्रोटोकॉल अनुभाग assays के एक्टिन अंगूठी व्यास को मापने के द्वारा बंद करने के घाव।
  2. इस तरह से जुड़े हुए ड्रोसोफिला moesin एक्टिन बाध्यकारी डोमेन के रूप में एक एफ actin मार्कर व्यक्त कि ट्रांसजेनिक कीड़े उत्पन्नGFP, इस तरह के (transgene juIs352) कर्नल -19 (2A चित्रा) के रूप में एक एपिडर्मल विशिष्ट प्रमोटर के नियंत्रण के तहत व्यक्त किया।
    नोट: हम इस तरह के Lifeact या एफ-tractin (अप्रकाशित परिणाम) के रूप में डोमेन मार्करों बाध्यकारी अन्य एक्टिन का उपयोग करते हुए इसी तरह के परिणाम प्राप्त किया है।
  3. पी कर्नल-19- GFP-moesin ट्रांसजेनिक कीड़े पर लोग घायल हो गए सुई प्रदर्शन करते हैं। सुई लोग घायल हो गए, के बाद ~ 5 मिनट से घाव स्थल के चारों ओर GFP-moesin की एक अंगूठी का पालन। एक्टिन अंगूठी व्यास में छोटा हो जाता है और अंत में जंगली प्रकार के पशुओं (2A चित्रा) में लोग घायल हो गए 2-3 घंटे बाद बंद कर देता है।
  4. एक गिलास स्लाइड पर एक 2% अगर पैड तैयार है और 2 μl 12 मिमी levamisole समाधान में पैड पर 10 कीड़े हस्तांतरण। पारंपरिक confocal माइक्रोस्कोपी का उपयोग लोग घायल हो गए बाद छवि GFP-moesin छल्ले एक घंटा।
    नोट: उपयोग confocal माइक्रोस्कोपी 1 घंटा घायल हो गए बाद actin के छल्ले के Z ढेर (13 एक्स 0.5 माइक्रोन) प्राप्त करने के लिए।
  5. घायल होने के बाद एक्टिन अंगूठी व्यास उपाय। एपिडर्मल जी quantitate करने के लिएएफपी-moesin, पहले z ढेर की अधिकतम तीव्रता प्रक्षेपण बनाने के लिए और फिर चार लाइन स्कैन आकर्षित GFP-moesin अंगूठी पर (एक दूसरे से 45 डिग्री पर)। अंगूठी व्यास चार लाइन स्कैन (चित्रा 2 बी) के शिखर दूरी के औसत चोटी के रूप में परिभाषित किया गया है। पहले से ही बंद कर दिया है कि छल्ले के लिए, व्यास 0 माइक्रोन के रूप में परिभाषित किया गया है।
    नोट: इस जंगली प्रकार में घाव बंद करने की प्रक्रिया के माध्यम से लगभग आधा रास्ता तय करना है के रूप में एफ actin के छल्ले आसानी से घायल हो गए 1 घंटा पोस्ट मापा जाता है। एफ actin के छल्ले भी घाव बंद होने के एक समय के पाठ्यक्रम प्राप्त करने के लिए कई समय बिंदुओं पर मापा जा सकता है। घाव बंद होने के समय चूक फिल्मों levamisole-immobilized कीड़े का उपयोग करने और कताई डिस्क confocal माइक्रोस्कोपी का अधिग्रहण किया जा सकता है।

एपिडर्मल रोगाणुरोधी पेप्टाइड्स के 5. परख प्रेरण

नोट: लोग घायल हो गए भी सी में सहज प्रतिरक्षा प्रतिक्रिया से चलाता है एलिगेंस त्वचा। रोगाणुरोधी पेप्टाइड्स (AMPS) एन्कोडिंग जीनों के प्रतिलेखन इंडस्ट्रीज़ हैएपिडर्मिस में uced। एनएलपी-29 (न्यूरोपेप्टाइड की तरह प्रोटीन) एएमपी दृढ़ता से चार लोग घायल हो गए द्वारा प्रेरित कर रहा है। एपिडर्मिस लोग घायल हो गए बाद एएमपी अभिव्यक्ति को नियंत्रित करता है कि कैसे अलग-अलग एएमपी प्रतिलेख के स्तर का पता लगाने के लिए ट्रांसजेनिक संवाददाताओं से या वास्तविक समय पीसीआर का उपयोग, परख करने के लिए।

  1. चार लोग घायल हो गए करने के लिए सहज प्रतिरक्षा प्रतिक्रिया के लिए ट्रांसजेनिक संवाददाता परख।
  2. एक आंतरिक नियंत्रण के रूप में पी एनएलपी-29 GFP और पी कर्नल-12- DsRed शामिल है जो ट्रांसजेनिक संवाददाता frIs7 व्यक्त वयस्क जानवरों पर (प्रोटोकॉल एक के रूप में) सुई लोग घायल हो गए प्रदर्शन करते हैं। एक GFP लंबे पास फिल्टर के रूप में गहरे लाल या नारंगी unwounded वयस्क जानवरों को ध्यान से देखें।
    नोट: लोग घायल हो गए जंगली प्रकार के कीड़े पी एनएलपी-29 -GFP अभिव्यक्ति प्रेरित करेगा लेकिन GFP के लंबे पास रोशनी के तहत नारंगी, पीला, हरा या प्रकट होने वाले कीड़े, जिसके परिणामस्वरूप पी कर्नल-12 -dsRed को प्रभावित नहीं करेगा। ऐसे पीएमके-1 या के रूप में p38 MAPK मार्ग में जीन के समारोह के नुकसान nsy-एक रोकेंगे एनएलपी-29 -GFPचार लोग घायल हो गए बाद प्रेरण। पी एनएलपी-29 GFP के लार्वा चरणों में उच्च स्तर पर व्यक्त की है
  3. युवा वयस्क जानवरों में एएमपी प्रेरण assays के प्रदर्शन। Unwounded नियंत्रण जानवरों GFP के निम्न स्तर है कि सुनिश्चित करें।
    नोट: पी एनएलपी-29 GFP अभिव्यक्ति भी आसमाटिक तनाव 8 से प्रेरित है, और अन्य पर्यावरणीय तनाव के प्रति संवेदनशील हो सकता है।
  4. लोग घायल हो गए बाद 6 घंटा, GFP के लंबे पास फिल्टर के साथ गुंजाइश विदारक एक प्रतिदीप्ति का उपयोग कर पी एनएलपी-29 -GFP प्रेरण (चित्रा 3) 9 है कि कीड़े की संख्या स्कोर।
    नोट: एक घंटा के बाद लोग घायल हो गए पी एनएलपी-29 GFP दिख प्रेरित है पर, फिर 6 घंटे के बाद लोग घायल हो गए के बारे में एक शिखर तक पहुंच गया और 24 घंटे बाद लोग घायल हो गए अप करने के लिए ऊपर उठाया शेष। दृश्य स्कोरिंग 4,9 द्वारा अभिव्यक्ति यों। वैकल्पिक रूप से, एक प्रतिदीप्ति सक्रिय कीड़ा सॉर्टर 4 का उपयोग कर अभिव्यक्ति के स्तर यों। कीड़ा सॉर्टर के लिए, कम से कम 50 जानवरों घायल होने की जरूरत है।
  5. योग्यता के लिए वास्तविक समय पीसीआर परखव्यक्तिगत एएमपी जीन की प्रतिलिपि स्तरों ntitating। कई जीनों के लिए परख प्रतिलेख स्तर: एनएलपी-29, एनएलपी-30, सीएनसी-1, और सीएनसी-5।
  6. जंगली प्रकार या उत्परिवर्ती कीड़े पर लोग घायल हो गए सुई प्रदर्शन करना (प्रोटोकॉल 1 देखें)
  7. वांछित समय पर 50 लोग घायल हो गए कीड़े और 50 unwounded कीड़े (जैसे 3, 6, 24 घंटा) के बाद लोग घायल हो गए लीजिए।
  8. शाही सेना के निर्माता के निर्देशों के बाद एक वाणिज्यिक किट का उपयोग कर निकालें।
  9. एक वाणिज्यिक रिवर्स ट्रांसक्रिपटेस किट का उपयोग कर कुल 20 μl सीडीएनए प्राप्त करने के लिए रिवर्स प्रतिलेखन प्रदर्शन करते हैं।
  10. आरटी पीसीआर के लिए, एक हरे रंग की fluorescein साथ Supermix और 0.2 माइक्रोन प्राइमरों के साथ संयोजन में प्रत्येक नमूने से 0.2 μl सीडीएनए (1/40) का उपयोग करें। शाही सेना गुणवत्ता की तुलना करने के लिए, संदर्भ के रूप में ए एम ए-1 या SNB-एक आरटी पीसीआर का उपयोग करें; आंतरिक नियंत्रण (ए एम ए-1 या SNB -1) के लिए सामान्य से एएमपी रिश्तेदार अभिव्यक्ति के स्तर की तुलना, या आदर्श से (घायल कीड़े / unwounded कीड़े में एएमपी प्रेरण) गुना प्रेरण के बाद लोग घायल हो गए तुलनाआंतरिक नियंत्रण करने के लिए alizing।
    नोट: सीएनसी -1 और सीएनसी -5 जिनके प्रतिलेखन 10 लोग घायल हो गए द्वारा सक्रिय है परिवार रोगाणुरोधी पेप्टाइड्स caenacin कर रहे हैं। आमतौर पर, सुई लोग घायल हो गए अभिव्यक्ति लाती है (~ सीएनसी-1 के लिए 500 गुना) 4 घंटा 10 के एक समय के पाठ्यक्रम पर। प्रकाशित काम में इस्तेमाल किया प्राइमर 2 टेबल में सूचीबद्ध हैं।

6. परख जीवन रक्षा के बाद लोग घायल हो गए

  1. नोट: सीए 2 + निर्भर घाव की मरम्मत मार्ग और सहज प्रतिरक्षा प्रतिक्रिया मार्ग: लोग घायल हो गए epidermis में कम से कम दो स्वतंत्र संकेत दे रास्ते सक्रिय। दोनों रास्ते बाँझ लोग घायल हो गए का पूरा अस्तित्व के लिए आवश्यक हैं। एक उत्परिवर्ती या आरएनएआई उपचार घाव भरने को प्रभावित करता है कि क्या परीक्षण करने के लिए, 24-48 घंटा पद लोग घायल हो गए पर अस्तित्व को मापने। वैकल्पिक रूप से, दीर्घायु 4,9 पर लोग घायल हो गए के प्रभाव को निर्धारित करने के लिए पारंपरिक उम्र assays के उपयोग करें।
  2. (युवा वयस्क (L4 + 24 घंटा) कीड़े पर 50 कीड़े लोग घायल हो गए सुई प्रदर्शन करना, दोहराने seveऊपर प्रोटोकॉल एक निम्नलिखित RAL बार)। नियंत्रण के रूप में unwounded कीड़े के एक बराबर संख्या को बनाए रखें।
  3. अस्तित्व (एक नई अगर प्लेट हर 24 घंटे के लिए स्थानांतरण घायल कीड़े) हर 24 घंटे की जाँच करें। ऐसे जीटीएल-2 या TIR-एक, जब सामान्यीकृत unwounded नियंत्रण जानवरों के रूप में घाव की मरम्मत में दोषपूर्ण हैं कि म्यूटेंट में लोग घायल हो गए के बाद 50% अस्तित्व ~ 24 घंटा निरीक्षण करें। मौत कृमि लेने से छूने की हरकत प्रतिक्रिया की कमी के रूप में परिभाषित किया गया है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ऐसे GCaMPs रूप CA सेंसर (चित्रा 1) के साथ कल्पना के रूप में लेजर या सुई लोग घायल हो गए, एपिडर्मल सीए के स्तर में तेजी से और निरंतर ऊंचाई ट्रिगर किया जाएगा। सीए ऊंचाई सेकंड के भीतर होता है, और मिनट के दसियों के लिए ऊंचा रहता है। Reproducibly लोग घायल हो गए सुई घाव साइटों (चित्रा 2) में एफ actin के छल्ले के गठन में यह परिणाम है; इन मिनट के भीतर दिखाई देते हैं, और लोग घायल हो गए के बाद धीरे-धीरे करीब 1-2 से अधिक घंटा। Actin के छल्ले कम अक्सर अधिक सटीक लेजर लोग घायल हो गए के बाद बनते हैं। दोनों सुई और लेजर लोग घायल हो गए ट्रांसक्रिप्शनल संवाददाताओं (चित्रा 3) के साथ पाया एपिडर्मल रोगाणुरोधी पेप्टाइड्स ऐसे एनएलपी-29 के रूप में (AMPS), की अभिव्यक्ति के लिए प्रेरित। एएमपी प्रेरण लोग घायल हो गए के बाद 2-4 घंटे के भीतर स्पष्ट है और लगभग 24 घंटे तक रहता है। जंगली प्रकार की सुई लोग घायल हो गए काफी (घायल हो गए बाद 24 घंटा में मापा) व्यवहार्यता या जीवन अवधि प्रभावित नहीं होना चाहिए।

चित्रा 1
चित्रा 1. लेजर लोग घायल हो गए सी में एक सीए 2 + प्रतिक्रिया से चलाता है एलिगेंस एपिडर्मिस। (ए) एपिडर्मल GCaMP3 प्रतिदीप्ति (पी कर्नल -19 -GCaMP3 (juIs319)) femtosecond लेजर लोग घायल हो गए बाद स्तरों। पूर्वकाल-शरीर में epidermis के पार्श्व दृश्य; एक्स, लेजर घाव; एन, एपिडर्मल नाभिक। कताई डिस्क confocal छवियों, तीव्रता कोड। UW: unwounded, डब्ल्यू:। / एफ 0 GCaMP3 ΔF के घायल (बी) Quantitation 20, 40, और घाव साइट से 60 माइक्रोन से कम; प्रतिनिधि ट्रेस। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 2
चित्रा 2. सुई लोग घायल हो गए घाव स्थल के चारों ओर actin के polymerization के चलाता है। (ए) कर्नल-19- GFP-moesin (juIs352) के साथ कल्पना घाव मार्जिन पर actin के छल्ले, के गठन को ट्रिगर। स्केल: 10 माइक्रोन। UW: unwounded, डब्ल्यू:।। रेखा स्कैन से एक्टिन अंगूठी व्यास के घायल (बी) Quantitation, पशु प्रति चार लाइन स्कैन (पैनल में लाल लाइनों बिंदीदार (ए), गुम्मट) यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 3
चित्रा 3. एपिडर्मल लोग घायल हो गए सहज प्रतिरक्षा प्रतिक्रिया को सक्रिय करता है। छवियों प्रतिनिधि सुई लोग घायल हो गए के बाद पी एनएलपी-29 -GFP (frIs7) प्रेरण की (गुम्मट unwounded, गुम्मट 3 घंटा घायल)। स्केल:। 200 माइक्रोन एक देखने के लिए यहां क्लिक करेंइस आंकड़े का बड़ा संस्करण।

रिपोर्टर Transgene रोशनी एलील
कैल्शियम Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 एक्स
Actin Pcol-19-GFP :: moesin GFP juIs352 मैं
एनएलपी-29 Pnlp-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 चतुर्थ

घाव प्रतिक्रिया assays में इस्तेमाल किया तालिका 1. transgenes। इस तालिका में chromosomally Caenorhabditis जेनेटिक्स केंद्र (http://www.cbs.umn.edu/research/resources/cgc) पर उपलब्ध ट्रांसजीन एकीकृत सूचीबद्ध करता है।

जीन नाम अनुक्रम
एनएलपी-29 एफ: cttctcgcctgcttcatggc
आर: gtccgtatccaccatatcctcc
एनएलपी-30 एफ: TTCTTCTCGCCTGCTTCATGG
आर: CATAACCTCTACCATATCCACCG
सीएनसी-1 एफ: gccattgtcgccatttcctc
आर: cctccatacattggatatcctc
सीएनसी -5 एफ: CTTCTTCTAGCAATGCTCGCTC
आर: GTATCCTCCACCATACCCTCC
ए एम ए-1 एफ: ACTCAGATGACACTCAACAC
आर: GAATACAGTCAACGACGGAG
SNB-1 एफ: tccagcagacacaagctcagg
आर: gagacaacttctgatcacgctc

एएमपी टेप के आरटी पीसीआर के लिए इस्तेमाल तालिका 2 प्राइमरों। एकाग्रता काम कर रहा है 0.2 माइक्रोन। SNB-एक आंतरिक नियंत्रण के रूप में कार्य करता है।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

सुई और लेजर लोग घायल हो गए के लिए यहाँ प्रस्तुत तरीकों क्षति की मरम्मत के लिए एपिडर्मल उपकला की क्षमता का आकलन करने के लिए पूरक दृष्टिकोण प्रदान करते हैं। सुई लोग घायल हो गए एपिडर्मिस, छल्ली, और संभावना आंतरिक तहखाने झिल्ली बाधित जबकि लेजर लोग घायल हो गए, एपिडर्मिस तक ही सीमित किया जा सकता है अपेक्षाकृत स्थानीय और (लेजर विन्यास पर निर्भर करता है) है। सुई लोग घायल हो गए और अधिक सही रोगजनकों या प्राकृतिक वातावरण में यांत्रिक क्षति के कारण घाव जैसे लगते हैं। एक नियम के रूप में, सुई लोग घायल हो गए पशु अस्तित्व के साथ संगत कर रहे हैं कि सटीक घावों को प्राप्त करने के लिए और अधिक अभ्यास की आवश्यकता है। सुई और लेजर लोग घायल हो गए प्रदर्शन कई समानताएं के लिए सेलुलर के हिमायती हैं। हालांकि यह actin के छल्ले के गठन reproducibly femtosecond लेजर लोग घायल हो गए के बाद नहीं मनाया जाता है कि ध्यान दिया जाना चाहिए।

यह भी सुई जिनके योगदान कीड़ा को नुकसान आंतरिक ऊतकों: सुई पंचर की एक सीमा है कि यह एक सटीक घाव नहीं हैअस्तित्व की जांच नहीं की गई है। इस प्रोटोकॉल का एक संभावित संशोधन और अधिक सटीक भौतिक लोग घायल हो गए प्रदर्शन करने के लिए microfluidic आधारित microinjection प्रणाली 11 और फ्लोरोसेंट संवाददाताओं से गठबंधन करने के लिए किया जाएगा।

यहाँ विस्तृत सुई और लेजर लोग घायल हो गए तरीकों का यह चुनौतीपूर्ण घाव प्रतिक्रिया के लक्षण वर्णन करने के लिए जीनोमिक या जैव रासायनिक तरीकों का उपयोग करने के लिए कर रही है, अभी तक काफी श्रम गहन है, और सबसे अच्छे रूप में मध्यम throughput के सरल कर रहे हैं। ऐसे कवक या प्रोटोजोआ 12,13 के रूप में छल्ली मर्मज्ञ रोगज़नक़ों जानवरों की बड़ी आबादी के लिए दिया जा सकता है, और लोग घायल हो गए के जवाब के साथ ओवरलैप है कि प्रतिक्रियाओं को ट्रिगर, अभी तक रोगज़नक़ विशिष्ट प्रतिक्रियाओं के अतिरिक्त जटिलताओं को पेश हो सकता है। इसके अलावा काम ऐसे बैलिस्टिक बमबारी 14 या micromechanical भेदी संरचनाओं 15 सरणियों के रूप में अन्य अजैव तरीकों का बड़े पैमाने पर लोग घायल हो गए के लिए अनुकूलित किया जा सकता है कि क्या पता लगाने के लिए आवश्यक हो जाएगा।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics