उत्पादन और Monovalent क्वांटम डॉट्स का लक्ष्य निर्धारण

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

जीवित कोशिकाओं पर एकल अणुओं की गतिशीलता उनके जैविक समारोह के लिए योगदान देता है. एकल अणु प्रतिदीप्ति इमेजिंग कोशिका की सतह 1,2,3 पर एक अणु गतिशीलता का अध्ययन करने के लिए एक लोकप्रिय तरीका है. हालांकि, इन अध्ययनों में सबसे अधिक इस्तेमाल किया इमेजिंग जांच कई महत्वपूर्ण नुकसान है. उदाहरण के लिए, पारंपरिक जैविक रंगों और फ्लोरोसेंट प्रोटीन -1 के बारे में 10 5 -10 6 एम, सेमी -1 उदारवादी चमक प्रदान करते हैं, लेकिन photochemically अस्थिर कर रहे हैं, ठेठ रहते सेल इमेजिंग शर्तों के तहत लगभग 10 5 -10 6 फोटॉनों के उत्सर्जन के बाद विरंजन 4,5. इसके विपरीत, अर्धचालक नैनोकणों, अक्सर कहा जाता है क्वांटम डॉट्स (QDs), 10 6 -10 7 एम -1 सेमी -1 की रेंज और photobl से पहले 10 7 -10 8 उत्सर्जित फोटॉनों से अधिक में विलुप्त होने के गुणांक के साथ, काफी उज्ज्वल है और अधिक स्थिर हैं5 eaching. जैविक fluorophores अधिक QDs के बेहतर चमक और photostability काफी तेजी से फ्रेम दर पर एकल अणुओं के अवलोकन और अधिक बहुत लंबे समय तक 6 trajectories सक्षम बनाता है.

अपने फायदे और वाणिज्यिक उपलब्धता के बावजूद, कई देनदारियों इन शक्तिशाली इमेजिंग एजेंट के लिए रहते हैं. पहला, वे खराब लक्षित biomolecules 6 के crosslinking में हो सकता है जो लक्षित कर संयोजकता, परिभाषित किया है. दूसरा, वे आम तौर पर कुछ भीड़ सेलुलर वातावरण 7 तक पहुँच को सीमित करता है कि एक बड़े hydrodynamic आकार (> 20 एनएम) है. तीसरा, वे प्रतिरूपकता 7 को लक्षित सीमित है. कई रणनीतियों इन समस्याओं 8,9,10 को संबोधित करने का प्रयास किया, लेकिन आम तौर पर लागू करने के लिए विशेष ज्ञान और अभिकर्मकों की आवश्यकता होती है.

इन समस्याओं का समाधान करने के लिए, हमने हाल ही में monovalent, छोटे तैयार करने के लिए एक "steric बहिष्करण" रणनीति की सूचना दी, औरमॉड्यूलर QDs 11. QDs एक भी लंबे phosphorothioate डीएनए (ptDNA) बहुलक के साथ लिपटे रहे. ptDNA सतह उजागर Zn परमाणुओं और ptDNA बहुलक की phosphorothioate समूहों के बीच कई Zn एस बातचीत के माध्यम से QD सतह को बांधता है. एक एकल बाध्य बहुलक sterically और electrostatically काफी कण के समग्र आकार (लगभग 2 एनएम) में वृद्धि के बिना बहुलक के अतिरिक्त समकक्ष के बंधन शामिल नहीं है. सभी अभिकर्मकों उत्पादों को उच्च उपज में बनते हैं, व्यावसायिक रूप से उपलब्ध हैं, और इस प्रक्रिया शुद्धि के लिए ही desalting चरणों की आवश्यकता है. एक बार को निशाना डोमेन (जैसे, benzylguanine (बीजी), benzylcytosine, या alkylhalides) असर पूरक किस्में डीएनए के लिए एक एकल ptDNA (mQDs) बाँध के साथ लिपटे QDs लेबल.

ये कार्यक्षमताओं आनुवंशिक रूप से ब्याज की प्रोटीन के लिए जुड़े हुए हैं कि इस तरह की तस्वीर, क्लिप और हेलो के रूप में एंजाइमी टैग करने के लिए विशेष रूप से mQDs लक्ष्य. इस संश्लेषण के लिए एक प्रोटोकॉल है, लक्ष्यीकरण, और steric अपवर्जन द्वारा उत्पादित mQDs का जीना सेल इमेजिंग.

Protocol

Monovalent क्वांटम डॉट्स 1. उत्पादन

  1. जलीय चरण के लिए जैविक से QDs के चरण स्थानांतरण
    1. एक 5 मिलीलीटर कांच की शीशी में क्लोरोफॉर्म के 400 μl के साथ जैविक चरण QDs के 1 माइक्रोन समाधान के 200 μl पतला.
    2. साफ एमपीईजी thiol (सीएच 3 हे (सीएच 2 सीएच 2 हे) 6 सी 2 एच 5 एसएच) के 36 μl के साथ एक 0.3 एम tetrabutylammonium ब्रोमाइड (TBAB) क्लोरोफॉर्म समाधान के 400 μl मिक्स और / एन ओ हिला.
    3. एक 0.2 एम NaOH जलीय घोल के 800 μl जोड़ें और 30 सेकंड के लिए हिला. एक चरण स्थानांतरण सघन जैविक चरण ऊपर जलीय चरण के लिए रंग कणों के स्थानांतरण से संकेत कुछ ही मिनटों के भीतर होती है.
    4. कणों जलीय और कार्बनिक चरणों के बीच एक तीसरे चरण में कुल हैं, एमपीईजी thiol साथ ऊष्मायन समय वृद्धि हुई है. जलीय चरण स्पष्ट रहता है, QDs चरण हस्तांतरण (चित्रा 3A देखें) नहीं किया था. वैकल्पिक रूप से, एकाग्रता में वृद्धिचरण 2 में एमपीईजी thiol का राशन गरीबों चरण हस्तांतरण को कम करने के लिए.
    5. (रंग) जलीय चरण में स्वस्थ और फिर 1 मिलीलीटर के लिए एक Centricon स्पिन स्तंभ (30 केडीए आणविक वजन कट ऑफ) के साथ एकत्र QDs ध्यान देना.
    6. एक Sephadex NAP10 स्तंभ 30 मिमी NaCl (8.0 पीएच) युक्त 10 मिमी Tris बफर के साथ पूर्व equilibrated में केंद्रित QD समाधान जोड़ें. गुरुत्वाकर्षण प्रवाह द्वारा क्षालन बफर के 1.5 मिलीलीटर के साथ QDs elute
    7. 350 एनएम पर अवशोषण स्पेक्ट्रोस्कोपी के साथ QDs की एकाग्रता उपाय.
  2. MQDs की तैयारी
    1. खरीद (या synthesize) ptDNA. इस प्रोटोकॉल अनुक्रम का उपयोग करता है 5'-ए एस 50 (सीटी) 10 (ACTG) 5 -3 '(1 टेबल देखें).
डीएनए अनुक्रम
5'-ए एस 50 (सीटी) 10 (ACTG) 5 एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एस
एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एस
एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एक एस
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-एनएच 2 - (सीटी) 10 (CAGT) 5 -3 ' राष्ट्रीय राजमार्ग 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
बीजी डीएनए BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

तालिका 1 डीएनए दृश्यों का उत्पादन और लक्ष्य mQDs करते थे.

  1. 30 मिमी NaCl (पीएच 8) युक्त 10 मिमी Tris बफर में 100 एनएम QD समाधान के 1 एमएल तैयार करें.
  2. सख्ती क्रियाशीलता जबकि 1 मिनट के लिए जलीय QDs के लिए 100 एनएम ptDNA समाधान के लिहाज से 500 μl बूंद जोड़ें. हलचल या एक अतिरिक्त 9 घंटे के लिए एक प्रकार के बरतन पर जगह है.
    नोट: ptDNA के 2 अनुपात: QD यह सैद्धांतिक रूप से एक 1 का उत्पादन करना चाहिए. हालांकि, वास्तविक stoichiometry कभी नहीं सही है - आम तौर पर परिणाम 1 के करीब है: 1.5. 1 ptDNA का अनुपात: एक 1 निर्माण करने के लिए आदेश में QD, जेल वैद्युतकणसंचलन के बाद densitometry ऊपर प्रयोग किया जाना जाता संस्करणों दिया विकार का सही अनुपात यों के लिए आवश्यक है.
  3. एक विश्लेषणात्मक agarose जेल पर चलने के लिए QD मिश्रण की ~ 10 μl निकालें. इसके अलावा (चरण 1.2.1 से) जलीय चरण में विसंयुग्मित QDs की एक ऐसी ही एकाग्रता को हटा दें.
    1. ~ 2 μ जोड़ें; 6x Ficoll लोड हो रहा है बफर के एल (समाधान घनत्व बढ़ाने के लिए) और के करीब पलायन विसंयुग्मित नियंत्रण लेन में 150 वी पर 15 मिनट के लिए सोडियम borate बफर में एक 0.8% WT / वी agarose जेल पर एक साथ एक बैंड इन दो नमूने चलाने खैर, और संयुग्मित QDs साथ लेन में दो बैंड (चित्रा 2B में जैल देखें) में देखा जाता है.
  4. दो बैंड के सापेक्ष तीव्रता का उपयोग विसंयुग्मित QD अंश की गणना (चित्रा 2B में समीकरण देखें). फिर QDs की संख्या से मिलान करने के लिए आवश्यक 100 एनएम ptDNA समाधान की अतिरिक्त मात्रा की गणना करने के लिए कि अंश का उपयोग करें.
  5. दोहराएँ इस गणना की मात्रा के साथ या सभी QDs का पूरा विकार का संकेत जेल पर एक ही बैंड में संयुग्मित QDs पतन तक एक बार और 1.2.5 के लिए 1.2.3 कदम.
  6. 10 मिमी Tris बफर सह में 10 मिमी (सीओ 2 एच) सीएच 2 ओ (सीएच 2 सीएच 2 हे) 6 सी 11 एच 23 एसएच (carboxy PEG6 alkane thiol) के 100 μl जोड़ेंऊपर उत्पादित संयुग्मित mQDs 30 मिमी NaCl (पीएच 8) ntaining, और 10 मिनट के लिए हिला.
    नोट: ये खूंटी ligands QD सतह passivate. एक लंबे समय तक खूंटी हालांकि, यह भी उनके आकार में वृद्धि होगी, QDs बेहतर passivate जाएगा. हाइड्रोफोबिक alkane thiol कार्यक्षमता चरण हस्तांतरण के लिए कम हाइड्रोफोबिक खूंटी thiol तुलना में, कुल में, QDs के लिए एक बहुत अधिक समानता है. इसलिए, इस चरण को भी लंबे समय आगे बढ़ने के लिए अनुमति नहीं देते या ptDNA alkane खूंटी-thiol द्वारा प्रतिस्थापित किया जाएगा. एक ~ 30 मिनट ऊष्मायन के बाद, डीएनए का एक महत्वपूर्ण अंश QDs (3B चित्रा) से विस्थापित किया गया होगा.
  7. , अतिरिक्त alkane खूंटी thiol को दूर एक sephadex NAP5 स्तंभ को QD समाधान के 0.5 मिलीलीटर जोड़ने के लिए क्षालन बफर के साथ पूर्व equilibrated (30 मिमी NaCl युक्त 10 मिमी Tris बफर). गुरुत्वाकर्षण प्रवाह द्वारा क्षालन बफर के 1.0 मिलीलीटर के साथ mQDs लीजिए.
  8. एक Centricon स्पिन स्तंभ (30 केडीए) के साथ एकत्र QDs ध्यान लगाओ. महीने के लिए 4 डिग्री सेल्सियस पर इन mQDs स्टोर. Fr न करेंउन्हें Eeze.
    नोट: ट्यूब के तल में एक रंगीन गोली देखा जाता है, तो डॉट्स एकत्रित और अब useable संभावना है.

लक्ष्य निर्धारण (Benzylguanine-) डीएनए के 2 उत्पादन

  1. उत्पादन या एमाइन समाप्त डीएनए खरीद. इस प्रोटोकॉल अनुक्रम का उपयोग करता है 5'-एनएच 2 - (सीटी) 10 - (CAGT) 5 -3 '(1 टेबल देखें). पाली सीटी लिंकर glycocalyx में गहरे दफन कार्यक्षमता तक पहुँच बढ़ जाती है, लेकिन सभी अनुप्रयोगों के लिए आवश्यक नहीं किया जा सकता है. एक डीएनए सिंथेसाइज़र के लिए उपयोग नहीं है, तो एक उपयुक्त 5 'एमिनो संशोधक (5' एमिनो संशोधक सी 6) का उपयोग एमिनो संशोधित डीएनए का उत्पादन.
  2. 10 मिलीग्राम / एमएल के एक एकाग्रता में सूखा डाइमिथाइल sulfoxide (DMSO) में बड़ी एन hydroxysuccinimide (बीजी एनएचएस) भंग.
    नोट: बड़ी एनएचएस विशेष रूप से DMSO और Dimethylformamide (DMF) की तरह hydroscopic विलायकों में, प्रतिक्रियाशील एनएचएस एस्टर की hydrolysis के लिए हवा से पानी को अवशोषित और बढ़ावा मिलेगा. बीजी एनएचएस सबसे अच्छा दुकान हैएक माध्यमिक कंटेनर युक्त desiccant के भीतर अपनी खुद की शीशी में एक पाउडर के रूप में -80 डिग्री सेल्सियस पर डी. शीशी खोलने से पहले आरटी के लिए गर्म. वैकल्पिक रूप से, तुरंत एकल उपयोग के लिए एक सूखी ध्रुवीय विलायक में बीजी एनएचएस एस्टर विभाज्य और -80 डिग्री सेल्सियस पर स्थिर, या 2.2 कदम में एमाइन डीएनए के साथ पूरी तरह से प्रतिक्रिया.
  3. HEPES में एमाइन समाप्त डीएनए (4 (2 hydroxyethyl) -1-piperazineethanesulfonic एसिड) बफर (8.5 पीएच) पानी के साथ कदम 2.1 से DMSO में बीजी एनएचएस मिश्रण द्वारा प्रतिक्रिया. (सीटी) - 10 - (CAGT) 20 μl 0.5 एम HEPES पीएच 8.5 के साथ बफर 5 58 में μl विआयनीकृत पानी एक ठेठ में 2 मिमी एनएच 2 के 2 μl साथ DMSO में 10 मिलीग्राम की 20 μl प्रतिक्रिया / एमएल बीजी एनएचएस. एक 1.5 मिलीलीटर microcentrifuge ट्यूब में प्रतिक्रियाओं के लिए बाहर ले. प्रतिक्रिया तेजी से आय के रूप में जल्दी से मिलाएं और एनएचएस एस्टर hydrolysis के साथ मुकाबला करना चाहिए.
  4. पूरी तरह से मिश्रण सुनिश्चित करने के लिए 5-10 मिनट के लिए Sonicate. आरटी पर ~ 1 घंटा सेते हैं. बीजी की stoichiometric अनुपात: डीएनए पूरा करने के लिए प्रतिक्रिया करने के लिए ड्राइव बदला जा सकता है.
  5. 8% और 30 मिनट से अधिक 95% acetonitrile के बीच acetonitrile (ACN) ढाल: एक 100 मिमी TEAA चल उलट चरण HPLC द्वारा unreacted एमाइन डीएनए से बड़ी डीएनए शुद्ध. unreacted एमाइन डीएनए बीजी डीएनए से पहले elute जाएगा. एक शंक्वाकार ट्यूब में बीजी डीएनए अंश लीजिए.
    1. मानक oligonucleotide शुद्धि के लिए एक सी 18 Zorbax स्तंभ और निम्नलिखित ढाल का प्रयोग करें:
      0 → 15 मिनट: 8 से 30% ACN →;
      15 → 21 मिनट: 30-90% ACN;
      21 → 25 मिनट: 90 → 8% ACN;
      25 → 30 मिनट: 8% ACN;
  6. तरल नाइट्रोजन में फ्रीज और एकत्र अंश lyophilize. विआयनीकृत पानी में डीएनए Resuspend. अवशिष्ट TEAA दूर करने के लिए दो से अधिक बार lyophilize, अतिरिक्त सावधान रहना. अवशिष्ट TEAA उच्च सांद्रता में कोशिकाओं को विषाक्त हो सकता है.
  7. वें के पक्ष धो लें, जिससे पानी में lyophilized बीजी डीएनए Resuspendई ट्यूब, और ~ 25 माइक्रोन शेयर पतला. 4 डिग्री सेल्सियस पर विभाज्य और दुकान. नमूने नजर गिरावट के बिना ~ 9 महीनों के लिए भंडारित किया गया.

Monovalent क्वांटम डॉट्स के साथ 3 लेबल लाइव प्रकोष्ठों

  1. वैकल्पिक रूप से, इस तरह के कैसिइन (0.5%) या गोजातीय सीरम albumin (बीएसए, 1-3%) के रूप में अभिकर्मकों का उपयोग कर एक इमेजिंग प्रयोग करने से ठीक पहले mQDs passivate.
  2. कुल आंतरिक प्रतिबिंब प्रतिदीप्ति (TIRF) -गुणवत्ता कांच पर तस्वीर टैग प्रोटीन व्यक्त प्लेट कोशिकाओं. इस प्रयोग में, हम एक तस्वीर टैग Notch1 रिसेप्टर और उच्च गुणवत्ता ग्लास सतहों व्यक्त एक U2OS सेल लाइन का उपयोग करें.
  3. कोशिकाओं गिलास (~ 24 घंटा) से जुड़ी है, के बाद पीबीएस के साथ धोने, विकास मीडिया को दूर, और ~ में आरटी पर 10-30 मिनट के लिए 100-150 पीबीएस के μl या ~ 1 माइक्रोन युक्त सेल मीडिया कोशिकाओं सेते BG- ऊपर कदम 2.6 से डीएनए.
  4. बीजी साथ ऊष्मायन के बाद, ध्यान से पीबीएस या सेल मीडिया के साथ कोशिकाओं को धो लें. वें के साथ ~ 5-10 मिनट के लिए कोशिकाओं को सेतेकदम 1.2.9 में उत्पादित ई mQDs (और वैकल्पिक कदम 3.1 में passivated).
  5. वैकल्पिक रूप से, अबाध mQDs धोने और इमेजिंग और संस्कृति दोनों के लिए उपयुक्त एक बफर / मीडिया के लिए कोशिकाओं वापसी. समाधान में अपार mQDs विश्लेषण के दौरान undetectable होने के लिए के रूप में ही mQDs के साथ तुलना में इतनी तेजी से फैला हुआ रूप TIRF मोड में imaged किया जा रहे थे कि कोशिकाओं के लिए, एक अंतिम धोने कदम अक्सर अनावश्यक था.

4 माइक्रोस्कोपी और विश्लेषण

  1. छवि एक TIRF माइक्रोस्कोप का उपयोग कोशिकाओं.
    नोट: गुंजाइश वियोज्य उत्तेजना और उत्सर्जन फिल्टर, या एक कस्टम QD फिल्टर क्यूब होनी चाहिए. QDs एक कम तरंगदैर्ध्य लेजर (405 या 488 एनएम) के साथ सबसे अच्छा उत्साहित हैं. विभिन्न व्यास की QDs आम तौर पर एक बड़े स्टोक की पारी के साथ जुड़े, विशेषता उत्सर्जन तरंग दैर्ध्य है.
  2. एक जीवित कोशिका के बेसल पक्ष इमेजिंग जबकि क्योंकि mQDs की चमक की, TIRF में उच्च फ्रेम दर पर छवियों को इकट्ठा.
    नोट: वैकल्पिक रूप से, एकल अणु गतिशीलता follo हो सकता हैएक कताई डिस्क confocal खुर्दबीन का उपयोग अन्य फोकल विमानों पर शादी. स्वचालित एकल कण ट्रैकिंग सॉफ्टवेयर सही उज्ज्वल और photostable mQDs ट्रैकिंग पर आम तौर पर सफल रहा है.

Representative Results

एक जलीय चरण के लिए एक कार्बनिक से QDs के चरण स्थानांतरण mQDs के उत्पादन के लिए महत्वपूर्ण है, लेकिन condition- और QD विशिष्ट दोनों हो सकता है. खंड 1.1 में चरण स्थानांतरण चित्रा 3 में पहले दो शीशियों के रूप में साफ दिखाई देनी चाहिए. हस्तांतरण अधिक शीशी 3 की तरह दिखाई देता है, तो एक अलग शर्तों के साथ फिर से प्रयास करना चाहिए.

QDs नकारात्मक आरोप लगाया डीएनए के साथ लेपित हैं एक बार जब वे गैर लिपटे QDs से अलग एक जेल पर विस्थापित चाहिए. चित्रा 2 बी में पहले जेल में देखा के रूप में एक नियंत्रण, एक दूसरे के रूप में unwrapped QDs की एक विभाज्य का उपयोग करना, तेजी से पलायन बैंड, ptDNA के अलावा पर ​​दिखाई देनी चाहिए. MQDs की पूरी गठन स्थिर बैंड की हानि, और चित्रा 2B में पिछले जेल में देखा के रूप में मोबाइल बैंड में उसके पतन के साथ प्रदर्शन किया है. अपने mQD उत्पाद की एक विभाज्य एक एकल बैंड के रूप में unwrapped QDs से वियोज्य migrates, तो अपने mQDs monovalent और अनुसंधान कर रहे हैं Eady आगे कदम में इस्तेमाल किया जाएगा.

सेल लेबलिंग अपनी पसंद के लक्ष्य के लिए विशिष्ट होना चाहिए और प्रोटीन अभिव्यक्ति के स्तर और mQD एकाग्रता पर निर्भर होना चाहिए. MQD एकाग्रता और mQD passivation दोनों के अनुभवजन्य अनुकूलन अक्सर किसी भी आवेदन के लिए आवश्यक है. 4B चित्रा 0.5 एनएम से 10 एनएम के लिए एकाग्रता में लेकर mQDs साथ एक तस्वीर टैग पायदान रिसेप्टर व्यक्त U2OS कोशिकाओं की लेबलिंग दर्शाता है.

चित्रा 1
चित्रा 1 मॉड्यूलर mQDs का निशाना. MQDs विभिन्न लक्षित कर अणुओं से functionalized ssDNA को संकरण. संलयन प्रोटीन टैग तस्वीर करने के लिए डीएनए लक्ष्य mQDs Benzylguanine से जुड़े. अन्य 5 'संशोधनों और डीएनए दृश्यों अन्य biomolecules की एक किस्म को mQDs को निशाना सकें./files/ftp_upload/52198/52198fig1highres.jpg "लक्ष्य =" _blank "> इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 2
MQDs के उत्पादन के लिए 2 योजना चित्रा. (क) जैविक चरण QDs ptDNA साथ लिपटे एमपीईजी thiol और TBAB, के साथ इलाज के द्वारा जलीय चरण के लिए स्थानांतरित कर, और carboxy PEG6 alkane thiol साथ passivated रहे हैं. प्रतिनिधि मंदिर छवियों क्रमशः, जैविक QD545, QD585, और QD605 हैं. (बी) के अनुभव से ऊपर चरण दो में QDs और ptDNA के बीच बातचीत के stoichiometry का निर्धारण करने के लिए एक विधि. 1 (G: ptDNA) QD और ptDNA stoichiometries अनुभव से अंतिम प्रतिक्रिया stoichiometry 1 है कि इस तरह के densitometry द्वारा सत्यापित कर रहे हैं. ptDNA के moles की प्रारंभिक संख्या QD के अनुपात से गुणा किया जाता है: mQD, और वास्तविक मात्रा वायुसेना द्वारा निकाला आतंकवाद संयुग्मन 1 को प्राप्त करने के लिए आवश्यक moles की संख्या उपज:. 1 संयुग्मन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 3
चित्रा 3 mQDs के उत्पादन के लिए प्रयोगात्मक विवरण. (ए) सफल के प्रतिनिधि तस्वीरें और चरण हस्तांतरण में विफल रहा है. QDs नेत्रहीन घने जैविक चरण और कम घने जलीय चरण के बीच स्थानांतरित करना चाहिए. अधूरा चरण जुदाई गरीब हस्तांतरण को इंगित करता है. (बी) ptDNA alkane खूंटी-thiol द्वारा प्रतिस्थापित किया जा सकता है. राइट जेल डेटा ptDNA का एक महत्वपूर्ण अंश की वजह से अधिक-passivation को QDs से विस्थापित किया गया है जहां एक की प्रतिक्रिया का प्रतिनिधि है.es.jpg "लक्ष्य =" _blank "> इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 4
चित्रा 4 लेबल जीवित कोशिकाओं पर प्रोटीन तस्वीर चिह्नित. (ए) योजनाबद्ध एक बड़ी लक्षित mQD साथ एक तस्वीर टैग रिसेप्टर की अभिव्यक्ति, लगाव और लेबलिंग का प्रदर्शन है. (बी) एक तस्वीर पायदान-mCherry विभिन्न mQD सांद्रता में निर्माण व्यक्त कोशिकाओं के प्रतिनिधि लेबलिंग. PEG12 साथ passivated mQDs mCherry विशिष्ट लेबलिंग का संकेत के साथ colocalize. लोअर लेबलिंग घनत्व (<0.5 एनएम) एकल कण ट्रैकिंग के लिए आम तौर पर बेहतर कर रहे हैं. स्केल बार 10 माइक्रोन है. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

Discussion

mQD डिजाइन की प्रतिरूपकता प्रयोगात्मक लचीलापन की एक वृद्धि की डिग्री सक्षम बनाता है. उदाहरण के लिए, mQDs की एक किस्म जल्दी से कई लक्ष्यों के साथ इमेजिंग के लिए अनुमति अद्वितीय रंगों में तैयार किया जा सकता है. ssDNA को लक्षित अनुक्रम, प्रोटीन को शक्कर 12, लिपिड mQDs प्रत्यक्ष और 13 सतहों कर सकते हैं. एंजाइमी टैग की संख्या कई लक्ष्यों को विभिन्न लक्षित mQDs साथ एक साथ imaged किया जा करने की अनुमति, orthogonal प्रजातियों के साथ उपलब्ध हैं. तस्वीर टैग के साथ लक्षित करने के अलावा, क्लिप टैग, हेलो टैग का उपयोग कर mQDs और biotinylated प्रोटीन के साथ लक्ष्य प्रोटीन की लेबलिंग भी सफल रहा था. इस प्रोटोकॉल इन mQDs साथ जीवित कोशिकाओं पर एक सतह रिसेप्टर की विशिष्ट लेबलिंग दर्शाता है, लेकिन प्रोटोकॉल आसानी से विभिन्न संदर्भों की एक संख्या के लिए अनुकूलित किया जा सकता है.

परिभाषित संयोजकता के साथ mQDs उत्पादन में महत्वपूर्ण पद्धति अंतर्दृष्टि है कि ~ 50 phosphorothioate से जुड़ेकुर्सियां ​​QDs लपेट (और इस प्रकार एक साथ बंधन से दो अणुओं को रोकने) के लिए आवश्यक हैं. एक पाली ए एस 50 अनुक्रम reproducibly और stably जीवन टेक्नोलॉजीज से 605 एनएम QDs बंधे. इस उत्पाद को बंद किया गया है, steric बहिष्कार रणनीति विभिन्न आकार, आकार, वर्णक्रमीय गुणों वाले अन्य विक्रेताओं से इसी तरह के उत्पादों के लिए generalizable है.

ptDNA लिपटे QDs की दक्षता और स्थिरता QDs की सतह के रसायन शास्त्र और संरचना पर निर्भर करता है. इसलिए, एक प्रोटोकॉल की सफलता QDs की वाणिज्यिक स्रोत और रासायनिक संरचना पर निर्भर करेगा. इस प्रोटोकॉल के प्रयोजनों के लिए, अंतर की तीन प्रमुख बिंदुओं QDs के विभिन्न व्यावसायिक स्रोतों के बीच मौजूद हैं: चरण हस्तांतरण के लिए आवश्यक शर्तों में एक अंतर; ptDNA द्वारा प्रारंभिक खूंटी thiol-ligand बाध्यकारी, संभवतः निरोधक विस्थापन की शक्ति में एक अंतर; और उजागर सीडीएसई कोर की राशि में एक अंतर है, जो कर सकते हैं Leएमपीईजी thiol चरण स्थानांतरण स्थितियों से QD का शमन करने के लिए विज्ञापन.

प्रकाशन के रूप में, mQDs के उत्पादन के लिए सबसे अच्छा संरचना के साथ QDs 545, 585, 605 और 625 एनएम (2A चित्रा) में उत्सर्जन स्पेक्ट्रा के साथ जीवन टेक्नोलॉजीज से खरीदा 4-10 एनएम सीडीएसई / ZnS कोर / खोल QDs हैं. 'ज्वलंत' सूत्रीकरण (545, 605, आदि) पर आधारित QDs एमपीईजी thiol के अलावा पर ​​बुझा लेते हैं और इस आवेदन के लिए उपयुक्त नहीं हैं. Aldrich और महासागर नैनोटेक से QDs अच्छी तरह से काम करते हैं, लेकिन लंबे समय तक चरण हस्तांतरण कदम और trioctylphosphine ऑक्साइड के साथ pretreatment की आवश्यकता होती है. इस प्रोटोकॉल जीवन टेक्नोलॉजीज से QDs के लिए अनुकूलित किया गया है.

QDs रैप करने के लिए प्रयोग किया जाता पाली एक phosphorothioate अनुक्रम एक को लक्षित किनारा संकरण सकता है जो करने के लिए (ACTG) 5 के अनुक्रम युक्त एक देशी 20 मेर डीएनए पूंछ के साथ समाप्त होता है. इस क्रम में यह कोई माध्यमिक संरचना करने के लिए कुछ किया है, के रूप में सुविधाजनक है, और hybridiz रहेगापीबीएस में 37 डिग्री सेल्सियस पर एड. एक डीएनए सिंथेसाइज़र के लिए उपयोग नहीं है, ptDNA एक सी 8 कॉलम का उपयोग करके संश्लेषित और फिर रिवर्स चरण उच्च प्रदर्शन तरल क्रोमैटोग्राफी (HPLC) द्वारा शुद्ध कर सकते हैं. ptDNA एक देशी रीढ़ के साथ बराबर oligonucleotides से HPLC पर बाद में elute जाएगा. आम तौर पर हम शुद्धि के बाद हमारे phosphorothioate oligonucleotides पर समूह की रक्षा DMT '5 छोड़ दें.

PtDNA लिपटे QDs की passivation आमतौर पर QDs की कोलाइडयन स्थिरता में सुधार और सबसे प्रयोगात्मक अनुप्रयोगों के लिए बाध्यकारी पृष्ठभूमि को कम करने के लिए आवश्यक है. प्रोटोकॉल QDs passivate करने के लिए एक खूंटी परत का उपयोग करता है. Carboxy खूंटी अतिरिक्त खूंटी इकाइयों के साथ alkane thiol ((सीओ 2 एच) सीएच 2 ओ (सीएच 2 सीएच 2 हे) 12 सी 11 एच 23 एसएच, carboxy-PEG12 alkane thiol) काफी पृष्ठभूमि कम प्रदान करता रह गया खूंटे दोनों बड़े होते हैं, हालांकि, और आम तौर पर और अधिक महंगा है. carboxy खूंटी अलका के साथ लेपित mQDsपूर्वोत्तर thiol ligands ऐसे फॉस्फेट बफर Salines और संस्कृति मीडिया के रूप में शारीरिक बफ़र्स में अत्यधिक स्थिर रहे हैं. 4 डिग्री सेल्सियस पर mQDs की लंबी अवधि के भंडारण (> 8 महीने) कोई महत्वपूर्ण एकत्रीकरण या ptDNA टुकड़ी 11 दिखाया. प्रयोग के आधार पर, QDs की खूंटी passivation अकेले हमेशा पर्याप्त गैर विशिष्ट mQDs के बंधन को कम नहीं करता. यह 50% ~ द्वारा mQDs का स्पष्ट hydrodynamic त्रिज्या में वृद्धि करता है, हालांकि काफी हद तक उपयोग करने से पहले 20 मिनट के लिए 3% बीएसए युक्त फॉस्फेट बफर खारा (पीबीएस) में कोशिकाओं और mQDs दोनों incubating, कोशिकाओं के लिए बाध्य गैर विशिष्ट कम कर देता है. 0.5% कैसिइन साथ passivation गैर विशिष्ट आगे भी बंधन कम कर देता है लेकिन यह बीएसए की तुलना में एक बड़ी हद तक स्पष्ट आकार बढ़ जाता है.

MQDs के पूरक एक डीएनए किनारा के 5 'अंत अलग biomolecules के एक नंबर के लक्ष्यीकरण सक्षम करने के लिए संशोधित किया जा सकता है. Covalently प्रोटीन को संशोधित करने के लिए उपलब्ध स्थापित तकनीकों का एक नंबर, एल कर रहे हैंipids और एकल असहाय डीएनए (ssDNA) के साथ शक्कर. SsDNA extracellularly प्रस्तुत किया जाता है, तब तक यह घुलनशील mQDs के लिए सुलभ है. ऊपर दृश्यों के साथ mQDs तेजी से सेल संस्कृति शर्तों के तहत उनके पूरक डीएनए किनारा साथ संकरण जाएगा. सेल की मोटी और नकारात्मक आरोप लगाया glycocalyx ऊपर बाध्यकारी अनुक्रम तरक्की के रूप में तो ptDNA और लक्षित कर अनुक्रम के बीच एक 10-20x पाली (सीटी) स्पेसर को लक्षित कुशल के लिए आवश्यक हो सकता है. इस प्रोटोकॉल के लिए हम दोनों mQDs संकरित और covalently तेजी से और विशिष्ट लेबलिंग के लिए एक तस्वीर टैग प्रोटीन को ही कड़ी होगी कि (CAGT) 5 के एक पूरक अनुक्रम के साथ एक बड़ी डीएनए का उत्पादन करने के लिए चुना है. अच्छी तरह से एमिनो संशोधित oligonucleotides को अन्य एनएचएस एस्टर युग्मन के लिए एक समान प्रोटोकॉल का कार्य करता है.

एकल अणु इमेजिंग के लिए, लेबलिंग की एक कम घनत्व आमतौर पर व्यक्तिगत अणुओं को हल करने के लिए आवश्यक है. Passivating एजेंट के साथ पीबीएस में ~ 0.5 एनएम के अंतिम mQD एकाग्रताएक अच्छा लक्ष्य है. हालांकि, इन उच्च dilutions कभी कभी के तहत लेबलिंग कोशिकाओं की में हुई. यदि ऐसा होता है लेबलिंग की एक इष्टतम घनत्व मनाया जाता है, जब तक अतिरिक्त mQD जोड़ा जा सकता है. 0.5 एनएम mQD लक्षित सेल के बेसल सतह पर 20 mQDs (4B चित्रा देखें) ~ की कुर्की में हुई है, जबकि तस्वीर में चिह्नित मानव Notch1 के मामले में,> 10 एनएम mQD की सांद्रता घने लेबलिंग कोशिकाओं का उत्पादन किया. MQDs साथ सेल लेबलिंग चढ़ाया कोशिकाओं के confluency की अत्यधिक निर्भर था. पीढ़ी मिला हुआ कोशिकाओं उनके बेसल सतहों पर लेबल नहीं है.

संक्षेप में, एक सरल विधि monovalent उत्पन्न करने के लिए और मॉड्यूलर QDs वर्णित किया गया था. लाइव U2OS कोशिकाओं पर पायदान रिसेप्टर इमेजिंग द्वारा प्रदर्शन के रूप में इन mQDs, लाइव सेल इमेजिंग आवेदनों की विस्तृत श्रृंखला में उपयोगिता लगता है. MQDs की प्रयोज्यता इस विशेष मामले तक सीमित नहीं है, लेकिन संभावित ऐसे अन्य प्रोटीन, न्यूक्लिक एसिड, और एंजाइमों के रूप में अन्य सेलुलर लक्ष्यों के लिए बढ़ाया जा सकता है.

Acknowledgements

डीओडी W81XWH-1023/10/01 (ZJG), सिस्टम के लिए UCSF केंद्र और सिंथेटिक बायोलॉजी (ZJG) से अनुदान P50 GM081879, एनआईएच 5R21EB015088-02 (YJ) और एनआईएच 1R21EB018044 (ZJG और YJ) द्वारा उपलब्ध कराए गए धन. डी एस मानव फ्रंटियर विज्ञान कार्यक्रम क्रॉस अनुशासनात्मक postdoc रिसर्च फैलोशिप द्वारा समर्थित किया गया.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats