Los métodos para la piel Heridas y ensayos para Respuestas de heridas en

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El C. elegans epidermis y cutícula forman una sencilla capa de piel y sofisticado que puede reparar daños localizados resultante de la herida. Los estudios de las respuestas de la herida y la reparación en este modelo han iluminado nuestro entendimiento del citoesqueleto y respuestas genómicas a daños en los tejidos. Los dos métodos más comúnmente utilizados para lesionar al C. elegans piel del adulto son pinchazos con agujas de microinyección y la irradiación láser local. Aguja hiriendo localmente altera la cutícula, la epidermis, y la matriz extracelular asociada, y también puede dañar los tejidos internos. Resultados de irradiación láser en daños más localizado. Heridas desencadena una sucesión de respuestas ensayadas fácilmente incluyendo elevada epidérmica Ca 2+ (segundo minutos), la formación y el cierre de un anillo que contiene actina en el sitio de la herida (1-2 horas), elevado transcripción de genes de péptidos antimicrobianos (2-24 hr), y la formación de cicatrices. Esencialmente, todos los animales adultos silvestres sobreviven herida, dondecomo mutantes defectuosos en la reparación de heridas u otras respuestas muestran una menor supervivencia. Se presentan los protocolos detallados de aguja y las heridas de láser, y ensayos para la cuantificación y visualización de las respuestas de la herida y los procesos de reparación (dinámica de Ca, la dinámica de actina, la inducción péptido antimicrobiano y supervivencia).

Introduction

Mecanismos de curación de heridas en la piel son de interés biológico básico y relevante para la salud humana. La cicatrización de heridas en los vertebrados y mamíferos comprende una compleja serie de respuestas coordinadas de múltiples tejidos y de señalización 1. Muchos simples organismos modelo genético también son capaces de curar las heridas de la piel 2. Por tanto, es de interés analizar modelos genéticamente tratables de la reparación de heridas de la piel. Nosotros y otros han comenzado a utilizar Caenorhabditis elegans como nuevo modelo para la curación de heridas de la piel 3,4. El objetivo de este protocolo es permitir a un conjunto más amplio de investigadores de utilizar C. elegans como una herramienta para investigar los mecanismos moleculares y celulares de la epidermis cicatrización de la herida.

El C. piel elegans comprende la epidermis (también conocidos como hipodermis) y la cutícula extracelular 5. La epidermis adulto se forman a partir de un pequeño número de sincitios multinucleados, de los cuales el más grande es el sincitio known como hyp7. La epidermis es un epitelio simple que segrega la cutícula en su superficie apical. La piel puede defenderse activamente contra los patógenos que penetran en la piel y reparar pequeñas heridas 4. La reparación de heridas de la C. piel elegans es robusta, ya que casi todos los animales de tipo salvaje sobreviven pueden sobrevivir pequeñas heridas punzantes causadas por agujas o daño local de la piel causada por la irradiación láser. C. heridas de la piel elegans desencadena una serie de respuestas, incluyendo una respuesta inmune innata epidérmico, cierre de la herida, y la formación de cicatrices 4. La epidermis adultos es post-mitótico, y cicatrización de heridas implica respuestas celulares locales en oposición a la proliferación epidérmica o la migración celular. Hemos demostrado que las heridas de la piel provoca un aumento grande y sostenido en epidérmica Ca 2+, requiriendo el canal de TRPM membrana GTL-2 e internos Ca 2 + tiendas 3. Se requiere señal El epidérmica Ca 2+ para la formación y el cierre de los anillos F-actina en el wositio und. Heridas también induce la respuesta inmune innata que activan la transcripción de AMPs como PNL-29. La transcripción inducida por heridas de AMP depende de una TIR-1 / PMK-1 p38 MAP quinasa cascada que actúa de forma autónoma en la epidermis 4. Los defectos en cualquiera de la vía de señalización de Ca2 + o en la respuesta inmune innata dará lugar a una menor supervivencia después de la herida. La estructura relativamente simple de la C. elegans epidermis, su maleabilidad genética y ventajas en vivo de imágenes hacen que sea un excelente sistema para estudiar varios aspectos de la reparación de la herida.

Aquí presentamos los protocolos para los dos métodos comunes de heridas: las heridas de aguja y lesiones láser. Herida de la aguja no requiere equipo especializado (que no sea el extractor de aguja), y con la experiencia se puede realizar en cientos de gusanos por día. Heridas de aguja se realiza en animales en crecimiento en placas de agar. Por el contrario, las heridas de láser se realiza en Anesanimales anestesiados montados en agar almohadillas bajo un cubreobjetos, y es adecuado para imágenes en vivo de las respuestas celulares a los daños.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Los siguientes protocolos describen el procedimiento detallado para C. piel elegans hiriendo y para analizar las respuestas de la herida.

1. Aguja hiriente 3,4

  1. Crecer gusanos unstarved saludables en placas con E. estándar NGM (medio de crecimiento de nematodos) bacterias coli OP50 como alimentos, mantenidos en una incubadora a 20 °.
    NOTA: Los métodos para placas de agar NGM y el cultivo de rutina de C. elegans se puede encontrar en www.wormbook.org 6.
  2. Escoja 25 L4 etapa gusanos a un recién sembrado placa 1 día antes de herir y de la cultura a 20 ° CO / N.
  3. Antes de herir, tire agujas de los capilares utilizando un extractor de aguja. Las agujas utilizadas en la herida son idénticos a los utilizados para la microinyección de C. elegans.
  4. Asegúrese de que todos los gusanos están en etapa adulta joven. Colocar la placa de gusanos en hielo durante aproximadamente 30 min. El enfriamiento provoca que los animales sean lentos, facilitando heridas aguja.
  5. Retire la placa de agar del hielo a un microscopio estereoscópico de disección. Usando una selección gusano, mover 25 gusanos en el centro de la placa de agar.
  6. Coloque la aguja en una punta de pipeta 100 l para mantener más fácilmente la aguja. Perforar la parte anterior o posterior del cuerpo del gusano con la aguja, evitando la gónada. En general, tratar de la herida entre la faringe posterior y anterior de las gónadas, o entre la gónada posterior y el recto. Reutilice las agujas muchas veces, hasta que se rompen.
    NOTA: Asegúrese de que las heridas son breves, pinchazos suaves que perforan la cutícula y la piel, penetrando ~ 5-10 micras en el animal. La aguja debe entrar en el animal aproximadamente a un ángulo recto a la piel. Las heridas no deben causar daños evidentes a los órganos internos, o ruptura inmediata del cuerpo. Observar una pequeña cantidad de citoplasma que rezuma durante unos segundos después de la herida; Sin embargo, si el contenido celular de fugas a lo largo de un tiempo prolongado los animales no sobrevivirán. Para imágenes óptima, la herida del sincitio lateral epidérmico (hyp7) o la costura lateral.
    Nota: Este procedimiento incluye el uso de una aguja de cristal.
  7. Permitir que los gusanos se recuperen a TA entonces la cultura a 20 ° C. Juzgar el éxito de la herida de la aguja por una serie de ensayos descritos a continuación. Más del 95% de los animales de tipo salvaje sobrevive 24 horas después de la aguja hiriendo en la etapa adulta joven. El efecto de herir en larvas o adultos mayores que aún no ha sido ampliamente analizado.

2. Láser Heridas 3

Utilice la irradiación láser de femtosegundo (800 nm) para realizar las heridas más preciso.

  1. Preparar p agaranuncios en un portaobjetos de vidrio derretido con agar al 2% 7. Asegúrese de que las almohadillas son similares a las pastillas de agar utilizados para imágenes en vivo de C. elegans.
  2. Transfiera 10 gusanos adultos jóvenes en la almohadilla de agarosa con recogida gusano, y añadir una gota 2 l de 12 mM solución Levamisol. Cubra los animales y el líquido con una hoja de la cubierta. Espere 1-2 minutos para que los gusanos paralizan.
  3. Colocar el portaobjetos en un microscopio confocal de disco giratorio. Mueva el escenario para encontrar los gusanos y se centran en la parte anterior o posterior sincicial epidermis laterales con un objetivo 100X (NA 1,4 a 1,46).
  4. Ajustar la potencia del láser de femtosegundo a 140 mW (medido antes de que el objetivo). Utilizar el láser de femtosegundos a una velocidad de repetición de 80 MHz.
    NOTA: Dos pulsos de 200 ms cada uno (separados por 20 ms) son suficientes para herir en nuestras manos.
  5. Centrarse en la superficie apical de la célula epidérmica y la herida de la epidermis. Observe interrupción local del citoplasma (burbujeo), o o blanqueo localesf cualquier marcador fluorescente usada.
    NOTA: Siga los procedimientos de seguridad láser apropiadas cuando se utiliza el láser de femtosegundo. Línea o un punto de exploraciones mediante rayos láser de femtosegundos, como los de dos microscopios de fotones deben proporcionar suficiente energía para herir láser.
    NOTA: Si bien no tenemos experiencia directa de la utilización de otros láseres, en principio herida debe ser posible el uso de láser UV convencionales (como se usa en C. elegans ablaciones celulares). Opcionalmente, utilice un FRAP (FRAP) Módulo de hilado confocal de disco para herir la epidermis (N. Pujol, comunicación personal).

3. Visualización de Respuestas epidérmico Ca 2+ a heridas

  1. Utilice transgénico C. elegans cepas que expresan Ca 2+ sensores (tales como los de la serie GCaMP) en la epidermis, bajo el control del promotor específico de epidérmica adulto col-19 (Figura 1A; transgenes se enumeran en NOTA: Hemos utilizado tdTomato como control interno para la expresión transgénica como fluorescencia tdTomato epidérmica es relativamente estable y no interfiere con imágenes GCaMP.
  2. Tanto la aguja y el láser hiriendo gatillo Ca 2+ elevación en la epidermis. Sin embargo, como la herida de la aguja no se puede realizar fácilmente en un disco giratorio confocal, heridas láser es preferible para el análisis cuantitativo de la Ca 2 + respuesta (Figura 1).
  3. Adquirir imágenes de lapso de tiempo en el modo de adquisición multidimensional (tiempo de intervalo de 2 segundos con 114 ms exposición láser de excitación) utilizando un confocal hilado disco con objetivo de 100X (NA 1,4 a 1,46) y conjuntos de filtros adecuados (filtros GFP trabajarán para GCaMP3).
    NOTA: Adquirir imágenes de lapso de tiempo cada 30 segundos durante aproximadamente 2 horas para examinar el Ca 2+ respOnse a hiriendo a más de un curso de tiempo más largo.
  4. El uso de software de análisis de imágenes medir la fluorescencia media GCaMP en diez regiones equivalentes de interés (ROI), cinco de los cuales se centran en el citoplasma de las células epidérmicas y cinco en el fondo.
  5. Obtener la fluorescencia de línea de base (F 0) por un promedio de fluorescencia en 5 ROIs en la epidermis luego restando la media de 5 ROIs en el fondo antes de la lesión. Expresar el cambio en la fluorescencia Delta F como la relación de cambio con respecto a la línea de base [(F t -F 0) / F 0].

4. Visualización de Dynamics F-actina después de la herida

  1. NOTA: En respuesta a heridas de la aguja, observar un anillo de actina en el sitio de la herida que se cierra poco a poco alrededor de la herida. Esta sección protocolo ensayos de cierre de la herida mediante la medición del diámetro del anillo de actina.
  2. Generar gusanos transgénicos que expresan un marcador de F-actina como el dominio de unión a actina moesina Drosophila fusionado aGFP, expresa bajo el control de un promotor específico epidérmico tales como col-19 (Figura 2A) (transgén juIs352).
    NOTA: Hemos obtenido resultados similares utilizando otros marcadores vinculante de dominio como Lifeact o F-tractin (resultados no publicados) actina.
  3. Realizar aguja hiriendo en P col-19- gusanos transgénicos-GFP moesina. Después de las heridas de aguja, observar un anillo de GFP-moesina alrededor del sitio de la herida por ~ 5 min. El anillo de actina se hace más pequeño en diámetro y, finalmente, se cierra 2-3 h después de heridas en animales de tipo salvaje (Figura 2a).
  4. Preparar una almohadilla de agar 2% en un portaobjetos de vidrio y transferir 10 gusanos en la almohadilla en 2 l solución 12 mM Levamisol. Imagen de los anillos de GFP-Moesin 1 hora después de la herida mediante microscopía confocal convencional.
    NOTA: El uso de microscopía confocal para adquirir z-pilas (13 x 0,5 m) de los anillos de actina 1 hora después de la herida.
  5. Mida el diámetro del anillo de actina después de la herida. Para cuantificar epidérmica GFP-moesina, primero hacer una proyección de máxima intensidad de la z-pila y luego dibujar 4 exploraciones de línea (a 45 ° entre sí) sobre el anillo de GFP-moesina. Diámetro del anillo se define como la distancia media de pico pico de las cuatro exploraciones de línea (Figura 2B). Para anillos que ya han cerrado, el diámetro se define como 0 m.
    NOTA: F-actina anillos se miden convenientemente 1 h después de herir, ya que es aproximadamente la mitad del proceso de cierre de la herida en el tipo silvestre. Anillos de F-actina se pueden medir también en varios puntos de tiempo para derivar un transcurso de tiempo de cierre de la herida. Tiempo películas de lapso de cierre de la herida pueden ser adquiridos usando gusanos levamisol inmovilizada y girando microscopía confocal de disco.

5. ensayo de inducción de péptidos antimicrobianos epidérmicas

NOTA: Heridas también desencadena la respuesta inmune innata en la C. piel elegans. La transcripción de los genes que codifican péptidos antimicrobianos (AMP) es induced en la epidermis. La PNL-29 (proteína-neuropéptido similares) AMP está fuertemente inducida por hiriendo a 4. Para ensayar cómo la epidermis controla la expresión AMP después de la herida, utilizar reporteros transgénicos o PCR en tiempo real para detectar los niveles individuales de transcripción AMP.

  1. Reportero de ensayo transgénico para la respuesta inmune innata a hiriendo a 4.
  2. Realizar la herida de la aguja (como en el protocolo 1) en los animales adultos que expresan el reportero transgénico frIs7, que contiene P PNL-29- GFP y col P-12 DsRed como un control interno. Observar los animales adultos no heridos rojos tan oscuro o naranja en un filtro de paso largo GFP.
    NOTA: Herir gusanos de tipo salvaje inducirán P PNL-29-GFP expresión, pero no afectarán P col-12 -dsRed, resultando en gusanos que aparecen de color naranja, amarillo o verde bajo GFP iluminación pase largo. Pérdida de la función de genes en la vía MAPK p38, tales como PMK-1 o NSY-1 bloqueará PNL-29-GFPinducción después de herir 4. GFP P PNL-29- se expresa en altos niveles en los estadios larvarios
  3. Realizar ensayos de inducción de AMP en animales adultos jóvenes. Asegúrese de que los animales de control no heridos tienen bajos niveles de las buenas prácticas agrarias.
    NOTA: P PNL-29- expresión de GFP también es inducida por estrés osmótico 8, y puede ser sensible a otras tensiones ambientales.
  4. 6 horas después de la herida, la puntuación de los números de gusanos que tienen P PNL-29-GFP inducción (Figura 3) 9 utilizando una fluorescencia de disección alcance con filtro de paso largo GFP.
    NOTA: En 1 hora después de la herida P PNL-29- GFP se induce visiblemente, alcanzando un pico de aproximadamente 6 horas después de la herida y luego permanecer elevada hasta después de la curación 24 hr. Cuantificar la expresión de un 4,9 de puntuación visual. Alternativamente, cuantificar los niveles de expresión utilizando una fluorescencia activada gusano clasificador 4. Para el clasificador de gusano, al menos 50 animales necesitan ser heridos.
  5. Ensayo de PCR en tiempo real para quantitating niveles de transcripción de los genes AMP individuales. Niveles de transcripción de ensayo para varios genes: PNL-29, PNL-30, cnc-1, y cnc-5.
  6. Realizar aguja hiriendo en de tipo salvaje o gusanos mutantes (véase el protocolo 1)
  7. Recoge 50 gusanos heridos y 50 gusanos no heridos en los tiempos deseados (por ejemplo, 3, 6, 24 horas) después de la herida.
  8. Extracto de ARN utilizando un kit comercial siguiendo las instrucciones del fabricante.
  9. Realizar la transcripción inversa para obtener cDNA total de 20 l usando un kit comercial de la transcriptasa inversa.
  10. Para RT-PCR, utilice 0,2 l de cDNA (1/40) de cada muestra en combinación con un Supermix verde con fluoresceína y 0,2 mM cebadores. Para comparar la calidad del ARN, utilice ama-1 o snb-1 RT-PCR como referencia; comparar el nivel de expresión relativa AMP mediante la normalización de control interno (ama-1 o snb-1), o comparar veces de inducción después de la herida (AMP inducción en gusanos heridos / gusanos no heridos) por normaalizing al control interno.
    NOTA: cnc-1 y cnc-5 se caenacin familiares péptidos antimicrobianos cuya transcripción se activa por hiriendo a 10. Típicamente, la herida de la aguja induce la expresión (~ 500 veces para CNC-1) durante un transcurso de tiempo de 4 h 10. Los cebadores utilizados en los trabajos publicados se enumeran en la Tabla 2.

6. Ensayo de supervivencia después de la herida

  1. NOTA: Heridas activa al menos dos vías de señalización independientes de la epidermis: la herida dependen de la vía Ca 2+ reparación y la ruta de respuesta inmune innata. Se requieren ambas vías para la supervivencia lleno de heridas estéril. Para probar si un mutante o tratamiento RNAi afecta a la curación de heridas, la supervivencia a medir después de la curación de 24-48 hr. Opcionalmente, utilice ensayos de vida útil convencionales para determinar el efecto de herir en la longevidad 4,9.
  2. Realizar aguja hiriendo al joven adulto (L4 + 24 hr) gusanos (50 gusanos, repita seveveces ral) siguiendo el protocolo 1 anterior. Mantener un número equivalente de gusanos ilesos como controles.
  3. Compruebe la supervivencia cada 24 horas (de transferencia gusanos heridos a una nueva placa de agar cada 24 horas). Observe ~ 50% de supervivencia a las 24 horas después de la herida en los mutantes que son defectuosos en la reparación de heridas, como GTL-2 o tir-1, cuando se normalizaron a los animales de control no heridos. La muerte se define como la falta de respuesta locomotora a tocar por selección gusano.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Láser o heridas aguja activarán elevación rápida y sostenida de los niveles de Ca epidérmicas, como se visualiza con sensores de Ca como GCaMPs (Figura 1). La elevación Ca se produce en cuestión de segundos, y sigue siendo elevado durante decenas de minutos. Aguja hiriendo reproducible resulta en la formación de anillos de F-actina en los sitios de la herida (Figura 2); éstos aparecen en cuestión de minutos, y poco a poco cerca sobre 1-2 horas después de la herida. Anillos de actina se forman con menos frecuencia después de herir láser más preciso. Tanto la aguja y el láser de heridas epidérmicas inducir la expresión de péptidos antimicrobianos (AMP), tales como PNL-29, detectados con los reporteros transcripcionales (Figura 3). AMP inducción es evidente dentro de 2-4 horas después de la herida y tiene una duración de aproximadamente 24 horas. Herida de la aguja de la de tipo salvaje no debería afectar significativamente la viabilidad (medido a las 24 h después de la herida) o tiempo de vida.

Figura 1
Figura 1. heridas Laser desencadena una respuesta de Ca2 + en el C. epidermis elegans. (A) epidérmico GCaMP3 fluorescencia (P col-19 -GCaMP3 (juIs319)) niveles después de herir láser de femtosegundo. Vista lateral de la epidermis en antero-cuerpo; x, herida láser; N, núcleo epidérmica. Spinning confocal de imágenes de disco, código intensidad. UW: no herido, W:. Heridos (B) Cuantificación de GCaMP3? F / F 0 a 20, 40 y 60 micras en el sitio de la herida; rastro representante. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Aguja heridas desencadena la polimerización de actina alrededor del sitio de la herida. (A) col-19- GFP-moesina (juIs352). Escala: 10 micras. UW: no herido, W:.. Heridos (B) Cuantificación de diámetro del anillo de actina de las exploraciones de línea, 4 exploraciones de línea por animal (líneas de puntos rojos en el panel (A), WT) Haga clic aquí para ver una versión más grande de esta figura.

Figura 3
Figura 3. epidérmico heridas activa la respuesta inmune innata. Imágenes representativas (WT ileso, WT herido + 3 h) de P PNL-29-GFP (frIs7) inducción después de herir aguja. Escala:. 200 m Haga clic aquí para ver unaversión más grande de esta cifra.

Reportero Transgén Fluorescencia Alelo
Calcio PCOL-19-GCaMP3; PCOL-19-tdTomato GFP / tdTomato juIs319 X
La actina -19 PCOL-GFP :: moesina GFP juIs352 I
PNL-29 PNLP-29-GFP / PCOL-12-DsRed GFP / DsRed frIs7 IV

Tabla 1. Los transgenes usados ​​en ensayos de respuesta de la herida. Esta tabla muestra los transgenes disponibles en el Centro de Genética Caenorhabditis (http://www.cbs.umn.edu/research/resources/cgc) cromosómicamente integrado.

Gen Secuencia
PNL-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
PNL-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabla 2. Los cebadores utilizados para la RT-PCR de los transcritos de amplificador. La concentración de trabajo es de 0,2 M. Snb-1 sirve como control interno.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Los métodos presentados aquí por aguja y lesiones láser ofrecen enfoques complementarios para evaluar la capacidad del epitelio epidérmico para reparar los daños. Herida láser es relativamente localizado y (dependiendo de la configuración del láser) puede limitarse a la epidermis, mientras que la herida de la aguja interrumpe la epidermis, la cutícula, y membranas basales internos probables. Heridas de aguja puede parecerse más precisión las heridas infligidas por agentes patógenos o daños mecánicos en el medio natural. Como regla general, la herida de la aguja requiere más práctica para lograr heridas precisas que son compatibles con la supervivencia animal. Las respuestas celulares a agujas y visualización heridas láser muchas similitudes. Sin embargo hay que señalar que la formación de anillos de actina no se observa de forma reproducible después de la herida láser de femtosegundo.

Una limitación de punción de la aguja es que no es una herida precisa: la aguja también daña los tejidos internos cuyas contribuciones al gusanosupervivencia no han sido investigados. Una posible modificación de este protocolo sería combinar el sistema de microinyección basado en microfluidos 11 y los reporteros fluorescentes para realizar herida física más precisa.

Los métodos hirientes agujas y láser se detallan aquí son sencillas pero bastante mano de obra, y en el mejor de mediano rendimiento, por lo que es difícil de usar enfoques genómicos o bioquímicas para la caracterización de la respuesta de la herida. Cutícula penetrante patógenos como hongos o protozoos 12,13 pueden ser entregados a las poblaciones más grandes de animales, y pueden desencadenar respuestas que se superponen con la respuesta a heridas, sin embargo, introducir complejidades adicionales de respuestas específicas de patógenos. Se requiere trabajo adicional para explorar si otros métodos abióticos como el bombardeo balístico 14 o arrays de estructuras de perforación micromecánicas 15 pueden adaptarse para herir a gran escala.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics