La production et le ciblage des monovalent Quantum Dots

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

La dynamique de molécules uniques sur cellules vivantes contribue à leur fonction biologique. Simple fluorescence de molécules imagerie est une méthode populaire pour étudier la dynamique de molécules uniques sur le 1,2,3 de la surface cellulaire. Cependant, les sondes d'imagerie les plus couramment utilisés dans ces études présentent plusieurs inconvénients importants. Par exemple, les colorants organiques et les protéines fluorescentes conventionnelles offrent luminosité modérée, environ 10 5 à 10 6 M -1 cm -1, mais sont photochimiquement instable, le blanchiment après l'émission de l'ordre de 10 5 -10 6 photons dans les conditions typiques d'imagerie en temps réel des cellules 4,5. En revanche, les nanoparticules semi-conductrices, souvent appelés points quantiques (QD), sont nettement plus brillant et plus stable, avec des coefficients d'extinction dans la gamme de 10 6 à 10 7 M -1 cm -1 et de plus de 10 7 -10 8 photons émis avant photoblENSEIGNEMENT 5. La luminosité améliorée et photostabilité des boîtes quantiques plus de fluorophores organiques permet l'observation de molécules uniques à une accélération significative du taux de trame et trajectoires sur beaucoup plus longtemps 6.

Malgré leurs avantages et la disponibilité commerciale, plusieurs engagements restent pour ces agents d'imagerie puissantes. Tout d'abord, ils ont mal défini ciblage valence, ce qui peut entraîner une réticulation des biomolécules cibles 6. Deuxièmement, ils ont généralement une taille hydrodynamique (> 20 nm) qui limite l'accès à certains environnements cellulaires encombrés 7. Troisièmement, ils ont limité le ciblage modularité 7. Plusieurs stratégies ont tenté de répondre à ces problèmes 8,9,10, mais exigent généralement des connaissances et des réactifs spécialisés pour la mise en œuvre.

Pour résoudre ces problèmes, nous avons récemment signalé une stratégie «d'exclusion stérique" pour préparer monovalent, petites etmodulaires QD 11. Les points quantiques sont emballés avec un seul polymère ADN phosphorothioate longue (ptDNA). Le ptDNA se lie à la surface par l'intermédiaire d'interactions multiples QD Zn-S entre les atomes de Zn exposées à la surface et les groupes phosphorothioate du polymère ptDNA. Un seul polymère lié de manière électrostatique et stérique exclut la liaison des équivalents supplémentaires du polymère sans augmenter de manière significative la taille globale de la particule (environ 2 nm). Tous les réactifs sont disponibles dans le commerce, les produits sont formés avec un rendement élevé, et le procédé nécessite seulement des étapes de purification de dessalage. Une fois marqué, les points quantiques emballés avec un seul bind ptDNA (mQDs) à des brins d'ADN complémentaires portant ciblant les domaines (par exemple, benzylguanine (BG), benzylcytosine ou alkylhalogénures).

Ces fonctionnalités ciblent spécifiquement les mQDs à étiquettes enzymatiques tels que la SNAP, CLIP & HALO qui sont génétiquement fusionnés à la protéine d'intérêt. Il s'agit d'un protocole de synthèse, Le ciblage et l'imagerie des cellules vivantes de mQDs produites par exclusion stérique.

Protocol

1 Production de monovalent Quantum Dots

  1. transfert de la phase de boîtes quantiques de organique à la phase aqueuse
    1. Diluer 200 ul d'une solution à 1 M de points quantiques de la phase organique avec 400 pi de chloroforme dans un flacon de 5 ml en verre.
    2. Mélanger 400 ul d'une solution 0,3 M de bromure de tétrabutylammonium (TBAB) de chloroforme avec 36 ul de mPEG pur thiol (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) et agiter O / N.
    3. Ajouter 800 ul d'une solution aqueuse 0,2 M de NaOH et agiter pendant 30 secondes. Un transfert de phase se produit au bout de quelques minutes, indiqués par le transfert des particules colorées dans la phase aqueuse au-dessus de la phase organique dense.
    4. Si les particules se rassemblent dans une troisième phase entre les phases aqueuse et organique, augmenter le temps d'incubation avec le thiol mPEG. Si la phase aqueuse reste clair, les points quantiques n'ont pas transfert de phase (voir figure 3A). Sinon, augmenter la concentration de mPEG thiol à l'étape 2 pour alléger transfert de phase pauvres.
    5. Récupérer le (couleur) phase aqueuse, puis concentrer les boîtes quantiques recueillies avec une colonne Centricon de spin (30 kDa de poids moléculaire de coupure) à 1 ml.
    6. Ajouter la solution de QD concentré dans une colonne de Sephadex NAP10 pré-équilibrée avec du tampon Tris 10 mM contenant 30 mM de NaCl (pH 8,0). On élue les points quantiques avec 1,5 ml de tampon d'élution par un écoulement par gravité.
    7. Mesurer la concentration de boîtes quantiques par spectroscopie d'absorption à 350 nm.
  2. Préparation de mQDs
    1. Achat (ou synthétiser) ptDNA. Ce protocole utilise la séquence 5'-A S 50 (CT) 10 (ACTG) 5 -3 '(voir le tableau 1).
ADN Séquence
5'-A S 50 (CT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (CT) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-ADN BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tableau 1: séquences d'ADN et utilisés pour produire des mQDs cibles.

  1. Préparer 1 ml d'une solution de QD 100 nM dans du tampon Tris 10 mM contenant 30 mM de NaCl (pH 8).
  2. Ajoutez goutte à goutte 500 pi de la solution 100 nM ptDNA aux boîtes quantiques aqueuses pendant 1 min en remuant énergiquement. Mélanger ou placer sur un agitateur pendant une 9 heures supplémentaires.
    Remarque: Ce devrait théoriquement produire un rapport de 1: 2 de ptDNA: QD. Cependant, la stoechiométrie réelle n'est jamais parfaite - habituellement le résultat est proche de 1: 1,5. Afin de produire un rapport de 1: 1 de ptDNA: QD, densitométrie après électrophorèse en gel est nécessaire de quantifier le rapport exact de conjugaison compte tenu des volumes connus utilisés ci-dessus.
  3. Retirez ~ 10 pl du mélange de QD pour fonctionner sur un gel d'agarose analytique. Retirez également une concentration similaire de points quantiques non conjugués en phase aqueuse (de l'étape 1.2.1).
    1. Ajouter ~ 2 μ, L de tampon de charge 6x Ficoll (pour augmenter la densité de la solution) et d'exécuter ces deux échantillons en même temps sur un gel à 0,8% en poids / volume d'agarose dans un tampon de borate de sodium pendant 15 min à 150 V. Une seule bande de la voie de commande non conjugué migrer à proximité le bien, et deux bandes dans la voie de QDs conjugués sont considérés (voir gels dans la figure 2B).
  4. Calculer la fraction QD non conjugué en utilisant l'intensité relative des deux bandes (voir l'équation de la figure 2B). Puis, utilisez la fraction de calculer le volume supplémentaire de 100 nM solution ptDNA nécessaire pour correspondre au nombre de points quantiques.
  5. Répétez les étapes 1.2.3 à 1.2.5 une fois de plus avec ce volume calculé ou jusqu'à ce que l'effondrement dans une seule bande de QDs conjugués sur le gel indiquant conjugaison complète de tous les points quantiques.
  6. Ajouter 100 ul de 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxy PEG6 alcane thiol) dans 10 mM Tris tampon containing 30 mM de NaCl (pH 8) pour les mQDs conjugués produits ci-dessus, et agiter pendant 10 min.
    Remarque: Ces ligands PEG passivent la surface de QD. A plus PEG sera mieux passiver les points quantiques, cependant, il permettra également d'augmenter leur taille. La fonctionnalité alcane thiol hydrophobe a une affinité beaucoup plus élevée pour les points quantiques, dans l'ensemble, à moins hydrophobe PEG-thiol utilisé pour le transfert de phase. Par conséquent, ne laissez pas cette étape pour poursuivre trop longtemps ou la ptDNA sera remplacé par l'alcane-PEG-thiol. Après une incubation ~ 30 min, une fraction importante de l'ADN aura été déplacé à partir des points quantiques (figure 3B).
  7. Pour supprimer alcane-thiol PEG excès, ajouter 0,5 ml de la solution de QD une colonne Sephadex NAP5 de pré-équilibrée avec un tampon d'élution (tampon Tris 10 mM contenant 30 mM de NaCl). Recueillir les mQDs avec 1,0 ml de tampon d'élution par écoulement gravitaire.
  8. Concentrer les boîtes quantiques recueillies avec une colonne Centricon de spin (30 kDa). Conservez ces mQDs à 4 ° C pendant des mois. Ne frEEZE eux.
    Remarque: Si une pastille colorée dans la partie inférieure du tube est considéré, les points sont regroupés et sont susceptibles de ne plus utilisable.

2 Production de ciblage (Benzylguanine-) ADN

  1. Produire ou d'acheter de l'ADN à terminaison amine. Ce protocole utilise la séquence 5'-NH 2 - (PM), 10 - (CAGT) 5 -3 '(voir tableau 1). L'éditeur de liens poly-CT augmente l'accessibilité aux fonctionnalités enfoui au plus profond dans le glycocalyx mais ne peut pas être nécessaire pour toutes les applications. Si on a accès à un synthétiseur d'ADN, produire de l'ADN amino-modifié à l'aide d'un 5 'amino-modificateur (5' approprié amino-modificateur C6).
  2. Dissoudre BG-N-hydroxysuccinimide (NHS-BG) dans le diméthylsulfoxyde sec (DMSO) à une concentration de 10 mg / ml.
    Remarque: BG-NHS va absorber l'eau de l'air et de conduire à une hydrolyse de l'ester de NHS-réactif, en particulier dans des solvants hygroscopiques tels que le DMSO et le diméthylformamide (DMF). BG-NHS est le meilleur magasind à -80 ° C sous forme de poudre dans son flacon dans un récipient contenant un produit déshydratant secondaire. Réchauffer à température ambiante avant d'ouvrir le flacon. Alternativement, aliquoter immédiatement à usage unique de l'ester BG-NHS dans un solvant polaire sec et congeler à -80 ° C, ou de réagir pleinement avec l'ADN d'amine dans l'étape 2.2.
  3. Réagir en mélangeant le BG-NHS dans du DMSO à l'étape 2.1 de l'ADN à terminaison amine dans de l'HEPES (4-(2-hydroxyéthyl) -1-piperazineethanesulfonic) tamponnée (pH 8,5) de l'eau. Dans une réaction typique de 20 pi de 10 mg / ml BG-NHS dans du DMSO avec 2 ul de 2 mM de NH 2 - (PM), 10 - (CAGT) 5 à 58 pl d'eau désionisée avec 20 pi de tampon de 0,5 M de HEPES pH 8,5. Réaliser des réactions dans un tube de 1,5 ml. Mélanger rapidement que la réaction se déroule rapidement et doit rivaliser avec hydrolyse NHS-ester.
  4. Soniquer pendant 5-10 min pour bien mélanger. Incuber ~ 1 heure à température ambiante. Le rapport stoechiométrique de BG: ADN peut être modifiée pour conduire la réaction à son terme.
  5. Purifier le BG-ADN à partir de l'aminé n'ayant pas réagi par l'ADN-HPLC en phase inverse exécutant une TEAA 100 mM: acétonitrile (ACN), gradient de 8% à 95% d'acétonitrile en 30 min. L'amine-ADN n'ayant pas réagi éluera avant l'ADN BG. Recueillir la fraction BG-ADN dans un tube conique.
    1. Utilisez une colonne C 18 Zorbax pour la purification d'oligonucléotides standard et le gradient suivant:
      0 → 15 min: 8 → 30% d'ACN;
      15 → 21 min: 30-90% d'ACN;
      21 → 25 min: 90 → 8% d'ACN;
      25 → 30 min: 8% d'ACN;
  6. Congeler dans l'azote liquide et lyophiliser la fraction recueillie. Remettre en suspension l'ADN dans de l'eau déminéralisée. Pour être très prudent, lyophiliser deux fois de plus pour éliminer TEAA résiduelle. TEAA résiduel peut être toxique pour les cellules à des concentrations plus élevées.
  7. Reprendre le BG-ADN lyophilisé dans l'eau, en s'assurant de laver les côtés de ee tube et diluer à environ 25 uM stock. Aliquote et conserver à 4 ° C. Les échantillons ont été conservés pendant ~ 9 mois sans dégradation notable.

3. cellules étiquetage direct avec monovalent Quantum Dots

  1. Eventuellement, passiver les mQDs juste avant une expérience d'imagerie en utilisant des réactifs tels que la caséine (0,5%) ou l'albumine de sérum bovin (BSA, 1 à 3%).
  2. cellules des plaques exprimant la protéine SNAP-marqué sur le total de fluorescence à réflexion interne (FRBR) verre -quality. Dans cette expérience, nous utilisons une lignée cellulaire U2OS exprimant un récepteur Notch1 SNAP-marqués et les surfaces de verre de haute qualité.
  3. Après que les cellules ont attaché au verre (~ 24 h), retirer le support de croissance, laver avec du PBS, et incuber les cellules à 10-30 min à température ambiante dans ~ 100-150 pi de PBS ou milieu cellulaire contenant ~ 1 uM BG- ADN de l'étape 2.6 ci-dessus.
  4. Après incubation avec BG, laver soigneusement les cellules avec du PBS ou milieu cellulaire. Incuber les cellules pendant ~ 5-10 min avec emQDs e produites dans l'étape 1.2.9 (et éventuellement passivation à l'étape 3.1).
  5. Eventuellement, laver les mQDs non liés et retourner les cellules dans un tampon / media approprié à la fois pour l'imagerie et de la culture. Pour les cellules qui étaient à imager en mode FRBR, une étape de lavage final est souvent inutile car mQDs non traitées dans la solution diffusés si rapidement par rapport à mQDs liées pour être indétectable lors de l'analyse.

4. microscopie et analyse

  1. Image les cellules en utilisant un microscope TIRF.
    Remarque: Le champ doit avoir excitation séparée et filtres d'émission, ou un filtre cube QD personnalisé. QDs sont les meilleurs excité avec un laser de faible longueur d'onde (405 ou 488 nm). QD de diamètre différent ont des longueurs d'onde d'émission caractéristiques, généralement associée à un décalage de grande Stoke.
  2. En raison de la luminosité de mQDs, recueillir des images à des cadences élevées dans la FRBR tandis que l'imagerie du côté de base d'une cellule vivante.
    Remarque: Vous pouvez également, la dynamique de molécules uniques peuvent être Follomarier à d'autres plans focaux à l'aide d'un microscope confocal disque rotatif. Logiciel automatisé de suivi une particule est généralement couronnée de succès à un suivi précis des mQDs lumineuses et photostable.

Representative Results

Le transfert de phase des points quantiques d'une organique à une phase aqueuse est critique pour la production de mQDs, mais peut être à la fois et de condition-QD-spécifique. transfert de phase dans la section 1.1 devrait apparaître aussi propre que les deux premiers flacons de la figure 3. Si le transfert apparaît plus comme flacon 3, alors il faut essayer de nouveau avec des conditions différentes.

Une fois que les points quantiques sont revêtues avec l'ADN chargé négativement, ils doivent migrer sur un gel séparément des boîtes quantiques non-enveloppé. Utilisation d'une aliquote de points quantiques déballé en tant que contrôle, une deuxième, une bande à migration plus rapide doit apparaître lors de l'addition de la ptDNA, comme on le voit dans le premier gel à la figure 2B. Formation complète de mQDs est démontré par la perte de la bande immobile, et sa chute dans la bande du service mobile tel que vu dans le dernier gel sur la figure 2B. Si une aliquote de votre produit MQD migre sous forme d'une bande unique séparable des boîtes quantiques déballé, vos mQDs sont monovalents et r eady à être utilisé dans d'autres étapes.

étiquetage cellulaire doit être spécifique à la cible de votre choix et devrait dépendre du niveau d'expression de protéines et la concentration MQD. L'optimisation empirique de deux concentration MQD et MQD passivation est souvent nécessaire pour une application donnée. Figure 4B montre le marquage des cellules U2OS exprimant un récepteur Notch SNAP-marqués avec mQDs des concentrations allant de 0,5 à 10 nm.

Figure 1
Figure 1: ciblage de mQDs modulaire. MQDs s'hybrident à l'ADN sb fonctionnalisé par différentes molécules de ciblage. Benzylguanine-liée cibles d'ADN mQDs SNAP-marqués protéines de fusion. D'autres modifications en 5 'et les séquences d'ADN permettent le ciblage des mQDs à une variété d'autres biomolécules./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2 Schéma de production de mQDs. (A) en phase organique les points quantiques sont transférés vers la phase aqueuse par traitement avec un thiol et mPEG TBAB, enveloppé avec ptDNA, et passivées par un groupe carboxy PEG6 alcane thiol. Images représentant TEM sont QD545 organique, QD585, et QD605, respectivement. (B) Un procédé pour déterminer de manière empirique la stoechiométrie de l'interaction entre les boîtes quantiques et ptDNA en deux étapes ci-dessus. & QD ptDNA stoechiométries sont vérifiées empiriquement par densitométrie de telle sorte que la stoechiométrie de la réaction finale est de 1: 1 (QD: ptDNA). Le nombre initial de moles de ptDNA est multiplié par le rapport entre QD: MQD, et ajustée par le volume réel d'af ter la conjugaison pour donner le nombre de moles nécessaires pour atteindre 1: 1. conjugaison S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3: Les détails expérimentaux pour la production de mQDs. (A) photos représentatifs de succès et à l'échec de transfert de phase. QD devrait visuellement transférer entre la phase organique dense et la phase aqueuse moins dense. Séparation de phase incomplète indique un mauvais transfert. (B) ptDNA peut être remplacé par l'alcane-thiol-PEG. Droit de données gel est représentatif d'une réaction dans laquelle une fraction importante de ptDNA ont été déplacés à partir des points quantiques due à une sur-passivation.es.jpg "target =" _blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4 protéines SNAP-étiquetage marqué sur des cellules vivantes. (A) Schéma montrant l'expression, l'attachement et l'étiquetage d'un récepteur SNAP-marqué d'un MQD BG-ciblée. (B) de l'étiquetage représentant de cellules exprimant un SNAP-Notch-mCherry construire à différentes concentrations MQD. mQDs passives avec PEG12 colocalisent avec mCherry indiquant un étiquetage spécifique. Densités plus faibles en matière d'étiquetage (<0,5 nM) sont généralement préférables pour le suivi de particules isolées. La barre d'échelle est de 10 um. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Discussion

La modularité de la conception MQD permet un accroissement du niveau de flexibilité expérimentale. Par exemple, une variété de mQDs peuvent être préparés rapidement en couleurs uniques permettant l'imagerie simultanée de multiples cibles. La séquence de ciblage ADN simple brin peut diriger mQDs de protéines, de sucres, de lipides et 12 surfaces 13. Un certain nombre de balises enzymatiques sont disponibles avec des réactivités orthogonales, permettant à plusieurs cibles à imager simultanément avec mQDs différemment ciblées. En plus de cibler avec l'étiquette de SNAP, l'étiquetage des protéines cibles avec mQDs utilisant la balise CLIP, l'étiquette de HALO, et des protéines biotinylées a également été couronnée de succès. Ce protocole montre le marquage spécifique d'un récepteur de surface de cellules vivantes avec ces mQDs, mais le protocole peut être facilement adapté à un certain nombre de contextes différents.

L'idée méthodologique important dans la production de mQDs de valence est défini que ~ 50 phosphorothioate-liébases sont nécessaires pour envelopper les boîtes quantiques (et éviter ainsi deux molécules de liaison simultanément). A-Une séquence poly S 50 reproductible et liée de façon stable 605 nm boîtes quantiques de Life Technologies. Bien que ce produit a été abandonné, la stratégie d'exclusion stérique est généralisable à des produits similaires d'autres fournisseurs ayant des tailles différentes, des formes, des propriétés spectrales.

L'efficacité et la stabilité des boîtes quantiques ptDNA emballés dépendent essentiellement de la chimie de surface et la structure des boîtes quantiques. Par conséquent, la réussite d'un protocole dépend de la structure chimique et de la source commerciale des points quantiques. Pour les fins du présent protocole, il existe trois principaux points de divergence entre les différentes sources commerciales de boîtes quantiques: une différence dans les conditions nécessaires pour le transfert de phase; une différence dans la force initiale de PEG-thiol-ligand de liaison, peut entraver le déplacement par ptDNA; et une différence dans la quantité de CdSe noyau exposé, qui peut leannonce à la trempe de la QD par les conditions de transfert de phase thiol MPEG.

Dès la publication, les points quantiques avec la meilleure structure pour la production de mQDs sont les points quantiques 4-10 nm CdSe / ZnS base / shell achetés auprès de Life Technologies avec des spectres d'émission à 545, 585, 605 et 625 nm (figure 2A). QD basées sur la formulation «Vivid» (545, 605, etc) étanchent lors de l'ajout de mPEG thiol et ne conviennent pas pour cette application. QD de Aldrich et océan Nanotech fonctionnent bien, mais nécessitent des étapes de transfert de phase et plus prétraitement avec de l'oxyde de trioctylphosphine. Ce protocole a été optimisé pour les points quantiques de Life Technologies.

La séquence poly-A phosphorothioate utilisé pour envelopper les boîtes quantiques est terminé par une queue d'ADN 20-mère contenant la séquence native de (ACTG) 5 dans laquelle un brin de ciblage peut s'hybrider. Cette séquence est commode, car il a peu ou pas de structure secondaire, et restera hybridized à 37 ° C dans du PBS. Si on a accès à un synthétiseur d'ADN, par la ptDNA peut alors synthétisé et purifié par Chromatographie liquide à haute performance en phase inverse (HPLC) utilisant une colonne C 8. Le ptDNA éluera plus tard sur la HPLC que oligonucléotides équivalentes à squelette natif. Nous laissons généralement 5 'DMT groupe protecteur sur nos oligonucléotides phosphorothioates après purification.

Passivation des boîtes quantiques ptDNA-emballés est généralement nécessaire pour améliorer la stabilité colloïdale des boîtes quantiques et réduire la liaison pour les applications les plus expérimentales fond. Le protocole utilise un PEG-couche de passivation les boîtes quantiques. Carboxy PEG de alcanethiol avec des unités supplémentaires de PEG ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, carboxy-PEG12 alcane thiol) contribuent à réduire de manière significative fond, si les PEG plus sont à la fois plus grande, et généralement plus coûteux. mQDs revêtus de carboxy PEG alkaligands thiols nes sont très stable dans des tampons physiologiques tels que le phosphate tamponnée salines et les milieux de culture. Stockage à long terme (> 8 mois) de mQDs à 4 ° C n'a montré aucune agrégation significative ou détachement ptDNA 11. En fonction de l'expérience, le PEG passivation des points quantiques ne pas toujours seul réduire suffisamment la liaison non spécifique des mQDs. L'incubation des cellules et les deux mQDs dans une solution saline tamponnée au phosphate (PBS) contenant 3% de BSA pendant 20 minutes avant utilisation permet de réduire sensiblement la liaison non spécifique à des cellules, bien que cela augmente le rayon hydrodynamique apparent des mQDs de ~ 50%. Passivation avec 0,5% de caséine réduit la liaison non spécifique, mais encore elle augmente la taille apparente d'une plus grande mesure que la BSA.

L'extrémité 5 'd'un brin d'ADN complémentaire à la mQDs peut être modifié pour permettre le ciblage d'un certain nombre de différentes biomolécules. Il existe un certain nombre de techniques disponibles établies pour modifier de manière covalente les protéines, lipids et des sucres à l'ADN simple brin (ADN simple brin). Tant que l'ADNsb est présentée de façon extracellulaire, il est accessible à mQDs solubles. mQDs avec les séquences ci-dessus seront rapidement s'hybrider avec leur brin d'ADN complémentaire dans des conditions de culture cellulaire. Un 10-20x poly (CT) entretoise entre la ptDNA et la séquence de ciblage peut être nécessaire pour le ciblage efficace de façon à élever la séquence de liaison au-dessus de la glycocalyx épaisse et chargée négativement de la cellule. Pour ce protocole, on a choisi pour produire un ADN-BG avec une séquence complémentaire de (CAGT) 5 qui sera hybridée à la fois aux mQDs covalente et se lier à une protéine SNAP-tag pour le marquage rapide et précis. A fonctions protocolaires similaires bien pour le couplage d'autres esters NHS à oligonucléotides aminés modifiés.

Pour l'imagerie de molécules simples, une faible densité de marquage est typiquement nécessaire pour résoudre des molécules individuelles. Une concentration MQD finale de ~ 0,5 nM dans du PBS avec agent de passivationest une bonne cible. Cependant, ces dilutions élevées parfois donné lieu à une sous-marquage des cellules. Si cela se produit, MQD supplémentaire peut être ajouté jusqu'à une densité optimale de marquage n'est observé. Dans le cas de Notch1 humain SNAP-marqués, les concentrations de> 10 nM MQD cellules produites à l'étiquetage denses tandis que 0,5 nM MQD conduit à la fixation de ~ 20 mQDs à la surface de base de cellule cible (voir la figure 4B). étiquetage portable avec mQDs était fortement tributaire de la confluence de cellules étalées. Trop cellules confluentes ne pas étiqueter leurs surfaces de base.

En résumé, une méthode simple pour générer monovalent et boîtes quantiques modulaires a été décrite. Ces mQDs trouvent une utilité dans une large gamme d'applications d'imagerie des cellules, tel que démontré par l'imagerie du récepteur Notch sur les cellules vivantes U2OS. Applicabilité de mQDs n'est pas limitée à ce cas particulier, mais peut être étendu à d'autres potentiellement des cibles cellulaires tels que d'autres protéines, acides nucléiques et les enzymes.

Acknowledgements

Le financement accordé par le DOD W81XWH-01.10.1023 (ZJG), subvention P50 GM081879 du Centre UCSF pour les systèmes et la biologie synthétique (ZJG), NIH 5R21EB015088-02 (YJ) et NIH 1R21EB018044 (ZJG & YJ). DS a été soutenu par le programme Human Frontier Science croisée postdoc disciplinaire bourse de recherche.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats