Méthodes pour Blessant Peau et Essais pour les réponses de blessure dans

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La C. elegans cuticule épiderme et forment une couche de la peau simple mais sophistiqué qui permet de réparer des dommages localisés résultant de blessant. Études des réponses de la plaie et la réparation de ce modèle ont éclairé notre compréhension du cytosquelette et les réponses génomiques à des lésions tissulaires. Les deux méthodes les plus couramment utilisés pour blesser l'C. elegans peau adulte sont piqûres avec aiguilles de microinjection, et irradiation laser local. Needle blessant localement perturbe la cuticule, épiderme, et de la matrice extracellulaire associé, et peut également endommager les tissus internes. les résultats d'irradiation laser dans des dommages plus localisée. Blessure déclenche une succession de réponses facilement dosés y compris épidermique élevée de Ca2 + (secondes) minutes, la formation et la fermeture d'un cycle contenant de l'actine au niveau du site de la plaie (1-2 heures), la transcription de gènes élevée de peptides antimicrobiens (24/2 h), et la formation de cicatrices. Essentiellement tous les animaux adultes de type sauvage survivent blessure, oùque des mutants défectueux dans la réparation de la plaie ou d'autres réponses montrent diminution de la survie. Des protocoles détaillés pour l'aiguille et blessures laser, et des dosages pour la quantification et la visualisation des réponses plaies et les processus de réparation (dynamique Ca, dynamique de l'actine, antimicrobien peptide induction et la survie) sont présentés.

Introduction

mécanismes de guérison des plaies de la peau sont d'intérêt biologique fondamentale et pertinente pour la santé humaine. La cicatrisation des plaies chez les vertébrés et les mammifères comprend une série complexe de réponses coordonnées de multiples tissus et de signalisation 1. De nombreux organismes modèles génétiques simples sont également capables de cicatrisation des plaies de la peau 2. Il est donc intéressant d'analyser les modèles génétiquement traitables de plaie cutanée réparation. Nous et d'autres avons commencé à utiliser Caenorhabditis elegans comme nouveau modèle de plaie cutanée guérison 3,4. L'objectif de ce protocole est de permettre à un ensemble plus large de chercheurs d'utiliser C. elegans comme un outil pour étudier les mécanismes moléculaires et cellulaires de l'épiderme de la cicatrisation.

La C. elegans peau comprend l'épiderme (aussi connu comme hypoderme) et la cuticule extracellulaire 5. L'épiderme adultes est formé à partir d'un petit nombre de syncytia multinucléés, dont le plus grand est le syncytium kurnommée hyp7. L'épiderme est un épithélium simple qui sécrète la cuticule sur sa surface apicale. La peau peut défendre activement contre les agents pathogènes de pénétration cutanée et réparer les petites plaies quatre. La réparation des plaies de la C. la peau elegans est robuste, comme presque tous les animaux de type sauvage survivent peuvent survivre petites plaies perforantes causées par des aiguilles ou des dommages à la peau locale provoquée par irradiation laser. C. elegans blessure de la peau déclenche une série de réactions, y compris une réponse épidermique immunitaire inné, fermeture de la plaie, et la formation de cicatrices 4. L'épiderme adultes est post-mitotique, et la cicatrisation des plaies implique réponses cellulaires locaux, par opposition à la prolifération épidermique ou la migration des cellules. Nous avons montré que les blessures de la peau provoque une augmentation forte et durable dans l'épiderme de Ca2 +, ce qui nécessite le canal de TRPM-2 GTL membrane interne et Ca 2+ trois magasins. Le signal de la Ca épidermique est nécessaire pour la formation et la fermeture des anneaux F-actine à la woSite und. Blessant induit également des réponses immunitaires innées qui activent la transcription de SAP tels que la PNL-29. La transcription induite blessure-de SAP dépend d'un TIR-1 / PMK-1 p38 MAP kinase cascade agir de façon autonome dans l'épiderme 4. Des défauts, soit la voie de signalisation Ca 2+ ou dans la réponse immunitaire innée mèneront à une survie plus faible après la blessure. La structure relativement simple de la C. elegans épiderme, sa traçabilité génétique et des avantages pour l'imagerie in vivo en font un excellent système pour étudier plusieurs aspects de la réparation des plaies.

Nous présentons ici des protocoles pour les deux méthodes courantes de blessures: blessure aiguille et en blessant laser. Blessure aiguille nécessite aucun équipement spécialisé (autre que l'extracteur de l'aiguille), et avec l'expérience peut être effectuée sur des centaines de vers par jour. Blessure aiguille est effectué sur les animaux en croissance sur gélose. En revanche, une blessure au laser est effectuée sur anesanimaux thetized montés sur patins agar sous une lamelle, et est adapté pour l'imagerie en direct des réponses cellulaires aux dommages.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Les protocoles suivants décrivent la procédure détaillée pour C. elegans blessant la peau et pour tester les réponses des plaies.

1. Aiguille Blessant 3,4

  1. Cultivez vers unstarved sains sur NGM norme (milieu de croissance des nématodes) Plaques avec E. bactéries coli OP50 que l'alimentation, maintenues dans un incubateur à 20 °.
    NOTE: Méthodes de NGM plaques d'agar et de culture de routine de C. elegans peut être trouvé à www.wormbook.org 6.
  2. Choisissez 25 vers de stade L4 à un fraîchement ensemencées plaque 1 jour avant blessant et de la culture à 20 ° CO / N.
  3. Avant blessant, tirez aiguilles des capillaires aide d'un extracteur de l'aiguille. Les aiguilles utilisées dans la blessure sont identiques à ceux utilisés pour la micro-injection de C. elegans.
  4. Veiller à ce que tous les vers sont au stade jeune adulte. Placer la plaque de vers sur la glace pendant environ 30 min. Refroidissement provoque les animaux d'être lente, facilitant aiguille blessure.
  5. Retirer la plaque de gélose de la glace à un stéréomicroscope à dissection. Avec une pointe de ver, déplacer 25 vers dans le centre de la plaque de gélose.
  6. Placez l'aiguille dans une pointe de pipette 100 pi de tenir plus facilement l'aiguille. Percer la partie antérieure ou postérieure du corps de la vis sans fin avec l'aiguille, évitant la gonade. En général, tenter de blesser entre le pharynx postérieur et antérieur gonade, ou entre la gonade postérieure et le rectum. Réutiliser les aiguilles à plusieurs reprises, jusqu'à ce qu'ils cassent.
    NOTE: Se assurer que les blessures sont brèves, piqûres douces qui perforent la cuticule et la peau, pénétrant ~ 5-10 pm dans l'animal. L'aiguille doit entrer dans le animal environ à angle droit par rapport à la peau. Les blessures ne devraient pas causer des dommages aux organes internes évidente, ou la rupture immédiate du corps. Observez une petite quantité de cytoplasme suinte pendant quelques secondes après la blessure; Toutefois, si le contenu cellulaires fuite sur une période prolongée les animaux ne seront pas survivre. Pour l'imagerie optimale, blesser le syncytium latérale épidermique (de hyp7) ou la couture latérale.
    Remarque: Cette procédure comprend l'utilisation d'une aiguille en verre.
  7. Autoriser les vers de récupérer à la température ambiante, puis la culture à 20 ° C. Juger de la réussite de l'aiguille blessure par un certain nombre de tests décrits ci-dessous. Plus de 95% des animaux de type sauvage survivre 24 heures après l'aiguille blessant au stade de jeune adulte. L'effet de blesser les larves ou les adultes plus âgés n'a pas encore été analysée.

2. Laser Blessant 3

Utilisez irradiation laser femtoseconde (800 nm) pour effectuer blessures plus précis.

  1. Préparer p agarannonces sur une lame de verre fondu avec 2% d'agar 7. Se assurer que les plaquettes sont similaires aux plaquettes d'agar utilisés pour l'imagerie en direct de C. elegans.
  2. Transférer 10 jeunes vers adultes sur le tampon d'agarose avec le ver de Pick, et ajouter une goutte 2 pi de 12 mM solution lévamisole. Couvrir les animaux et le liquide avec une lamelle. Attendre 1-2 min pour les vers à paralysent.
  3. Placez la lame de verre sur un microscope confocal disque rotatif. Déplacez la scène pour trouver les vers et se concentrer sur les antérieures ou syncytial postérieure épiderme latérales avec un objectif 100X (NA) de 1,4 à 1,46.
  4. Régler la puissance du laser femtoseconde à 140 mW (mesurée avant l'objectif). Utilisez le laser femtoseconde à un taux de 80 MHz de répétition.
    REMARQUE: Deux impulsions de 200 ms chacune (séparés par 20 ms) sont suffisantes pour blessant dans nos mains.
  5. Focus sur la surface apicale de la cellule épidermique et enroulé l'épiderme. Observez la perturbation locale du cytoplasme (bulles), ou de blanchiment o localef toute marqueur fluorescent utilisé.
    REMARQUE: Suivez les procédures de sécurité de laser appropriés lors de l'utilisation du laser femtoseconde. balayages de ligne ou un point utilisant des lasers femtoseconde comme ceux de deux microscopes photoniques devraient fournir une puissance suffisante pour blessure laser.
    REMARQUE: Bien que nous ne avons pas d'expérience directe de l'utilisation d'autres lasers, en principe blessure devrait être possible en utilisant des lasers UV conventionnelles (comme dans C. elegans ablations cellulaires). Eventuellement, utiliser une récupération de fluorescence après photoblanchiment (FRAP) module sur disque rotatif confocale de blesser l'épiderme (N. Pujol, communication personnelle).

3. Visualisation des réponses des épidermique Ca à Blessant

  1. Utilisez transgénique C. elegans souches qui expriment Ca 2+ capteurs (tels que ceux de la série GCaMP) dans l'épiderme, sous le contrôle du promoteur spécifique de l'épiderme adulte col-19 (Figure 1A; transgènes sont répertoriés dans NOTE: Nous avons utilisé tdTomato comme un contrôle interne pour l'expression du transgène que la fluorescence épidermique tdTomato est relativement stable et ne interfère pas avec l'imagerie GCaMP.
  2. Les deux aiguilles et laser blessant déclenchement Ca 2+ élévation dans l'épiderme. Cependant, comme la blessure aiguille ne peut être aisément effectuée sur un disque de filage confocal, des blessures laser est préférable pour l'analyse quantitative de la réponse Ca 2+ (figure 1).
  3. Acquérir les images de déchéance de temps en mode d'acquisition multi-dimensionnelle (intervalle de temps de 2 secondes avec 114 exposition au laser d'excitation msec) en utilisant un disque confocale de filature à l'objectif 100X (NA 1,4 à 1,46) et des filtres appropriés (filtres GFP vont travailler pour GCaMP3).
    REMARQUE: Acquérir les images time-lapse toutes les 30 secondes pendant environ 2 heures pour examiner la resp Ca 2+onse à blesser sur un parcours de plus de temps.
  4. Grâce à un logiciel d'analyse d'images mesurer la fluorescence de GCaMP moyenne en dix régions équivalentes d'intérêt (ROI), dont cinq sont centrées sur le cytosol des cellules épidermiques et cinq en arrière-plan.
  5. Obtenir fluorescence de référence (F 0) en faisant la moyenne de fluorescence dans les ROI 5 dans l'épiderme puis en soustrayant la moyenne des cinq régions d'intérêt dans le fond avant de blessure. Exprimer la variation de fluorescence AF comme le rapport de changement par rapport à la ligne de base [(F t -F 0) / F 0].

4. Visualisation des Dynamics F-actine après la blessure

  1. NOTE: En réponse à aiguille blessure, observer un anneau d'actine au site de la plaie qui se referme progressivement autour de la plaie. Cette section du protocole des essais fermeture des plaies en mesurant le diamètre de l'anneau d'actine.
  2. Générer des vers transgéniques qui expriment un marqueur F-actine tel que le domaine de liaison de l'actine de Drosophila moésine fusionné àGFP, exprimé sous le contrôle d'un promoteur spécifique de l'épiderme comme col-19 (figure 2A) (transgène juIs352).
    NOTE: Nous avons obtenu des résultats similaires en utilisant des marqueurs de domaine tels que Lifeact ou F-tractin (résultats non publiés) contraignant autre actine.
  3. Effectuer aiguille blessant sur ​​P col-19- vers transgéniques GFP moésine. Après aiguille blessure, observer un anneau de GFP-moésine autour du site de la plaie par ~ 5 min. L'anneau d'actine devient de plus petit diamètre et finalement ferme 2-3 heures après blessant chez les animaux de type sauvage (figure 2A).
  4. Préparer un tampon de gélose de 2% sur une lame de verre et de les transférer vers 10 sur le tampon dans 2 ul solution mM lévamisole 12. Image les anneaux GFP-moésine 1 h après la blessure en utilisant la microscopie confocale classique.
    REMARQUE: Utilisez la microscopie confocale à acquérir z-piles (13 x 0,5 um) d'anneaux d'actine 1 h après la blessure.
  5. Mesurer le diamètre de l'anneau d'actine après la blessure. Pour quantifier épidermique GFP-moésine, d'abord faire une projection d'intensité maximale de la z-pile puis dessinez quatre balayages de lignes (à 45 ° à l'autre) sur l'anneau GFP-moésine. diamètre de la bague est défini comme la moyenne pic à pic de la distance des quatre balayages de ligne (figure 2B). Pour les anneaux qui ont déjà fermés, le diamètre est défini comme 0 um.
    NOTE: F-actine anneaux sont commodément mesurés 1 h après la blessure car ce est environ à mi-chemin à travers le processus de fermeture de plaie dans le type sauvage. Anneaux F-actine peuvent également être mesurés à de multiples points de temps pour obtenir un cours de temps de fermeture de la plaie. Accéléré films de fermeture de la plaie peuvent être acquises en utilisant les vers de lévamisole immobilisée et la filature disque microscopie confocale.

5. Essai d'induction de épidermiques Antimicrobial Peptides

REMARQUE: Blessant déclenche également les réponses immunitaires innées dans le C. la peau elegans. La transcription des gènes codant pour des peptides antimicrobiens (AMP) est induced dans l'épiderme. Le PNL-29 (protéine de neuropeptide-like) AMP est fortement induite par blessant quatre. Pour doser la façon dont l'épiderme contrôle l'expression AMP après blessure, utiliser journalistes transgéniques ou PCR en temps réel pour détecter les niveaux de transcription AMP individuelles.

  1. Dosage rapporteur transgénique de la réponse immunitaire innée à blessant quatre.
  2. Effectuer blessures d'aiguille (comme dans le protocole 1) sur les animaux adultes exprimant le journaliste transgénique frIs7, qui contient P PNL-29- GFP et P col-12- DsRed comme un contrôle interne. Observez les animaux adultes non blessés rouge foncé ou orange dans un filtre à long passe de la GFP.
    NOTE: Blesser des vers de type sauvage induiront P nlp-29-GFP expression, mais ne affecteront pas P col-12 -dsRed, résultant en des vers qui apparaissent orange, jaune ou verte sous GFP longue passe illumination. Perte de la fonction des gènes dans la voie p38 MAPK, comme PCM-1 ou NSY-1 bloquera nlp-29-GFPinduction après blessant quatre. GFP P PNL-29- est exprimée à des niveaux élevés dans les stades larvaires
  3. Effectuer AMP essais d'induction chez les jeunes animaux adultes. Veiller à ce que les animaux témoins non blessés ont de faibles niveaux de GFP.
    NOTE: P PNL-29- expression de GFP est également induite par le stress osmotique 8, et peut être sensible à d'autres stress environnementaux.
  4. 6 h après la blessure, marquer le nombre de vers qui ont P nlp-29-GFP induction (Figure 3) 9 en utilisant une fluorescence dissection portée avec la GFP filtre passe-temps.
    NOTE: À 1 h après la blessure P PNL-29- GFP est visiblement induite, atteignant un pic d'environ 6 h ​​après la blessure, puis restant élevée jusqu'à 24 heures après la blessure. Quantifier expression en notation visuelle 4,9. Sinon, quantifier les niveaux d'expression en utilisant une fluorescence activé ver trieuse quatre. Pour la trieuse de ver, au moins 50 animaux ont besoin d'être blessé.
  5. Test PCR en temps réel pour quantitating niveaux des gènes AMP individuelles de transcription. Les niveaux de transcription analyse pour plusieurs gènes: nlp-29, nlp-30, cnc-1, et cnc-5.
  6. Effectuer aiguille sur blessant de type sauvage ou vers mutants (voir le protocole 1)
  7. Recueillir 50 blessés et 50 vers des vers non blessés aux moments souhaités (par exemple, 3, 6, 24 h) après la blessure.
  8. Extrait ARN en utilisant un kit commercial en suivant les instructions du fabricant.
  9. Effectuer une transcription inverse pour obtenir de l'ADNc total de 20 ul en utilisant un kit commercial de la transcriptase inverse.
  10. Par RT-PCR, en utilisant 0,2 ul d'ADNc (1/40) à partir de chaque échantillon en combinaison avec un supermix vert avec de la fluorescéine et 0,2 uM des amorces. Pour comparer la qualité de l'ARN, utiliser ama-1 ou SNB-1 RT-PCR comme référence; comparer le niveau d'expression relatif AMP en normalisant au contrôle interne (ama-1 ou SNB-1), ou comparer pli induction après la blessure (AMP induction dans les vers blessés / des vers non blessés) par la normealizing au contrôle interne.
    REMARQUE: cnc-1 et cnc-5 sont caenacin famille peptides antimicrobiens dont la transcription est activée en blessant 10. Typiquement, l'aiguille blessure induit l'expression (~ 500 fois pour cnc-1) sur un parcours de temps de 4 h 10. Les amorces utilisées dans les travaux publiés sont énumérés dans le tableau 2.

6. Essai de survie après la blessure

  1. REMARQUE: Blessant active au moins deux voies de signalisation indépendantes de l'épiderme: la plaie voie dépendante de Ca2 + et de réparation de la voie de réponse immunitaire innée. Les deux voies sont nécessaires pour la survie complète de la blessure stérile. Pour tester si un mutant ou un traitement ARNi affecte la cicatrisation des plaies, de mesurer la survie à 24-48 h après la blessure. Eventuellement, utiliser des essais de durée de vie classiques pour déterminer l'effet de blesser sur la longévité 4,9.
  2. Effectuer aiguille blessant sur les jeunes adultes (L4 + 24 h) vers (50 vers, répétez sevefois RAL) suivantes protocole 1 ci-dessus. Maintenir un nombre équivalent de vers non blessés comme témoins.
  3. Vérifiez la survie toutes les 24 heures (transfert vers blessés à une nouvelle plaque de gélose toutes les 24 heures). Observez ~ 50% de survie 24 heures après la blessure dans les mutants qui sont défectueux dans la réparation des plaies telles que GTL-2 ou tir-1, après normalisation pour les animaux de contrôle non blessés. Le décès est défini comme un manque de réponse locomotrice à toucher par le ver choix.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser ou une aiguille blessure va déclencher l'élévation rapide et soutenue des niveaux Ca épidermiques, comme visualisé avec des capteurs Ca tels que GCaMPs (Figure 1). L'élévation Ca se produit en quelques secondes, et reste élevé pendant plusieurs dizaines de minutes. Aiguille blessant reproductible conduit à la formation d'anneaux F-actine dans des sites de la plaie (figure 2); ceux-ci apparaissent en quelques minutes, et peu à peu étroit sur 1-2 heures après la blessure. anneaux d'actine sont moins souvent formés après plus précis blessure laser. Les deux aiguilles et laser blessure induire l'expression des peptides antimicrobiens épidermiques (SAP) tels que la PNL-29, détectés avec des journalistes de la transcription (Figure 3). AMP induction est apparente dans les 2-4 heures après la blessure et dure environ 24 heures. Blessure aiguille du type sauvage ne devrait pas affecter de manière significative la viabilité (mesurée à 24 h après la blessure) ou la durée de vie.

Figure 1
Figure 1. Laser blessure déclenche une réponse de Ca 2+ dans le C. épiderme elegans. (A) épidermique GCaMP3 fluorescence (P col-19 -GCaMP3 (juIs319)) niveaux après femtoseconde blessure laser. Vue latérale de l'épiderme en antéro-corps; x, blessure par laser; N, épidermique noyau. Spinning disques images confocales, le code de l'intensité. UW: non blessé, W:. Blessés (B) La quantification de GCaMP3 AF / F 0 à 20, 40, et 60 um à partir du site de la plaie; trace représentant. Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2. aiguille blessure déclenche polymérisation de l'actine autour du site de la plaie. (A) col-19- GFP-moésine (juIs352). Echelle: 10 pm. UW: non blessé, W:.. Blessés (B) La quantification de diamètre de l'anneau d'actine de balayages de lignes, quatre balayages de lignes par animal (pointillés rouges dans le panneau (A), WT) Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. épidermique blessure active la réponse immunitaire innée. Des images représentatives (WT pas blessé, blessé WT + 3 h) de P nlp-29-GFP (frIs7) après induction aiguille blessure. Echelle:. 200 um Se il vous plaît cliquer ici pour voir uneplus grande version de ce chiffre.

Journaliste Transgene Fluorescence Allèle
Calcium Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 X
Actine Pcol-19-GFP :: moésine GFP Je juIs352
nlp-29 PNLP-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 IV

Tableau 1. transgènes utilisés dans des essais de réponse plaies. Ce tableau répertorie transgènes disponibles au Centre de Génétique Caenorhabditis (http://www.cbs.umn.edu/research/resources/cgc) intégré dans le chromosome.

Nom de gène Séquence
nlp-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
nlp-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tableau 2. Les amorces utilisées pour la RT-PCR de transcrits AMP. Concentration de travail est de 0,2 uM. SNB-1 sert de contrôle interne.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Les méthodes présentées ici pour aiguille et blessures laser offrent des approches complémentaires pour évaluer la capacité de l'épithélium épidermique pour réparer les dégâts. Laser blessure est relativement localisée et (selon la configuration de laser) peut être limitée à l'épiderme, tandis que l'aiguille blessure perturbe l'épiderme, la cuticule, et susceptibles membranes basales internes. Needle blessure peut ressembler plus précisément blessures infligées par des agents pathogènes ou des dommages mécaniques dans le milieu naturel. En règle générale, l'aiguille blessure nécessite plus de pratique pour atteindre blessures précises qui sont compatibles avec la survie des animaux. Les réponses cellulaires à aiguilles et affichage de blessure laser de nombreuses similitudes. Cependant il convient de noter que la formation d'anneaux d'actine ne est pas reproductible observée après une blessure au laser femtoseconde.

Une limitation de ponction à l'aiguille, ce est que ce ne est pas une blessure précise: l'aiguille aussi endommage les tissus internes dont les contributions à vis sans finla survie n'a pas été étudié. Une éventuelle modification de ce protocole serait de combiner le système de micro-injection à base de microfluidique-11 et les journalistes fluorescentes pour effectuer blessure physique plus précise.

Les méthodes blessantes aiguilles et laser détaillées ici sont simples mais assez de main-d'œuvre, et au mieux à moyen débit, ce qui rend difficile d'utiliser des approches génomiques ou biochimiques à la caractérisation de la réponse de la plaie. Cuticules pénétration des agents pathogènes tels que les champignons ou protozoaires 12,13 peuvent être livrés à de plus grandes populations d'animaux, et peuvent déclencher des réponses qui se chevauchent avec la réponse à la blessure, mais introduire des complexités supplémentaires de réponses spécifiques d'agents pathogènes. Des travaux complémentaires seront nécessaires pour déterminer si d'autres méthodes abiotiques tels que le bombardement balistique 14 ou des tableaux de structures de perçage 15 micromécaniques peuvent être adaptés pour une blessure à grande échelle.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics