Metoder för Skin såra och Analyser för Wound-svar i

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den C. elegans epidermis och nagelband bildar en enkel men sofistikerad hudlagret som kan reparera lokaliserad skada till följd av att såra. Studier av lindade svar och reparation i denna modell har belyst vår förståelse av cytoskelettala och iska reaktioner på vävnadsskada. De två vanligaste metoderna för att såra C. elegans vuxen hud är idioter med mikroinjektion nålar och lokal laserstrålning. Needle såra lokalt stör nagelband, epidermis, och tillhörande extracellulära matrix, och kan även skada inre vävnader. Laserbestrålning resulterar i mer lokala skador. Sårskada utlöser en följd av lätt analyserade responser inklusive förhöjd epidermal Ca2 + (sekunder-minuter), bildning och stängning av en aktin-innehållande ringen vid sårstället (1-2 h), förhöjd transkription av antimikrobiella peptidgener (2-24 hr), och ärrbildning. I huvudsak alla vildtyp vuxna djuren överlever sårskada, därsom mutanter defekta i sårläkning eller andra svar visar minskad överlevnad. Detaljerade protokoll för nål och laser såra, och analyser för kvantifiering och visualisering av lindade svar och reparationsprocesser (Ca dynamik, aktin dynamik, antimikrobiell peptid induktion, och överlevnad) presenteras.

Introduction

Hud sårläkning mekanismer är av grundläggande biologiskt intresse och relevans för människors hälsa. Sårläkning hos vertebrater och däggdjur innefattar en komplex serie samordnade svaren från flera vävnader och signalsystem 1. Många enkla genetiska modellorganismer har också förmåga att läka hudsår 2. Det är därför av intresse att analysera genetiskt lätthanterliga modeller av hudsår reparation. Vi och andra har börjat använda Caenorhabditis elegans som ny modell för huden sårläkning 3,4. Målet med detta protokoll är att möjliggöra en bredare uppsättning forskare att använda C. elegans som ett verktyg för att undersöka molekylära och cellulära mekanismer av epidermal sårläkning.

Den C. elegans huden omfattar epidermis (även känd som huden) och den extracellulära nagelband 5. De vuxna epidermis bildas från ett litet antal multinucleate syncytia, varav den största är den syncytium kNown som hyp7. Epidermis är en enkel epitel som utsöndrar nagelband på sin apikala yta. Huden kan aktivt försvara mot hud-penetrerande patogener och reparera små sår fyra. Wound reparation av C. elegans hud är robust, eftersom nästan alla vildtyp djur överlever kan överleva små sticksår ​​orsakade av nålar, eller lokala hudskador orsakade av laserstrålning. C. elegans huden sårskada utlöser en svit av svaren, inklusive en epidermal medfödda immunsvar, sårtillslutning och ärrbildning 4. De vuxna epidermis är post-mitotiska och sårläkning involverar lokala cellulära svar i motsats till epidermal proliferation eller cellmigration. Vi har visat att huden sårskada utlöser en stor och varaktig ökning av epidermal Ca2 +, kräver membran TRPM kanalen GTL-2 och interna Ca 2 + butiker 3. Den epidermal Ca2 + signal krävs för bildning och nedläggning av F-aktin ringar på wound plats. Såra inducerar också medfödda immunsvar som aktiverar transkriptionen av AMPs såsom NLP-29. Den sårskada-inducerad transkription av AMPs är beroende av en TIR-1 / PMK-1 p38 MAP-kinaskaskad som agerar autonomt i epidermis 4. Defekter i antingen Ca2 + signalväg eller i det medfödda immunsvaret kommer att leda till lägre överlevnad efter sårskada. Den relativt enkla struktur C. elegans epidermis, dess genetiska spårbarhet och fördelar för in vivo imaging gör den till ett utmärkt system för att studera flera aspekter av sårläkning.

Här presenterar vi protokoll för de två vanligaste metoderna för sårskada: nål sårskada och laser sårskada. Needle såra kräver ingen specialutrustning (annat än nålen avdragare), och med erfarenhet kan utföras på hundratals maskar per dag. Needle såra utförs på djur som växer på agarplattor. Däremot är laser såra utförs på Anesthetized djur monterade på agar kuddar under ett täck, och är lämplig för levande avbildning av de cellulära svaren på skador.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Följande protokoll beskriver detaljerat förfarande för C. elegans huden såra och för analys lindade svar.

1. Nål sårskada 3,4

  1. Odla friska unstarved maskar på standard NGM (nematod tillväxtmedium) plattor med E. coli OP50 bakterier som mat som finns i ett 20 ° C inkubator.
    OBS: Metoder för NGM agarplattor och rutin odling av C. elegans kan hittas på www.wormbook.org 6.
  2. Pick 25 L4 scen maskar till en nyligen seedade platta 1 dag innan såra och kultur vid 20 ° CO / N.
  3. Innan såra, drar nålar från kapillärer med en nål avdragare. De nålar som används vid sårbildning är identiska med de som används för mikroinjektion av C. elegans.
  4. Se till att alla maskar är i ung vuxen skede. Placera plattan av maskar på is under ca 30 min. Kylning orsakar djuren att vara trög, underlättar nål såra.
  5. Avlägsna agarplatta från isen till en dissekera stereomikroskop. Med användning av en mask plocka, flyttar 25 maskar in i centrum av agarplattan.
  6. Placera nålen i en 100 l pipettspets att lättare hålla nålen. Punktering den främre eller bakre delen av kroppen av masken med nålen, undvika gonad. I allmänhet försöker lindad mellan den bakre svalget och främre gonad, eller mellan den bakre gonad och ändtarmen. Återanvänd nålar många gånger, tills de går sönder.
    OBS: Se till såren är korta, milda idioter som punktera nagelband och hud, genomträngande ~ 5-10 um i djuret. Nålen bör ange animal i ungefär rät vinkel mot huden. Såren bör inte orsaka synliga skador på inre organ, eller omedelbar bristning av kroppen. Observera en liten mängd cytoplasman sipprar ut under några sekunder efter såret; om emellertid cellulära innehåll läcker ut över en förlängd tid som djuren inte kommer att överleva. För optimal avbildning, sår sido epidermal syncytium (hyp7) eller sidosömmen.
    OBS: Denna procedur innefattar användning av en glasålen.
  7. Låt maskar att återhämta sig vid RT då kulturen vid 20 ° C. Bedöm framgång nålen sårskada av ett antal analyser som beskrivs nedan. Mer än 95% av vildtyp djur överlever 24 timmar efter nålen såra i unga vuxna stadiet. Effekten av sårskada i larver eller äldre vuxna har ännu inte analyserats.

2. Laser sårskada 3

Använd femtosecond laserstrålning (800 nm) för att utföra mer exakt sårande.

  1. Förbered agar pannonser på en glasskiva med smält 2% agar 7. Se till att elektroderna liknar de agar dynor används för live avbildning av C. elegans.
  2. Överför 10 unga vuxna maskar på agarosen pad med mask plocka, och lägg till en 2 pl droppe 12 mM levamisol lösning. Täck djuren och vätskan med ett täckglas. Vänta 1-2 min för maskarna att förlama.
  3. Placera glasskiva på en snurrande skiva konfokalmikroskop. Flytta scenen för att hitta maskar och fokusera på de laterala främre eller bakre syncytiala epidermis med 100X objektiv (NA 1,4-1,46).
  4. Ställ kraften i femtosecond laser till 140 mW (mätt före mål). Använd femtosecond laser en repetitionsfrekvens på 80 MHz.
    OBS: Två pulser av 200 msek vardera (separerade med 20 msek) är tillräckliga för att såra i våra händer.
  5. Fokus på den apikala ytan av epidermal cellen och sår epidermis. Beakta lokala störningar i cytoplasman (bubblande), eller lokal blekning of fluorescerande markör som används.
    OBS: Följ lämpliga laser säkerhetsrutiner vid användning av femtosecond laser. Linje eller punkt skannar med hjälp femtosekundslasrar som de i två fotonmikroskop bör ge tillräcklig effekt för laser sårskada.
    OBS: Även om vi inte har direkt erfarenhet av att använda andra lasrar i princip såra bör vara möjligt att använda konventionella UV-lasrar (som används i C. elegans cell ablationer). Du kan också använda en fluorescens återhämtning efter fotoblekning (FRAP) modul på spinning disk konfokala att såra epidermis (N. Pujol, personlig kommunikation).

3. Visualisering av Epidermal Ca2 + Svar på sårskada

  1. Använd transgen C. elegans stammar som uttrycker Ca 2 + sensorer (såsom de i den GCaMP serien) i epidermis, under kontroll av den vuxna epidermal specifika promotorn col-19 (Figur 1A; transgener är listade i OBS: Vi har använt tdTomato som en intern kontroll för transgen expression såsom epidermal tdTomato fluorescens är relativt stabil och stör inte GCaMP avbildning.
  2. Både nål och laser såra trigger Ca2 + höjd i epidermis. Men eftersom nålen sårskada inte lätt kan utföras på en snurrande skiva konfokala, är laser sårskada föredra för kvantitativ analys av Ca2 + respons (figur 1).
  3. Förvärva tid förfaller bilder i flerdimensionell förvärvsläge (intervalltid 2 sek med 114 ms excitation laserexponering) med hjälp av en roterande skiva konfokala med 100X objektiv (NA 1,4-1,46) och lämpliga filteruppsättningar (GFP filter kommer att arbeta för GCaMP3).
    OBS: Förvärva time-lapse bilder varje 30 sek för ca 2 timmar att undersöka Ca2 + response att såra över en längre tidsförlopp.
  4. Använda bildanalys programvara mäter den genomsnittliga GCaMP fluorescens i tio likvärdiga områden av intresse (ROI), varav fem är centrerad på epidermal cellcytosolen och fem i bakgrunden.
  5. Skaffa baslinje fluorescens (F 0) genom att ta medelvärdet fluorescens i fem ROI i epidermis sedan subtrahera genomsnitt 5 ROI i bakgrunden innan skadan. Uttryck förändringen i fluorescens AF som förhållandet mellan förändringen i förhållande till baslinjen [(Ft -F 0) / F 0].

4. Visualisering av F-aktin Dynamics efter sårbildning

  1. OBS: Som svar på nålen såra, observera en aktin ring vid sårområdet som gradvis stänger runt såret. Detta protokoll avsnitt analyser sårtillslutning genom att mäta aktin ringdiametern.
  2. Generera transgena maskar som uttrycker en F-aktin markör såsom Drosophila moesin aktin bindande domän smält tillGFP, uttrycks under kontroll av en epidermal specifik promotor såsom col-19 (Figur 2A) (transgen juIs352).
    OBS: Vi har fått liknande resultat som använder andra aktin bindande domän markörer som Lifeact eller F-tractin (opublicerade resultat).
  3. Utför nål såra på P col-19- GFP-moesin transgena maskar. Efter nål sårskada, observera en ring av GFP-moesin runt såret med ~ 5 min. Den aktin ringen blir mindre i diameter och slutligen stänger 2-3 timmar efter sårskada i vildtyp djur (figur 2A).
  4. Bered en 2% agar pad på en glasskiva och överföra 10 maskar på kudden i 2 pl 12 mM levamisol lösning. Bild av GFP-moesin ringar 1 timme efter sårskada med konventionell konfokalmikroskopi.
    OBS: Använd konfokalmikroskopi att förvärva z-stackar (13 x 0,5 mikrometer) av aktin ringar 1 timme efter sårskada.
  5. Mät aktin ringdiameter efter sårbildning. Att kvantifiera epidermal GFP-moesin, först göra en maximal intensitet projektion av z-stack och sedan dra fyra linjeavsökningar (vid 45 ° till varandra) över GFP-moesin ring. Ringen diameter definieras som den genomsnittliga topp till topp distans av de fyra linjeavsökningar (Figur 2B). För ringar som redan har stängts, är diametern definieras som 0 nm.
    NOT: F-aktin ringar är lämpligen mätas 1 h efter sårskada eftersom detta är ungefär halvvägs genom sårförslutningsanordning processen i den vilda typen. F-aktin ringar kan också mätas vid flera tidpunkter för att härleda ett tidsförlopp för sårtillslutning. Time Lapse-filmer av sårtillslutning kan förvärvas med hjälp levamisol-immobiliserade maskar och spinning disk konfokalmikroskopi.

5. Analys Induktion av Epidermala antimikrobiella peptider

OBS: sårskada utlöser också medfödda immunsvar i C. elegans hud. Transkription av gener som kodar antimikrobiella peptider (AMP) är induced i epidermis. NLP-29 (neuropeptid-liknande protein) AMP är starkt induceras av såra 4. För att analysera hur epidermis styr AMP uttryck efter sårskada, använder transgena reportrar eller realtids-PCR för att detektera enskilda AMP transkriptnivåer.

  1. Transgena reporter analys för medfödda immunsvar mot såra 4.
  2. Utför nål såra (som i protokollet 1) på vuxna djur som uttrycker den transgena reporter frIs7, som innehåller P NLP-29- GFP och P col-12- DsRed som en intern kontroll. Observera oskadad vuxna djur som mörkröda eller orange i en GFP lång passfilter.
    OBS: Sårskada vildtyp maskar kommer att inducera P NLP-29 -GFP uttryck men kommer inte att påverka P col-12 -dsRed, vilket resulterar i maskar som visas orange, gul eller grön enligt GFP lång passning belysning. Förlust av funktionen hos gener i p38 MAPK väg, såsom PMK-1 eller nsy-1 kommer att blockera NLP-29 -GFPinduktion efter sårbildning 4. P nlp-29- GFP uttrycks vid höga nivåer i larvstadier
  3. Utför AMP induktionsanalyser hos unga vuxna djur. Se till att oskadade kontrolldjur har låga nivåer av GFP.
    OBS: P nlp-29- GFP-uttryck induceras också genom osmotisk påfrestning 8, och kan vara känslig för andra miljöpåfrestningar.
  4. 6 h efter sårskada, poäng antalet maskar som har P nlp-29 -GFP induktion (Figur 3) 9 med användning av en fluorescens dissekera omfattning med GFP långpassfilter.
    OBS: Vid en timme efter sårskada P nlp-29- GFP synligt induceras och nådde en topp ca 6 h efter sårbildning och sedan förblir förhöjd upp till 24 h efter sårbildning. Kvantifiera expression genom visuell poängsättning 4,9. Alternativt, kvantifiera uttrycksnivåer med hjälp av en fluorescensaktiverad mask sorterare 4. För masken sorterare, minst 50 djur måste sårade.
  5. Realtids-PCR-analys för quantitating transkriptnivåer för de enskilda AMP generna. Analystranskriptnivåer för flera gener: NLP-29, nlp-30, cnc-1, och cnc-5.
  6. Utför nål såra på vildtyp eller muterade maskar (se protokoll 1)
  7. Samla 50 sårade maskar och 50 oskadad maskar vid önskad tid (t.ex. 3, 6, 24 h) efter sårskada.
  8. Extrahera RNA med användning av ett kommersiellt kit enligt tillverkarens instruktioner.
  9. Utför omvänd transkription för att få totalt 20 ul cDNA med ett kommersiellt omvänt transkriptas kit.
  10. För RT-PCR, använda 0,2 | il cDNA (1/40) från varje prov i kombination med en grön Supermix med fluorescein och 0,2 pM primrar. Att jämföra RNA kvalitet, använd ama-1 eller SNB-1 RT-PCR som referens; jämföra AMP relativa expressionsnivån genom att normalisera till intern kontroll (Ama-1 eller SNB-1), eller jämföra faldig induktion efter sårskada (AMP induktion i sårade maskar / oskadad maskar) efter normalizing till intern kontroll.
    OBS: cnc-1 och cnc-5 är caenacin familjeantimikrobiella peptider vars transkription aktiveras genom att såra 10. Typiskt inducerar nål sårskada expression (~ 500-faldigt för CNC-1) under ett tidsförlopp av 4 h 10. Primrar som användes i den publicerade arbetet är listade i Tabell 2.

6. Analys Överlevnad efter sårbildning

  1. OBS: såra aktiveras minst två oberoende signalvägar i epidermis: Ca2 + beroende sårläkning vägen och det medfödda immunsvaret vägen. Båda vägar krävs för full överlevnad steril sårande. För att testa om en mutant eller RNAi behandling påverkar sårläkning, mät överlevnad vid 24-48 timmar efter sårskada. Eventuellt använder konventionella livslängdsanalyser för att bestämma effekten av såra på livslängd 4,9.
  2. Utför nål såra på unga vuxna (L4 + 24 tim) maskar (50 maskar, upprepa seveRAL gånger) följande protokoll 1 ovan. Upprätthålla ett motsvarande antal oskadade maskar som kontroller.
  3. Kontrollera överlevnad varje 24 tim (transfer sårade maskar till en ny agarplatta varje 24 timmar). Observera ~ 50% överlevnad 24 timmar efter sårskada i mutanter som är defekta i sårläkning såsom GTL-2 eller tir-1, när normaliserad till oskadade kontrolldjur. Döden definieras som en brist på rörelsesvar röra med mask plocka.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser eller nål såra kommer att utlösa en snabb och ihållande förhöjning av epidermala Ca nivåer, som visualiseras med Ca sensorer såsom GCaMPs (Figur 1). Ca höjd inträffar inom några sekunder, och förblir förhöjt under tiotals minuter. Needle såra reproducerbart resulterar i bildning av F-aktin ringar vid sårställen (Figur 2); dessa verkar inom några minuter, och gradvis nära under 1-2 timmar efter sårskada. Aktin ringar är mindre ofta bildas efter mer exakt laser sårskada. Både nål och laser såra inducerar uttryck av epidermala antimikrobiella peptider (AMP) såsom NLP-29, som upptäckts med transkriptions reportrar (Figur 3). AMP induktion är påtaglig inom 2-4 timmar efter att såra och varar ca 24 tim. Needle såra av vildtypen bör inte signifikant påverka lönsamheten (mätt vid 24 timmar efter sårskada) eller livslängd.

Figur 1
Figur 1. Laser sårskada utlöser en Ca2 + svar i C. elegans epidermis. (A) Epidermal GCaMP3 fluorescens (P col-19 -GCaMP3 (juIs319)) nivåer efter femtosecond laser sårskada. Lateral bild av epidermis i anterior-kroppen; x, laser såret; N, epidermal kärna. Spinning disk konfokala bilder, intensitet kod. UW: oskadad, W:. Sårad (B) Kvantifiering av GCaMP3 AF / F 0 vid 20, 40, och 60 pm från sår platsen; representativt spår. Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2. Needle såra utlöser aktin polymerisation runt sår sajt. (A) col-19- GFP-moesin (juIs352). Skala: 10 | im. UW: oskadad, W:.. Sårad (B) Kvantifiering av aktin ringen diameter från linjeavsökningar, 4 linjeavsökningar per djur (prickade röda linjer i panelen (A), WT) Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. Epidermal sårskada aktiverar medfödda immunsvar. Bilderna (WT oskadad, WT sårade + 3 h) P NLP-29 -GFP (frIs7) induktion efter nålen sårskada. Skala:. 200 pm Klicka här för att se enstörre version av denna siffra.

Reporter Transgen Fluorescens Allel
Kalcium Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 X
Aktin Pcol-19-GFP :: moesin GFP juIs352 I
NLP-29 Pnlp-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 IV

Tabell 1. Transgener som används i upprullade responsanalyser. Denna tabell listar kromosomalt integrerade transgener som finns på Caenorhabditis Genetics Center (http://www.cbs.umn.edu/research/resources/cgc).

Gene namn Sekvens
NLP-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
NLP-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabell 2. Primrar som användes för RT-PCR av AMP-transkript. Arbetskoncentration är 0,2 pM. SNB-en tjänar som intern kontroll.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De metoder som presenteras här för nål och laser såra ger kompletterande tillvägagångssätt för att bedöma förmågan hos epidermal epitel att reparera skador. Laser såra är relativt lokal och (beroende på laserkonfiguration) kan begränsas till epidermis, medan nålen såra stör epidermis, nagelband och sann interna basalmembraner. Needle såra får mer exakt likna sår orsakade av patogener eller mekaniska skador i naturen. Som regel kräver nål såra mer övning för att uppnå exakta sår som är kompatibla med djuröverlevnad. De cellulära svaren på nål och laser såra display många likheter. Det bör dock noteras att bildandet av aktin ringar inte reproducerbart observeras efter femtosecond laser sårskada.

En begränsning av nålstick är att det inte är en exakt sår: nålen också skadar inre vävnader vars bidrag till maskenöverlevnad har inte undersökts. En eventuell ändring av detta protokoll skulle vara att kombinera mikroflödesbaserade mikroinjektion systemet 11 och fluorescerande reportrar att utföra mer exakt fysisk sårande.

Nålen och laser såra metoder som beskrivs här är enkla men ganska arbetskrävande, och i bästa fall medel genomströmning, vilket gör det svårt att använda iska eller biokemiska metoder för karakterisering av såret svaret. Cuticle penetrerande patogener som svampar eller protozoer 12,13 kan levereras till större populationer av djur, och kan utlösa reaktioner som överlappar med svaret på såra, men ändå införa ytterligare komplexitet patogen specifika svar. Ytterligare arbete kommer att krävas för att undersöka om andra abiotiska metoder såsom ballistiska bombardemang 14 eller arrayer av mikromekaniska piercing strukturer 15 kan anpassas för storskalig sårskada.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics