Производство и таргетинг одновалентных квантовых точек

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

Динамика отдельных молекул на живых клетках способствует их биологической функции. Одноместный флуоресцентной томографии молекула является популярным методом для изучения динамики одной молекулы на поверхности клеток 1,2,3. Тем не менее, наиболее часто используемые датчики изображений в этих исследованиях есть несколько важных недостатков. Например, обычные органические красители и флуоресцирующие белки обеспечить умеренную яркость, около 10 5 -10 6 М -1 см -1, но фотохимически нестабильны, отбеливание после испускания около 10 5 -10 6 фотонов в типичных условиях обработки изображений живых клеток 4,5. В отличие от этого, полупроводниковые наночастицы, часто называемые квантовые точки (КТ), значительно ярче и стабильнее, с коэффициентов поглощения в диапазоне 10 6 -10 7 М -1 см -1 и более 10 7 -10 8 испускаемые фотоны перед photobleaching 5. Улучшенная яркость и фотостабильность КТ более органических флуорофоров позволяет наблюдение одиночных молекул в значительно более быструю смену кадров и более гораздо дольше траекторий 6.

Несмотря на их преимущества и коммерческой доступности, несколько обязательства остаются для этих мощных визуализирующих агентов. Во-первых, они плохо определены таргетинга валентность, которая может привести к сшиванию целевых биомолекул 6. Во-вторых, они обычно имеют большой гидродинамический размер (> 20 нм), что ограничивает доступ к некоторым переполненных сотовых средах 7. В-третьих, они имеют ограниченную ориентации модульность 7. Несколько стратегий пытались решить эти проблемы 8,9,10, но обычно требуют специальных знаний и реагенты для реализации.

Для решения этих проблем, мы недавно сообщили стратегию "Стерическое исключения" для подготовки моновалентная, небольшой, имодульные КТ 11. КТ обернуты одной долго фосфоротиоат ДНК (птДНК) полимера. ПтДНК связывается с поверхностью КТ через несколько взаимодействий Zn-S между поверхностными, подвергшихся воздействию атомов Zn и фосфоротиоатных групп птДНК полимера. Одним прыжком полимер пространственно и электростатическим исключает связывание дополнительных эквивалентов полимера без существенного увеличения общего размера частицы (около 2 нм). Все реагенты коммерчески доступны, продукты образуются с высоким выходом, и этот процесс требует только шаги обессоливания для очистки. После помечены, КТ, обернутые с одной птДНК (mQDs) связываться с комплементарными нитями ДНК, несущих таргетинга доменов (например, бензилгуанин (BG), benzylcytosine или алкилгалогениды).

Эти функциональные нацелены на mQDs специально для ферментативных меток, таких как SNAP, CLIP & HALO, генетически, слитых с интересующего белка. Это протокол для синтеза, Таргетинг, и живых клеток томография mQDs производимых стерической исключения.

Protocol

1 Производство моновалентные квантовых точек

  1. Передача Фаза КТ от органических до водной фазе
    1. Развести 200 мкл 1 мкМ раствора органической фазы КТ с 400 мкл хлороформа в стеклянный флакон 5 мл.
    2. Смешайте 400 мкл раствора 0,3 М тетрабутиламмонийбромид (ТБАБ) хлороформ с 36 мкл аккуратный мПЭГ тиол (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) и встряхните O / N.
    3. Добавить 800 мкл 0,2 М NaOH водного раствора и встряхивают в течение 30 сек. Фазового переноса происходит в течение нескольких минут, указанных передачи цветных частиц в водной фазе над плотной органической фазы.
    4. Если частицы агрегировать в третьей фазе между водной и органической фаз, увеличить время инкубации с тиолом MPEG. Если водную фазу остается ясным, что КТ не поэтапно перевод (смотрите рисунок 3А). С другой стороны, увеличить ОБОГАЩЕНИЯРацион мПЭГ тиол в шаге 2, чтобы облегчить плохое передачу фаз.
    5. Восстановление (цветной) водную фазу, а затем сконцентрироваться собранные КТ с колонки Centricon спина (30 кДа молекулярный вес отсечения) до 1 мл.
    6. Добавить концентрированного раствора в QD колонке с Сефадексом NAP10, предварительно уравновешенную 10 мМ Трис-буфера, содержащего 30 мМ NaCl (рН 8,0). Элюируйте КТ с 1,5 мл буфера для элюции самотеком.
    7. Измерьте концентрацию КТ с абсорбционной спектроскопии при 350 нм.
  2. Подготовка mQDs
    1. Покупка (или синтезировать) птДНК. Этот протокол использует последовательность 5'-S 50 (КТ) 10 (АКТГ) 5 -3 '(таблица 1).
ДНК Последовательность
5'-S 50 (КТ) 10 (АКТГ) 5 S S S S S S S S S S S S S S S S
S S S S S S S S S S S S S S S S S
S S S S S S S S S S S S S S S S S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (КТ) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-ДНК BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Таблица 1 Последовательности ДНК используется для производства и целевые mQDs.

  1. Подготовить 1 мл 100 нМ раствора КТ в 10 мМ Трис-буфера, содержащего 30 мМ NaCl (рН 8).
  2. Добавить по каплям 500 мкл раствора нМ птДНК 100 к водным КТ в течение 1 мин при интенсивном перемешивании. Перемешать или разместить на шейкере в течение дополнительного 9 часов.
    Примечание: Это должно теоретически произвести 1: соотношение 2 из птДНК: QD. Однако фактическое стехиометрии никогда не является совершенной - обычно результат ближе к 1: 1,5. Для того чтобы получить в соотношении 1: 1 в птДНК: QD, денситометрии после гель-электрофореза необходимо, чтобы количественно определить точное соотношение конъюгации данного известные объемы, используемые выше.
  3. Удалить ~ 10 мкл QD смеси для запуска на аналитических агарозном геле. Также удалите где сосредоточены неконъюгированных КТ в водной фазе (со стадии 1.2.1).
    1. Добавить ~ 2 μ; Л 6x Ficoll загрузочного буфера (увеличить плотность раствора) и запустить эти два образца вместе на 0,8% мас / об агарозном геле в буфере бората натрия в течение 15 мин при 150 В. одной полосы в полосу неконъюгированного управления близко к миграции хорошо, а две полосы в полосу с сопряженными КТ видны (см гели на рисунке 2б).
  4. Рассчитайте неконъюгированного QD фракции, используя относительную интенсивность двух полос (см уравнение в рисунке 2B). Затем используйте ту долю рассчитать дополнительный объем 100 нМ раствор птДНК, необходимых для соответствия количеству КТ.
  5. Повторите шаги 1.2.3 для 1.2.5 еще раз с этой расчетного объема или до распада сопряженные квантовых точек в одной полосы на геле с указанием полного сопряжение всех КТ.
  6. Добавить 100 мкл 10 мМ (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (карбокси PEG6 алканов тиольным) в 10 мМ Трис-буфера сотрудничестваntaining 30 мМ NaCl (рН 8) с сопряженными mQDs, полученных выше, и встряхивают в течение 10 мин.
    Примечание: Эти ПЭГ лиганды пассивации поверхности КТ. ПЭГ больше будет лучше пассивации КТ, однако, он также будет увеличивать свои размеры. Гидрофобный функциональность алканов тиол имеет гораздо более высокое сродство к КТ, в совокупности, чем менее гидрофобной ПЭГ-тиол б для фазовый переход. Поэтому, не позволяют этот шаг, чтобы перейти слишком долго или птДНК будут заменены алканов-ПЭГ-тиол. После минутной инкубации ~ 30, значительная часть ДНК будет были перемещены из квантовых точек (Рисунок 3В).
  7. Чтобы удалить избыток алкана PEG-тиол, добавьте 0,5 мл раствора КТ в колонке с Сефадексом NAP5, предварительно уравновешенную буфером для элюции (10 мМ Трис-буфер, содержащий 30 мМ NaCl). Соберите mQDs с 1,0 мл буфера для элюции самотеком.
  8. Концентрат собранные КТ на колонке Centricon спина (30 кДа). Храните эти mQDs при 4 ° С в течение нескольких месяцев. Не FREeze их.
    Примечание: Если цвета осадок на дне пробирки видно, точки не объединяются, и, скорее всего, больше не пригодной к использованию.

2 Производство таргетирования (Benzylguanine-) ДНК

  1. Производить или покупать с концевой аминогруппой ДНК. Этот протокол использует последовательность 5'-NH 2, - (КТ) 10 - (CAGT) 5 -3 '(таблица 1). Поли-линкер КТ увеличивает доступность функциональных захоронены глубоко в гликокаликса, но не могут быть необходимы для всех приложений. Если есть доступ к ДНК-синтезаторе, производить амино-модифицированной ДНК с использованием соответствующего 5 'амино-модификатор (5' амино-C6) модификатор.
  2. Растворить BG-N-гидроксисукцинимид (NHS-BG) в сухом диметилсульфоксиде (ДМСО) при концентрации 10 мг / мл.
    Примечание: БГ-NHS будет поглощать влагу из воздуха и привести к гидролиза реакционноспособного NHS-эфира, в частности, в гигроскопической растворителей, таких как ДМСО и диметилформамид (ДМФ). BG-NHS лучше магазинд при -80 ° С в виде порошка в своем собственном флаконе в течение второй контейнер, содержащий осушитель. Нагреться до комнатной температуры перед открытием флакон. С другой стороны, сразу же аликвоту для одноразового использования сложного эфира BG-NHS в сухом полярном растворителе, и заморозить при температуре -80 ° С или полностью вступают в реакцию с амином ДНК в шаге 2.2.
  3. Реакция путем смешивания BG-NHS в ДМСО с шагом 2,1 с аминными концевыми ДНК в HEPES (4-(2-гидроксиэтил) -1-пиперазинэтансульфоновая кислоты) забуференный (рН 8,5) воды. В типичной реакции 20 мкл 10 мг / мл Б.-NHS в ДМСО с 2 мкл 2 мМ NH 2 - (КТ) 10 - (CAGT) 5 в 58 мкл деионизированной воды, забуференного 20 мкл 0,5 М HEPES рН 8,5. Провести реакции в 1,5 мл микроцентрифужных трубки. Смешайте быстро, как реакция протекает быстро и должны конкурировать с гидролиза NHS-эфира.
  4. Обрабатывают ультразвуком в течение 5-10 мин, чтобы обеспечить тщательное смешивание. Инкубируйте ~ 1 ч при комнатной температуре. Стехиометрическое отношение BG: ДНК может быть изменена, чтобы довести реакцию до конца.
  5. Очищают BG-ДНК из непрореагировавшего амина-ДНК с помощью обращенно-фазовой ВЭЖХ работает 100 мм TEAA: ацетонитрил (ACN) градиент от 8% до 95% ацетонитрила в течение 30 мин. Непрореагировавший амин-ДНК будет элюирования до BG-ДНК. Соберите часть BG-ДНК в конической трубе.
    1. Используйте Zorbax колонку C 18 для стандартного очистки олигонуклеотидов и следующий градиент:
      0 → 15 мин: 8 → 30% ACN;
      15 → 21 мин: 30-90% ACN;
      21 → 25 мин: 90 → 8% ACN;
      25 → 30 мин: 8% ACN;
  6. Замораживание в жидком азоте и лиофилизировать собранную фракцию. Ресуспендируют ДНК в деионизированной воде. Чтобы быть очень осторожным, лиофилизировать еще два раза, чтобы удалить остатки TEAA. Остаточный TEAA могут быть токсичными для клеток при более высоких концентрациях.
  7. Ресуспендируют лиофилизированную BG-ДНК в воде, убедившись, мыть стороны гоэлектронной трубки, и развести на ~ 25 мкм запас. Алиготе и хранить при температуре 4 ° С. Образцы хранили в течение ~ 9 месяцев без заметной деградации.

3. Маркировка живых клеток одновалентными квантовых точек

  1. По желанию, пассивации mQDs непосредственно перед экспериментом изображений с использованием реагентов, таких как казеин (0,5%) или бычьего сывороточного альбумина (БСА, 1-3%).
  2. Пластина клеток, выражающие SNAP-меченый белок на общей внутренней флуоресценции отражение (TIRF) -quality стекла. В этом эксперименте мы используем линию клеток U2OS выражающую SNAP-тегами рецептор Notch1 и стеклянных поверхностей высокого качества.
  3. После того, как клетки прикреплены к стеклу (~ 24 ч), удалить питательной среды, промыть PBS, и инкубировать клетки в течение 10-30 минут при комнатной температуре в ~ 100-150 мкл PBS или мобильный носитель, содержащий ~ 1 мкм BG- ДНК с шага 2.6 выше.
  4. После инкубации с BG, тщательно промыть клетки с PBS или мобильный СМИ. Инкубируйте клетки в течение ~ 5-10 мин с гое mQDs, полученные на стадии 1.2.9 (и, возможно, пассивированы в шаге 3.1).
  5. При желании, мыть несвязанных mQDs и вернуть клетки в буферную / СМИ подходящей как для обработки изображений и культуры. Для клеток, которые должны были быть отображены в режиме TIRF, заключительный этап стирки часто ненужным, поскольку несвязанные mQDs в растворе рассеянный так быстро по сравнению со связанными mQDs как быть обнаружить во время анализа.

4 микроскопия и анализ

  1. Изображение клетки с использованием TIRF микроскоп.
    Примечание: В комплект должны быть разъемные возбуждение и фильтры выбросов, или фильтра куб обычай QD. КТ лучше волнует лазера низкой длин волн (405 или 488 нм). КТ разного диаметра имеют характерные длины волн излучения, как правило, связаны со сдвигом большой Стокса.
  2. Из яркости mQDs, собирать изображения при высокой частоте кадров в TIRF а визуализации базальную сторону живой клетке.
    Примечание: В качестве альтернативы, динамика одиночных молекул может быть FOLLOср в других фокальных плоскостях, используя вращающийся диск конфокальной микроскопии. Программное обеспечение автоматизированных одночастичное отслеживания правило, успешны в точно отслеживать яркие и фотостабильных mQDs.

Representative Results

Передача фаза КТ с органической к водной фазе, имеет решающее значение для производства mQDs, но может быть и состояние- и КТ-специфический. Передача Фаза в разделе 1.1 должны появиться так чисто, как первые два флаконов на рисунке 3. Если передача появляется больше как флакона 3, то следует попробовать снова с различными условиями.

После того, как КТ покрыты отрицательно заряженным ДНК они должны мигрировать на геле отдельно от не-завернутые КТ. Использование аликвоту развернутых КТ в качестве контроля, второй, более быстро мигрируют группа должна отображаться при добавлении птДНК, как показано в первой гель на фиг.2В. Полное формирование mQDs демонстрируется с потерей неподвижной полосы, и его распада в мобильной группе, как видно в последнем геля в рисунке 2B. Если аликвоту вашего MQD продукта мигрирует в виде одной полосы отделить от развернутого КТ, то ваши mQDs являются одновалентной и R Eady быть использован в дальнейших шагов.

Сотовый маркировка должна быть специфическими для цели по вашему выбору и должна зависеть от уровня экспрессии белка и концентрации MQD. Эмпирические оптимизация как концентрации MQD и MQD пассивации часто требуется для любого конкретного применения. демонстрирует маркировку U2OS клеток, экспрессирующих SNAP-тегами Notch рецептор с mQDs располагающихся в концентрации от 0,5 до 10 нм.

Рисунок 1
Рисунок 1 Модульная адресности mQDs. MQDs гибридизации с одноцепочечной ДНК функционализован различных нацеленных молекул. Бензилгуанин-связаны задания ДНК mQDs в SNAP-тегом слитые белки. Другое 5 'модификации и последовательности ДНК, позволит нацеливание mQDs к различным других биомолекул./files/ftp_upload/52198/52198fig1highres.jpg "целевых =" _blank "> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 2
Рисунок 2. Схема для производства mQDs. (A) Органические фазы КТ передаются в водной фазе с помощью обработки мПЭГ-тиола и бромистого тетрабутиламмони, завернутый с птДНК, и пассивированная с карбоксильной PEG6 алканов тиола. Представитель ПЭМ-изображения являются органическими QD545, QD585, и QD605 соответственно. (B) Способ определения эмпирически стехиометрии взаимодействия между КТ и птДНК в шаге выше. QD и птДНК стехиометрии эмпирически проверена с помощью денситометрии так, чтобы конечная стехиометрии реакции составляет 1: 1 (QD: птДНК). Первоначальное количество молей птДНК умножается на отношение QD: MQD, и регулируется фактического объема AF тер сопряжение с получением число молей, необходимых для достижения 1:. 1 сопряжение Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рис.3 Экспериментальные данные производства mQDs. (A) Характерные фотографии успешных и неудачных фаз передачу. КТ должна визуально передавать между плотной органической фазы и менее плотного водной фазе. Разделение Неполное фаза указывает на плохую передачу. (В) птДНК может быть заменен на алкана-PEG-тиол. Данные правой гель представитель реакции, где значительная часть птДНК были изгнаны из квантовых точек в связи с чрезмерной пассивации.ES.jpg "целевых =" _blank "> Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4 Маркировка SNAP-меченных белков на живые клетки. (А) Схематическое демонстрируя выражение, привязанность и маркировки в SNAP-меченого рецептора с BG-целевой MQD. (B) представитель маркировки клеток, экспрессирующих SNAP-Notch-mCherry построить на различных MQD концентрациях. mQDs пассивированные с PEG12 локализуются с mCherry указанием конкретной маркировки. Более низкие плотности маркировки (<0,5 нМ), как правило, предпочтительнее для отслеживания одной частицы. Шкала бар составляет 10 мкм. Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Discussion

Модульность конструкции MQD позволяет повышенную степень экспериментальной гибкости. Например, различные mQDs могут быть быстро подготовлены в уникальных цветов, позволяющих для одновременного визуализации нескольких целей. Направленный последовательность онДНК может направить mQDs с белками, сахара 12, липиды и поверхностей 13. Ряд ферментативных меток доступны с ортогональным реакционной, позволяя несколько целей для включения в образ одновременно с дифференциально целевых mQDs. В дополнение к ориентации с SNAP тега, маркировка белков-мишеней с mQDs с помощью зажима тег, гало тег, и биотинилированными белков также был успешным. Этот протокол демонстрирует специфическую маркировку поверхности рецептора на живых клеток с этими mQDs, но протокол может быть легко адаптирован к ряду различных контекстах.

Значительные методологические понимание в производстве mQDs с определенной валентности, что ~ 50 фосфоротиоат-связаныосновы обязаны обернуть КТ (и тем самым предотвратить две молекулы от привязки одновременно). Поли-S 50 последовательность воспроизводимо и устойчиво связанной 605 нм КТ от Life Technologies. Хотя этот продукт был прекращен, стерический стратегия исключение распространены на аналогичные продукты других производителей, имеющих разные размеры, формы, спектральные свойства.

Эффективность и стабильность птДНК завернутых КТ критически зависит от химии поверхности и структуры квантовых точек. Поэтому успех протокола будет зависеть от коммерческого источника и химической структуры квантовых точек. Для целей данного протокола, три основных точки разницы существуют между различными коммерческих источников КТ: разница в условиях, необходимых для передачи фазы; Разница в силе первоначального ПЭГ-тиол-лигандсвязывающим, возможно, препятствующей перемещению по птДНК; и разница в размере открытой ядра CdSe, которые могут леобъявление к тушению КТ по ​​условиям передачи тиол фазовых MPEG.

По состоянию на публикации, КТ с лучшим структуры для производства mQDs являются 4-10 нм CdSe / основные ZnS / оболочка КТ, приобретенные у компании Life Technologies с спектров излучения в 545, 585, 605 и 625 нм (рисунок 2А). КТ, основанные на 'Vivid' формулировки (545, 605 и т.д.) утолить при добавлении мПЭГ тиол и не предназначены для такого применения. КТ от Aldrich и океана Нанотех хорошо работать, но требуют шаги передачи больше фазовые и предварительную обработку оксида триоктилфосфин. Этот протокол был оптимизирован для КТ с Life Technologies.

Последовательность поли-фосфоротиоат используется, чтобы обернуть КТ прекращается с родным 20-мерной хвоста ДНК, содержащего последовательность (ACTG) 5, в которой таргетинг прядь может гибридизации. Эта последовательность удобно, так как он имеет практически нет вторичной структуры, и останется hybridizред при 37 ° С в PBS. Если есть доступ к ДНК-синтезаторе, птДНК может быть синтезированы, а затем очищали с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (ВЭЖХ) с использованием колонки С 8. ПтДНК будет элюировать позже на ВЭЖХ, чем эквивалентные олигонуклеотидов с носителем позвоночника. Мы, как правило, покидают 5 'DMT защитную группу на наших фосфоротиоатных олигонуклеотидов после очистки.

Пассивация птДНК завернутых КТ обычно требуется для того, чтобы улучшить коллоидной стабильности КТ и снижения фон обязательными для самых экспериментальных приложений. Протокол использует PEG-слой пассивации КТ. Карбокси ПЭГ алканов тиол с дополнительным PEG единиц ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, карбокси-PEG12 алканов тиол) обеспечивает значительно снижается фон, хотя более длинные колышки как больше, так, и в целом более дорогим. mQDs покрытые карбокси ПЭГ алкапе тиоловых лиганды обладают высокой стабильностью в физиологических буферах, таких как фосфатный буферный солончаков и питательных сред. Длительное хранение (> 8 месяцев) из mQDs при 4 ° С не показали значительного агрегации или птДНК отряд 11. В зависимости от эксперимента, ПЭГ пассивация КТ сам по себе не всегда в достаточной степени снизить неспецифического связывания из mQDs. Инкубация как клетки и mQDs в фосфатном буферном солевом растворе (PBS), содержащем 3% БСА в течение 20 мин перед существенно снижает использование неспецифического связывания с клетками, хотя это увеличивает видимую гидродинамический радиус mQDs на ~ 50%. Пассивации с 0,5% казеина уменьшает неспецифическое связывание еще больше, но это увеличивает видимый размер в большей степени, чем BSA.

5'-конец из нити ДНК, комплементарной к mQDs может быть изменен, чтобы позволить ориентации ряда различных биомолекул. Есть несколько установленных методов доступны ковалентно модифицировать белки, Lipids & сахара с одноцепочечной ДНК (оцДНК). До тех пор пока оцДНК представлена ​​внеклеточно, она доступна для растворимых mQDs. mQDs с вышеупомянутых последовательностей будет быстро гибридизации с их комплементарной цепи ДНК в условиях культивирования клеток. 10-20x поли (КТ) спейсер между птДНК и таргетинга последовательности могут потребоваться для эффективной ориентации таким образом, чтобы повысить фиксирующей последовательности над толщиной и отрицательно заряженных гликокаликса клетки. Для этого протокола мы выбрали для получения BG-ДНК с комплементарной последовательностью (CAGT) 5, что будет как гибриды с mQDs и ковалентно связать себя с белком SNAP-тега для быстрого и конкретного маркировки. Аналогичная функции протокола также для соединения с другими NHS-эфиры в аминокислотных-модифицированных олигонуклеотидов.

Для визуализации одиночных молекул, низкой плотности маркировки, как правило, необходимо, чтобы решить отдельные молекулы. Конечная концентрация MQD из ~ 0,5 нМ в PBS с пассиватораявляется хорошей мишенью. Тем не менее, эти высокие разведения иногда приводило к недостаточно маркировки клеток. Если это происходит, дополнительное MQD могут быть добавлены, пока не наблюдается оптимальная плотность маркировки. В случае SNAP-меченого человеческого Notch1, концентрации> 10 нМ MQD получают плотные маркировки клеток в то время как 0,5 нМ MQD в результате присоединения ~ 20 mQDs на базальной поверхности клетки-мишени (смотри фиг.4В). Сотовый маркировка с mQDs в высокой степени зависит от слияния из посеянных клеток. Чрезмерно сливающиеся клетки не маркировать на их базальных поверхностей.

Таким образом, простой способ для генерации моновалентную и модульные КТ было описано. Эти mQDs найти применение в широком диапазоне живых приложений обработки изображений клеток, о чем свидетельствует визуализации Notch рецептор на живых клетках U2OS. Применимость mQDs не ограничивается этом конкретном случае, но может быть продлен на потенциально других клеточных мишеней, таких как другие белки, нуклеиновые кислоты и ферментов.

Acknowledgements

Финансирование обеспечивается DOD W81XWH-10-1-1023 (ZJG), грант P50 GM081879 от UCSF Центра систем и синтетической биологии (ZJG), NIH 5R21EB015088-02 (YJ) и NIH 1R21EB018044 (ZJG & YJ). DS поддержали человека Frontier Science Program междисциплинарных постдок исследовательской общении.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats