Métodos para a pele ferimento e Ensaios para Responses ferida no

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A C. elegans epiderme e cutícula formar uma camada de pele simples mas sofisticado que pode reparar danos localizados resultante do ferimento. Os estudos da resposta de feridas e reparação neste modelo ter iluminado a nossa compreensão do citoesqueleto e respostas genómicas para danos nos tecidos. Os dois métodos mais comumente usados ​​para ferir a C. elegans pele de um adulto são picadas com agulhas microinjeção, e irradiação com laser local. Agulha ferindo interrompe localmente a cutícula, epiderme, e matriz extracelular associada, e também podem danificar os tecidos internos. Resultados da irradiação com laser em danos mais localizada. Ferimento desencadeia uma sucessão de respostas prontamente ensaiada, incluindo epidérmico elevada Ca 2+ (segundo minutos), a formação e fecho de um anel que contém actina no sítio da ferida (1-2 hr), a transcrição de genes elevada de péptidos antimicrobianos (2-24 hr), e formação de cicatriz. Essencialmente todos os animais adultos de tipo selvagem sobrevivem ferimento, ondecomo mutantes defectivos na reparação de feridas ou outras respostas mostram diminuição sobrevivência. Protocolos detalhados para agulhas e ferimento a laser, e ensaios para a quantificação e visualização de respostas feridas e processos de reparação (dinâmica de Ca, dinâmica de actina, indução peptídeo antimicrobiano e sobrevivência) são apresentados.

Introduction

Pele ferida mecanismos de cura são de interesse biológico básico e relevantes para a saúde humana. Cicatrização de feridas nos animais vertebrados e mamíferos compreende uma série complexa de respostas coordenadas de vários tecidos e de sinalização 1. Muitas simples organismos modelo genético também são capazes de curar feridas de pele 2. É, portanto, de interesse para analisar modelos geneticamente tratáveis ​​de reparação de feridas de pele. Nós e os outros começaram a usar Caenorhabditis elegans como novo modelo para a pele ferida cura 3,4. O objetivo deste protocolo é permitir que um conjunto mais amplo de pesquisadores para usar C. elegans como uma ferramenta para investigar os mecanismos moleculares e celulares da epiderme a cicatrização de feridas.

A C. elegans pele compreende a epiderme (também conhecidos como hipoderme) e a cutícula extracelular 5. A epiderme adultos é formado a partir de um pequeno número de sincícios multinucleados, das quais a maior é a sincício known como hyp7. A epiderme é um epitélio simples que segrega a cutícula na sua superfície apical. A pele pode defender ativamente contra patógenos de penetração na pele e reparar pequenos ferimentos 4. Reparação de feridas do C. elegans pele é robusta, como quase todos os animais do tipo selvagem sobreviver podem sobreviver pequenas perfurações causadas por agulhas, ou danos à pele local provocada pela irradiação laser. C. elegans ferimento da pele desencadeia uma série de respostas, incluindo uma resposta epidérmica imunológica inata, fechamento da ferida, e formação de cicatriz 4. A epiderme adultos é pós-mitótico, e cicatrização de feridas envolve respostas celulares locais em oposição à proliferação epidérmica ou migração celular. Mostrámos que o ferimento da pele provoca um aumento considerável e sustentado epidérmico Ca 2+, exigindo o canal TRPM membrana GTL-2 e internas de Ca 2+ lojas 3. O sinal de Ca2 + da epiderme é necessário para a formação e fecho dos anéis de F-actina no wolocal und. Ferimento também induz resposta imune inata que ativam a transcrição de AMPs como PNL-29. A transcrição induzida pelo ferimento de AMPs é dependente de um / PMK-1 MAP-quinase p38 cascata agindo autonomamente na epiderme 4 TIR-1. Defeitos quer na via de sinalização de Ca2 + ou na resposta imune inata irá conduzir a uma baixa sobrevivência após o ferimento. A estrutura relativamente simples do C. elegans epiderme, sua rastreabilidade genética e as vantagens para a imagem in vivo torná-lo um excelente sistema para estudar vários aspectos da reparação de feridas.

Aqui apresentamos os protocolos para os dois métodos mais comuns de ferimento: ferimento agulha e ferindo laser. Ferimento da agulha requer nenhum equipamento especializado (excepto o puxador de agulha), e com experiência pode ser realizado em centenas de vermes por dia. Ferimento da agulha é realizada em animais em crescimento em placas de agar. Em contraste, o ferimento do laser é realizado em anesanimais thetized montado em agar almofadas sob uma lamela, e é adequada para imagens ao vivo das respostas celulares a danos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Os seguintes protocolos de descrever o procedimento detalhado para C. elegans pele ferindo e para ensaiar respostas feridas.

1. Needle Ferimento 3,4

  1. Crescer vermes unstarved saudáveis ​​na NGM standard (meio de crescimento nematóide) placas com E. bactérias coli OP50 como alimentos, mantidos em um 20 ° C incubadora.
    NOTA: Os métodos para placas de agar NGM e cultivo de rotina de C. elegans pode ser encontrada em www.wormbook.org 6.
  2. Escolha 25 L4 vermes palco para um recém-semeadas placa 1 dia antes ferindo e cultura a 20 ° CO / N.
  3. Antes ferindo, puxe agulhas dos capilares usando um extrator de agulha. As agulhas utilizadas no ferir, são idênticos aos utilizados para microinjecção de C. elegans.
  4. Certifique-se que todos os vermes estão em fase de adulto jovem. Colocar a placa de vermes em gelo durante cerca de 30 min. Resfriamento faz com que os animais a ser lento, facilitando agulha ferimento.
  5. Remova a placa de agar a partir de gelo para um estereomicroscópio de dissecação. Usando uma picareta verme, vermes mover 25 para o centro da placa de agar.
  6. Coloque a agulha em uma ponteira 100 l para manter mais facilmente a agulha. Perfurar a parte anterior ou posterior do corpo do sem-fim com a agulha, evitando o desenvolvimento das gónadas. Em geral, tentar ferida entre a faringe posterior e anterior das gônadas, ou entre a gônada posterior e do reto. Re-use agulhas muitas vezes, até que eles quebram.
    NOTA: Certifique-se as feridas são breves, picadas suaves que perfuram a cutícula e pele, penetrando ~ 5-10 mm para o animal. A agulha deve entrar no animal em aproximadamente um ângulo reto com a pele. As feridas não deve causar danos evidentes aos órgãos internos, ou ruptura imediata do corpo. Observar uma pequena quantidade de citoplasma escorrendo para fora por alguns segundos depois que a ferida; no entanto, se o conteúdo celulares vazar durante um tempo prolongado os animais não vão sobreviver. Para imagem ideal, ferir o syncytium laterais epidérmico (hyp7) ou a costura lateral.
    NOTA: Este procedimento inclui a utilização de uma agulha de vidro.
  7. Permitir vermes para recuperar, à TA, em seguida a cultura a 20 ° C. Julgar o sucesso de ferimento da agulha por uma série de ensaios a seguir descritos. Mais de 95% dos animais de tipo selvagem sobrevivem 24 horas após o ferimento da agulha na fase de adulto jovem. O efeito de ferir em larvas ou adultos mais velhos ainda não foi amplamente analisada.

2. Laser Ferimento 3

Use a irradiação com laser de femtossegundos (800 nm) para realizar ferimento mais preciso.

  1. Prepare agar pAnúncios sobre uma lâmina de vidro derretido com 2% agar 7. Assegurar que as almofadas são semelhantes para as almofadas de agar utilizadas para imagens em tempo real de C. elegans.
  2. Transferir 10 vermes adultos jovens sobre o bloco de agarose com sem-fim de seleção e adicionar uma gota 2 mL de solução de 12 Levamisole mM. Cubra os animais e para o líquido com uma lamela. Espere 1-2 min para os vermes para paralisar.
  3. Coloque a lâmina de vidro em um microscópio confocal disco giratório. Mova o palco para encontrar os vermes e se concentrar nas anterior e posterior sincicial epiderme laterais com um objetivo 100X (NA 1,4-1,46).
  4. Defina a potência do laser femtosegundo a 140 mW (medido antes da objetiva). Use o laser de femtosegundo uma taxa de repetição de 80 MHz.
    NOTA: Dois pulsos de 200 ms cada (separados por 20 ms) são suficientes para ferindo em nossas mãos.
  5. Concentre-se na superfície apical da célula epidérmica e ferir a epiderme. Observe rompimento local do citoplasma (borbulhando), ou o local de branqueamentof qualquer marcador fluorescente utilizado.
    NOTA: Siga os procedimentos de segurança a laser apropriadas quando se utiliza o laser de femtosegundo. Ponto ou linha scans usando lasers de femtossegundos, tais como aqueles em dois microscópios de fótons deve fornecer energia suficiente para ferir laser.
    NOTA: Enquanto não temos experiência direta do uso de outros lasers, em princípio, o ferimento deve ser possível usando lasers UV convencionais (como usado em C. elegans ablações celulares). Opcionalmente, use uma recuperação de fluorescência Após Fotodegradação módulo (FRAP) no giro confocal disco de ferir a epiderme (N. Pujol, comunicação pessoal).

3. A visualização das Epidérmico Ca 2+ As respostas do ferimento

  1. Use C. transgênico elegans estirpes que expressam Ca 2+ sensores (tais como os da série GCaMP) na epiderme, sob o controlo do promotor específico adulto epidérmico col-19 (Figura 1A; transgenes são listados em NOTA: Temos usado tdTomato como um controlo interno para a expressão do transgene como epidérmica tdTomato fluorescência é relativamente estável e não interfere com GCaMP imagem.
  2. Ambos agulha eo laser ferindo gatilho Ca 2+ elevação na epiderme. No entanto, como ferimento da agulha não pode ser prontamente realizada em um disco confocal fiação, ferimento laser é preferível para análise quantitativa da resposta de Ca2 + (Figura 1).
  3. Adquirir imagens de lapso de tempo em modo de aquisição multi-dimensional (tempo de intervalo de 2 segundos com 114 ms exposição laser de excitação), utilizando um confocal fiação disco com objetivo 100X (NA 1,4-1,46) e filtros adequados (filtros GFP irá trabalhar para GCaMP3).
    NOTA: Adquirir imagens de lapso de tempo a cada 30 seg por cerca de 2 horas para examinar o Ca 2+ response do ferimento durante um curso de tempo mais longo.
  4. Usando o software de análise de imagem medir a fluorescência média GCaMP em dez regiões equivalentes de interesse (ROI), cinco dos quais estão centradas no citoplasma de células epidérmicas e cinco no fundo.
  5. Obter fluorescência basal (F 0) fazendo a média da fluorescência em 5 ROIs na epiderme, em seguida, subtraindo a média de 5 ROIs no fundo antes da lesão. Expressar a alteração na fluorescência Af como a razão de alteração relativamente à linha de base [(t F ​​-F 0) / 0 F].

4. visualização da dinâmica da F-actina após o ferimento

  1. NOTA: Em resposta ao ferimento da agulha, observar um anel de actina no sítio da ferida que fecha gradualmente em torno da ferida. Esta seção de protocolo ensaios de fechamento da ferida através da medição do diâmetro do anel de actina.
  2. Gerar vermes transgénicos que expressam um marcador de F-actina, tais como o domínio de ligação da actina moesina Drosophila fundido comGFP, expressa sob o controlo de um promotor específico da epiderme tais como col-19 (Figura 2A) (transgene juIs352).
    NOTA: Temos obtido resultados semelhantes usando outros marcadores de domínio, tais como Lifeact ou F-tractin (resultados não publicados) actina.
  3. Execute agulha ferindo em P col-19- vermes transgênicos GFP moesin. Depois de agulha ferimento, observar um anel de GFP-moesin ao redor do local da ferida por ~ 5 min. O anel de actina torna-se menor em diâmetro e, eventualmente, fecha 2-3 horas após o ferimento, em animais de tipo selvagem (Figura 2A).
  4. Prepara-se uma almofada de 2% de agar em uma lâmina de vidro e transferir 10 para o bloco de vermes em 2 ul Levamisol solução 12 mM. Imagem dos anéis GFP-moesin 1 hora após o ferimento usando microscopia confocal convencional.
    NOTA: microscopia confocal Uso de adquirir z pilhas (13 x 0,5 m) de anéis de actina 1 hora após o ferimento.
  5. Meça o diâmetro do anel de actina após o ferimento. Para quantificar epidérmico LFP-moesin, primeiro fazer uma projeção de intensidade máxima do z-stack e depois tirar 4 scans de linha (em 45 ° entre si) sobre o anel de GFP-moesin. O diâmetro do anel é definido como o pico médio da distância pico dos quatro varrimentos das linhas (Figura 2B). Para anéis que já fechadas, o diâmetro é definido como 0 mm.
    NOTA: F-actina anéis são convenientemente medidos 1 hora após o ferimento como este é, aproximadamente, a meio caminho através do processo de encerramento de feridas no tipo selvagem. Anéis F-actina também pode ser medido em vários pontos de tempo para derivar um curso de tempo de encerramento de feridas. Filmes lapso de tempo de fechamento da ferida pode ser adquirido usando vermes imobilizada-levamisole e girando microscopia confocal disco.

5. Ensaio de Indução de epidérmicas Antimicrobial Peptides

NOTA: Ferimento também desencadeia respostas imunitárias inatas na C. elegans pele. A transcrição de genes que codificam peptídeos antimicrobianos (AMPs) é induced na epiderme. A PNL-29 (proteína neuropeptídeo-like) AMP é fortemente induzido pelo ferindo quatro. Para analisar como a epiderme controla a expressão AMP após o ferimento, utilize repórteres transgénicos ou PCR em tempo real para detectar os níveis individuais de transcrição AMP.

  1. Ensaio de repórter transgênica para a resposta imune inata para ferindo quatro.
  2. Execute ferimento agulha (como no protocolo 1) em animais adultos que expressam o repórter transgênico frIs7, que contém P PNL-29- GFP e P-12 col DsRed como um controlo interno. Observe os animais adultos sem ferimentos vermelho escuro ou laranja em uma GFP filtro passe longo.
    NOTA: Ferir do tipo selvagem vermes vão induzir a P-29 PNL -GFP expressão, mas não afetará P col-12 -dsRed, resultando em vermes que aparecem laranja, amarelo, verde ou GFP sob iluminação passe longo. A perda da função de genes na via de p38 MAPK, tais como pmk-1 ou NSY-1 irá bloquear PNL-29 -GFPindução após ferindo quatro. GFP P PNL-29- é expresso em níveis elevados em estágios larvais
  3. Execute AMP ensaios de indução nos animais adultos jovens. Certifique-se de que os animais de controle sem ferimentos têm baixos níveis de GFP.
    NOTA: P PNL-29- expressão da GFP também é induzida por stress osmótico 8, e podem ser sensíveis a outros tipos de stress ambiental.
  4. 6 horas após o ferimento, marcar o número de vermes que têm pnl P-29 -GFP indução (Figura 3) 9 utilizando uma fluorescência escopo de dissecação com GFP filtro de passagem longa.
    NOTA: Em 1 hora após o ferimento P PNL-29- GFP é induzida visivelmente, atingindo um pico de cerca de 6 horas após o ferimento e, em seguida, permanecendo elevado até 24 horas após o ferimento. Quantificar a expressão por 4,9 de pontuação visual. Alternativamente, quantificar os níveis de expressão usando uma fluorescência ativado verme classificador 4. Para o classificador de verme, pelo menos 50 animais precisam ser ferido.
  5. Ensaio de PCR em tempo real para quantitating níveis de transcrição dos genes AMP individuais. Níveis de transcrição de ensaio para vários genes: PNL-29, a PNL-30, cnc-1, e cnc-5.
  6. Execute agulha ferindo on-tipo selvagem ou vermes mutantes (ver protocolo 1)
  7. Colete 50 vermes feridos e 50 vermes sem ferimentos nos horários desejados (por exemplo, 3, 6, 24 horas) após o ferimento.
  8. Extrai-se o ARN utilizando um kit comercial, seguindo as instruções do fabricante.
  9. Realizar a transcrição reversa para obter ADNc total de 20 uL utilizando um kit comercial da transcriptase reversa.
  10. Para RT-PCR, utilizar 0,2 ul de cDNA (1/40) de cada amostra em combinação com um Supermix verde com fluoresceína e 0,2 uM iniciadores. Para comparar a qualidade RNA, utilize ama-1 ou SNB-1 RT-PCR como referência; comparar o nível de expressão relativa AMP normalizando ao controlo interno (AMA-1 ou SNB-1), ou comparar indução vezes após o ferimento (indução AMP em vermes feridos / worms sem ferimentos) por normaalizing para controle interno.
    NOTA: cnc-1 e cnc-5 são caenacin família peptídeos antimicrobianos cuja transcrição é ativado por ferindo 10. Normalmente, agulha ferimento induz a expressão (~ 500 vezes para cnc-1), no período máximo de 4 horas 10. Os iniciadores utilizados em trabalhos publicados são apresentadas na Tabela 2.

6. ensaio de sobrevivência após o ferimento

  1. NOTA: Ferimento activa pelo menos duas vias de sinalização independentes na epiderme: a Ca 2+ dependente via de reparação de feridas e a via de resposta imune inata. Ambas as vias são necessários para a sobrevivência completa do ferimento estéril. Para testar se um mutante ou tratamento RNAi afecta a cicatrização de feridas, em medir a sobrevivência de 24-48 horas após o ferimento. Opcionalmente, use o tempo de vida ensaios convencionais para determinar o efeito de ferir sobre a longevidade 4,9.
  2. Execute agulha ferindo em adulto jovem (L4 + 24 hr) vermes (50 vermes, repita sevevezes RAL) seguindo o protocolo 1 acima. Manter um número equivalente de vermes sem ferimentos como controles.
  3. Verifique sobrevivência cada 24 horas (de transferência de vermes feridos para uma nova placa de ágar a cada 24 horas). Observe ~ 50% de sobrevivência de 24 horas após o ferimento em mutantes que estão com defeito no reparo de feridas, como GTL-2 ou tir-1, quando normalizado para animais de controle sem ferimentos. A morte é definida como uma falta de resposta locomotor para tocar por verme picareta.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser ou agulha ferimento irá desencadear uma elevação rápida e sustentada dos níveis de Ca epidérmicas, como visualizado com sensores Ca como GCaMPs (Figura 1). A elevação Ca ocorre em poucos segundos, e permanece elevada por dezenas de minutos. Agulha ferindo reprodutivelmente resulta na formação de anéis de F-actina em locais de ferida (Figura 2); estas aparecem dentro de minutos, e fechar gradualmente ao longo de 1-2 horas após o ferimento. Anéis de actina são menos frequentemente formado após ferimento a laser mais preciso. Ambos agulha e laser de ferimento induzir a expressão de epidérmicas peptídeos antimicrobianos (PAMs), tais como a PNL-29, detectadas com repórteres de transcrição (Figura 3). Indução AMP é aparente dentro de 2-4 horas após o ferimento e dura cerca de 24 horas. Ferimento da agulha do tipo selvagem não deve afetar significativamente a viabilidade (medida às 24 h após o ferimento) ou tempo de vida.

Figura 1
Figura 1. laser ferimento desencadeia uma resposta de Ca 2+ no C. epiderme elegans. (A) Epidérmico GCaMP3 fluorescência (P-19 col -GCaMP3 (juIs319)) níveis após femtosecond ferimento laser. Vista lateral da epiderme em ântero-corpo; x, ferida laser; N, epidérmica núcleo. Spinning imagens confocal de disco, código intensidade. UW: não ferida, W:. Ferido (B) Quantificação do GCaMP3 Af / F 0 a 20, 40, e 60 mm do local da ferida; traço representante. Por favor, clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. ferimento da agulha provoca a polimerização da actina em torno do local da ferida. (A) col-19- GFP-moesin (juIs352). Escala: 10 um. UW: sem ferimentos, W:.. Feridos (B) A quantificação do diâmetro do anel de actina de scans de linha, quatro varreduras de linha por animal (pontilhado linhas vermelhas no painel (A), WT) Por favor, clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. Epidérmico ferimento ativa resposta imune inata. Imagens representativas (WT sem ferimentos, WT feridos + 3 hr) da PNL-29 -GFP (frIs7) indução P após agulha ferimento. Escala:. 200 mm Por favor, clique aqui para ver umaversão maior desta figura.

Repórter Transgene Fluorescência Alelo
Cálcio PCOL-19-GCaMP3; PCOL-19-tdTomato GFP / tdTomato juIs319 X
Actina PCOL-19-GFP :: moesin GFP juIs352 I
PNL-29 PNLP-29-GFP / PCOL-12-DsRed GFP / DsRed frIs7 IV

Tabela 1. Os transgenes utilizados em ensaios de resposta da ferida. Esta tabela lista transgenes disponíveis no Caenorhabditis Genetics Center (http://www.cbs.umn.edu/research/resources/cgc) chromosomally integrado.

Nome Gene Seqüência
PNL-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
PNL-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabela 2. Os iniciadores utilizados para RT-PCR de transcritos AMP. Concentração de trabalho é de 0,2 mM. SNB-1 serve como controle interno.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Os métodos apresentados aqui por agulha e ferimento a laser oferecem abordagens complementares para avaliar a capacidade do epitélio epidérmico para reparar os danos. Ferimento Laser é relativamente localizada e (dependendo da configuração laser) pode ser confinado à epiderme, enquanto ferimento agulha interrompe a epiderme, cutícula e membranas basais internos prováveis. Ferimento Needle pode assemelhar-se com mais precisão as feridas infligidas por patógenos ou danos mecânicos no ambiente natural. Como regra geral, agulha ferimento requer mais prática para alcançar feridas precisas que são compatíveis com a sobrevivência animal. As respostas celulares a agulha e exibição ferimento a laser muitas semelhanças. No entanto deve notar-se que a formação de anéis de actina não é reprodutível observada após ferimento femtosecond laser.

A limitação da punção com agulha é que ele não é uma ferida preciso: a agulha também danifica tecidos internos cujas contribuições para vermesobrevivência não foi investigada. Uma possível modificação deste protocolo seria combinar sistema de microinjeção baseados em microfluídica 11 e repórteres fluorescentes para executar ferimento físico mais preciso.

O ponteiro laser e métodos de injúria detalhadas aqui são simples, mas bastante trabalhoso, e na melhor das hipóteses de médio rendimento, tornando-se um desafio para usar abordagens genômicas ou bioquímicos para caracterização da resposta ferida. Cutícula penetrante patógenos como fungos ou protozoários 12,13 pode ser entregue para as populações de animais maiores, e podem desencadear respostas que se sobrepõem com a resposta ao ferimento, ainda introduzir complexidades adicionais de respostas específicas de agentes patogénicos. Os trabalhos irão ser obrigados a explorar se outros métodos abióticos, como bombardeamento balístico 14 ou matrizes de estruturas de perfuração micromecânica 15 pode ser adaptado para o ferimento em grande escala.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics