Produktion und Targeting von Monovalenter Quantenpunkte

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

Die Dynamik einzelner Moleküle an lebenden Zellen beiträgt, ihre biologische Funktion. Einzelmolekül-Fluoreszenz-Bildgebung ist eine beliebte Methode, um einzelne Molekül Dynamik auf der Zelloberfläche 1,2,3 studieren. Die am häufigsten verwendeten Bildgebungssonden in diesen Studien haben jedoch mehrere wesentliche Nachteile. Zum Beispiel herkömmliche organische Farbstoffe und fluoreszierende Proteine ​​liefern moderate Helligkeit, etwa 10 5 bis 10 6 M -1 cm -1, sind aber photochemisch instabil, Bleichen nach der Emission von etwa 10 5 bis 10 6 Photonen unter typischen Live-Cell-Imaging Bedingungen 4,5. Im Gegensatz dazu Halbleiter-Nanopartikel, häufig als Quantenpunkte (QP), sind deutlich heller und stabil, mit Extinktionskoeffizienten im Bereich von 10 6 bis 10 7 M -1 cm -1, und mehr als 10 7 -10 8 emittierten Photonen vor photoblEACHING 5. Die verbesserte Helligkeit und Photo QDs über organische Farbstoffe ermöglicht die Beobachtung von einzelnen Molekülen zu deutlich schnellere Bildwiederholraten und über wesentlich längere Flugbahnen 6.

Trotz ihrer Vorteile und kommerzielle Verfügbarkeit, bleiben mehrere Verbindlichkeiten für diese leistungsfähige Imaging-Agenten. Erstens, sie schlecht definierten Ziel Wertigkeit, die Vernetzung der Biomoleküle gezielt 6 führen kann. Zweitens, sie haben in der Regel eine große hydrodynamische Größe (> 20 nm), die Zugänglichkeit zu bestimmten zellulären Umgebungen überfüllten 7 begrenzt. Drittens, sie beschränkt Targeting Modularität 7. Mehrere Strategien sind versucht, diese Probleme anzugehen 8,9,10, aber im Allgemeinen erfordern spezielle Kenntnisse und Reagenzien zu implementieren.

Um diese Probleme anzugehen, die vor kurzem beschrieben wir eine "sterische Ausschlußchromatographie" Strategie zur Herstellung einwertiger, klein, undmodulare QDs 11. Die QDs sind mit einem einzigen langen Phosphorothioat- DNA (ptDNA) Polymer gewickelt. Die ptDNA bindet an den QD-Oberfläche durch mehrere Zn-S-Wechselwirkungen zwischen oberflächenexponierten Zn-Atome und der Phosphorthioat-Gruppen des Polymers ptDNA. Ein einzelnes Polymer gebunden sterisch und elektrostatisch schließt die Bindung von zusätzlichen Mitteln des Polymers ohne Gesamtgröße des Partikels (ca. 2 nm) deutlich zu erhöhen. Alle Reagenzien sind im Handel erhältlich, Produkte in hoher Ausbeute gebildet wird, und das Verfahren erfordert nur Entsalzungsschritte zur Reinigung. Einmal markiert, QDs mit einem einzigen ptDNA (mQDs) binden an komplementäre DNA-Stränge Lager Targeting-Domains (zB Benzylguanin (BG), benzylcytosine oder Alkylhalogenide) gewickelt.

Diese Funktionalitäten gezielt die mQDs spezifisch an enzymatischen Tags wie SNAP, CLIP-HALO, das genetisch mit dem interessierenden Protein fusioniert sind. Ein Protokoll für die Synthese, Targeting, und Live-Cell-Imaging von mQDs durch sterische Ausschluss produziert.

Protocol

1. Herstellung von monovalente Quantenpunkte

  1. Phasentransfer von QDs von organischer zu wässriger Phase
    1. Verdünnen 200 ul einer Lösung von 1 uM organische Phase QDs mit 400 ul Chloroform in einer 5-ml-Glasflasche.
    2. Mischen 400 ul einer 0,3 M Tetrabutylammoniumbromid (TBAB) Chloroform-Lösung mit 36 ul ordentlich mPEG Thiol (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) und schütteln O / N.
    3. Fügen Sie 800 ul einer 0,2 M NaOH-Lösung und schütteln für 30 Sekunden. Ein Phasentransfer erfolgt innerhalb von wenigen Minuten, nach der Übertragung der Farbpartikel in die wässrige Phase über dem dichteren organischen Phase zeigte.
    4. Wenn die Teilchen aggregieren in einer dritten Phase zwischen den wässrigen und organischen Phasen, erhöhen die Inkubationszeit mit dem MPEG Thiol. Wenn die wässrige Phase klar bleibt, haben die QDs nicht Phasentransfer (siehe Abbildung 3a). Alternativ erhöhen Sie die concentRation von mPEG Thiol in Schritt 2, um schlechte Phasen-Transfer zu lindern.
    5. Wiederherstellung der (farbigen) wässrige Phase und dann konzentrieren die gesammelten QDs mit einem Centricon-Spin-Säule (30 kDa Molekulargewicht cut-off) auf 1 ml.
    6. Hinzufügen des konzentrierten QD Lösung in eine Sephadex NAP10 Säule mit 10 mM Tris-Puffer, enthaltend 30 mM NaCl (pH 8,0) äquilibriert. Eluieren QDs mit 1,5 ml Elutionspuffer durch die Schwerkraft fließen.
    7. Messen die Konzentration von QDs mit Absorptionsspektroskopie bei 350 nm auf.
  2. Vorbereitung der mQDs
    1. Kauf (oder synthetisieren) ptDNA. Dieses Protokoll verwendet die Sequenz 5'-A S 50 (CT) 10 (ACTG) 5 -3 '(siehe Tabelle 1).
DNA Folge
5'-A S 50 (CT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (CT) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tabelle 1. DNA-Sequenzen verwendet werden, um zu produzieren und Ziel mQDs.

  1. Vorbereitung 1 ml von 100 nM QD-Lösung in 10 mM Tris-Puffer, enthaltend 30 mM NaCl (pH 8).
  2. Add-Drop-weise 500 ul der 100 nM ptDNA Lösung der wässrigen QDs für 1 min unter kräftigem Rühren. Rühren oder legen Sie auf einem Schüttler für eine weitere 9 Stunden.
    Hinweis: Dies sollte theoretisch produzieren eine 1: 2-Verhältnis von ptDNA: QD. Allerdings ist die tatsächliche Stöchiometrie nie perfekt - in der Regel das Ergebnis ist näher an 1: 1,5. Um ein 1: 1-Verhältnis von ptDNA: QD ist Densitometrie nach Gelelektrophorese notwendig, das genaue Verhältnis der Konjugation angesichts der bekannten Volumina oben verwendet quantifizieren.
  3. Entfernen ~ 10 ul des Gemisches auf QD auf einem analytischen Agarosegel laufen gelassen. Auch entfernen, eine ähnliche Konzentration von unkonjugierten QDs in wässriger Phase (aus Schritt 1.2.1).
    1. Fügen Sie ~ 2 μ; L 6x Ficoll-Ladepuffer (Lösungsdichte zu erhöhen), und führen diese beiden Proben zusammen auf einem 0,8% wt / v Agarose-Gel in Natriumboratpuffer für 15 min bei 150 V eine einzige Bande in der Kontrollspur unkonjugierten Migration in der Nähe die gut, und zwei Bands in der Spur mit konjugierten QDs gesehen (siehe Gele in Abbildung 2b).
  4. Berechne den unkonjugierten QD Fraktion mit der relativen Intensität der beiden Banden (siehe Gleichung in 2B). Dann nutzen Sie diesen Bruch, um das zusätzliche Volumen von 100 erforderlich ist, um die Anzahl der Quantenpunkte entsprechen nM ptDNA Lösung zu berechnen.
  5. Wiederholen Sie die Schritte 1.2.3 noch einmal mit diesem berechneten Volumen oder bis zum Zusammenbruch konjugierten QDs in einer einzigen Bande auf dem Gel, was eine vollständige Konjugation von allen QDs 1.2.5.
  6. 100 ul 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxy PEG6 Alkanthiol) in 10 mM Tris-Puffer Containing 30 mM NaCl (pH 8) auf die konjugierten mQDs oben hergestellt, und schüttelt 10 min.
    Hinweis: Diese PEG-Liganden zu passivieren, die QD-Oberfläche. Eine längere PEG wird besser-Passivieren der QDs, es wird jedoch auch ihre Größe zu erhöhen. Die hydrophobe Alkan Thiolfunktionalität hat eine viel höhere Affinität zu den QDs, in der Summe als für Phasentransfer der weniger hydrophoben PEG-Thiol. Daher erlauben dies nicht Schritt zu lang, um fortzufahren, oder ptDNA wird von der Alkan-PEG-Thiol ersetzt werden. Nach einer ~ 30 min Inkubation wird ein erheblicher Anteil der DNA aus den QDs (3B) vertrieben wurden.
  7. Um überschüssige Alkan PEG-Thiol zu entfernen, mit 0,5 ml der QD-Lösung auf eine Sephadex NAP5 Säule mit Elutionspuffer äquilibriert (10 mM Tris-Puffer, enthaltend 30 mM NaCl). Sammle die mQDs mit 1,0 ml Elutionspuffer durch Schwerkraftströmung.
  8. Konzentrieren die gesammelten QDs mit einem Centricon-Spin-Säule (30 kDa). Bewahren Sie diese mQDs bei 4 ° C für Monate. Fr nichteeze ihnen.
    Anmerkung: Wenn eine farbige Pellet in dem Boden des Rohres gesehen, haben die Punkte zusammengefasst und nicht mehr wahrscheinlich ist verwendbar.

2. Herstellung von Targeting (Benzylguanine-) DNA

  1. Produzieren oder kaufen, Amin-terminierte DNA. Dieses Protokoll verwendet die Sequenz 5'-NH 2 - (CT) 10 - (CAGT) 5 -3 '(siehe Tabelle 1). Die Poly-Linker CT erhöht Zugänglichkeit Funktionalität tief in der Glykokalyx begraben, aber möglicherweise nicht für alle Anwendungen benötigt werden. Wenn es Zugang zu einem DNA-Synthesizer erzeugen aminomodifizierten DNA unter Verwendung einer geeigneten 5'-Amino-Modifikator (5'-Amino-Modifier C6).
  2. Auflösen BG-N-hydroxysuccinimid (NHS-BG) in trockenem Dimethylsulfoxid (DMSO) in einer Konzentration von 10 mg / ml.
    Hinweis: BG-NHS wird Wasser aus der Luft aufnehmen und führen zu Hydrolyse des reaktiven NHS-Ester, insbesondere in hygroskopischen Lösungsmittel wie DMSO und Dimethylformamid (DMF). BG-NHS ist beste Geschäftd bei -80 ° C als Pulver in einem eigenen Gefäß in einem zweiten Behälter, enthaltend Trockenmittel. Warm vor dem Öffnen der Fläschchen RT Alternativ sofort aliquotiert zur Einzelnutzung der BG-NHS-Ester in ein trockenes polares Lösungsmittel und frieren bei -80 ° C oder vollständig reagieren mit der Amin-DNA in Schritt 2.2.
  3. Reagieren, indem das BG-NHS in DMSO aus Schritt 2.1 mit Amin-terminierten DNA in HEPES (4-(2-hydroxyethyl)-1-piperazinethansulfonsäure)-gepufferter (pH 8,5) Wasser. In einer typischen Reaktion 20 ul 10 mg / ml BG-NHS in DMSO mit 2 ul 2 mM NH 2 - (CT) 10 - (CAGT) 5 in 58 ul entionisiertem Wasser mit 20 ul 0,5 M HEPES pH 8,5 gepuffert. Zuführen Reaktionen in einem 1,5-ml-Mikrozentrifugenröhrchen. Mischen schnell wie die Reaktion schnell und müssen mit NHS-Ester-Hydrolyse zu konkurrieren.
  4. Beschallen für 5-10 min eine gute Durchmischung zu gewährleisten. Inkubieren ~ 1 h bei RT. Das stöchiometrische Verhältnis von BG: DNA kann verändert werden, um die Reaktion zu vervollständigen.
  5. Reinige den BG-DNA von der nichtumgesetzten Amin-DNA mittels Umkehrphasen-HPLC ausgeführt 100 mM TEAA: Acetonitril (ACN)-Gradienten von 8% bis 95% Acetonitril über 30 min. Das nicht umgesetzte Amin-DNA wird vor der BG-DNA zu eluieren. Sammeln Sie die BG-DNA-Fraktion in einem konischen Rohr.
    1. Verwenden Sie ein C 18 Zorbax Spalte für Standard-Oligonukleotid-Reinigung und des folgenden Gradienten:
      0 → 15 min: 8 → 30% ACN;
      15 → 21 min: 30-90% ACN;
      21 → 25 min: 90 → 8% ACN;
      25 → 30 min: 8% ACN;
  6. Einfrieren in flüssigem Stickstoff und lyophilisiert die gesammelten Fraktion. Resuspendieren DNA in VE-Wasser. Um besonders vorsichtig sein, lyophilisieren zwei weitere Male, um Rest TEAA entfernen. Rest TEAA kann bei höheren Konzentrationen für Zellen toxisch sein.
  7. Resuspendieren lyophilisiert BG-DNA in Wasser, und achten Sie auf die Seiten der th waschenE Rohr, und mit Wasser auf ~ 25 uM Lager. Aliquoten und bei 4 ° C. Die Proben wurden für ~ 9 Monate ohne merkliche Verschlechterung gespeichert.

3. Kennzeichnung lebenden Zellen mit monovalenten Quantum Dots

  1. Gegebenenfalls Passivieren der mQDs unmittelbar vor einem Abbildungsexperiment unter Verwendung von Reagenzien wie Casein (0,5%) oder Rinderserumalbumin (BSA, 1-3%).
  2. Platte Zellen, die den SNAP-markierten Protein auf Totalreflexions-Fluoreszenz (TIRF) -Qualität Glas ausdrücken. In diesem Experiment verwenden wir eine U2OS-Zelllinie ein SNAP-tag Notch1-Rezeptor und hochwertige Glasflächen ausdrückt.
  3. Nachdem die Zellen auf das Glas (~ 24 h) angebracht sind, entfernen Wachstumsmedien, waschen mit PBS und Inkubation der Zellen für 10-30 min bei RT in ~ 100-150 ul PBS oder Zell Medien mit ~ 1 uM BG DNA aus Schritt 2.6.
  4. Nach Inkubation mit BG, sorgfältig waschen die Zellen mit PBS oder Zell Medien. Inkubieren Sie die Zellen für ca. 5-10 Minuten mit thin Schritt 1.2.9 hergestellten E mQDs (und gegebenenfalls die in Schritt 3.1 passiviert).
  5. Optional, waschen Sie die ungebundenen mQDs und geben die Zellen zu einem Puffer / Medien sowohl für Bildgebung und Kultur. Für Zellen, die in TIRF-Modus abgebildet werden sollten, war eine letzte Waschschritt oft unnötig, da ungebundene mQDs in Lösung im Vergleich mit gebundenen mQDs als während der Analyse nicht nachweisbar zu sein diffundiert, so schnell.

4. Mikroskopie & Analysis

  1. Bild die Zellen mit Hilfe eines TIRF-Mikroskop.
    Hinweis: Der Umfang muss trennbar Anregungs-und Emissionsfilter oder einen benutzerdefinierten QD Filterwürfel haben. QD am besten Anregung mit einer geringen Wellenlängen-Lasers (405 oder 488 nm). QDs unterschiedlicher Durchmesser haben charakteristische Emissionswellenlängen, in der Regel mit einer großen Stokes-Verschiebung verbunden.
  2. Aufgrund der Helligkeit des mQDs, sammeln Bilder bei hohen Bildraten in TIRF, während die Abbildung der basalen Seite von einer lebenden Zelle.
    Hinweis: Alternativ können Einzelmoleküldynamik Follo seinbei anderen Brennebenen mit einer sich drehenden Scheibe konfokalen Mikroskop heiraten. Automatisierte Einzelpartikel-Tracking-Software ist in der Regel auf genau die Verfolgung der hellen und photo mQDs erfolgreich.

Representative Results

Der Phasenübergang der Quantenpunkte aus einem organischen in eine wässrige Phase ist entscheidend für die Herstellung von mQDs, kann aber auch Konditionierung und QD-spezifisch sein. Phasentransfer in Abschnitt 1.1 sollte so sauber wie die ersten beiden Fläschchen in Abbildung 3 angezeigt. Wenn Übertragung erscheint mehr wie Fläschchen 3, dann sollte man wieder mit unterschiedlichen Bedingungen zu versuchen.

Nachdem die Quantenpunkte mit der negativ geladenen DNA beschichtet sie auf einem Gel getrennt von den nicht-umhüllt QD migrieren. Verwendung eines Aliquots der ungeöffneten QP als Kontrolle wurde eine zweite, sollte schneller wandernde Bande bei Zugabe des ptDNA erscheinen, wie in dem ersten Gel in 2B zu sehen. Vollständige Bildung mQDs ist mit dem Verlust des unbeweglichen Band und deren Zusammenbruch in den mobilen Band, wie in der letzten Gel in 2B gesehen gezeigt. Wenn ein Aliquot Ihre MQD Produkt wandert als eine einzelne Bande trennbar von den ungeöffneten QDs, dann wird Ihr mQDs monovalente und r eady in weiteren Schritten verwendet werden.

Zellmarkierung sollten speziell auf die Ziel Ihrer Wahl und sollte abhängig von Proteinexpressionsniveaus und MQD Konzentration sein. Für jede gegebene Anwendung wird oft empirische Optimierung sowohl MQD Konzentration und MQD Passivierung erforderlich. 4B zeigt die Markierung von U2OS-Zellen ein SNAP-markierte Notch-Rezeptors mit mQDs im Konzentrationsbereich von 0,5 nM bis 10 nM exprimieren.

Figur 1
Abbildung 1. Modulare Ausrichtung der mQDs. MQDs hybridisieren ssDNA durch verschiedene Targeting-Moleküle funktionalisiert. Benzylguanin gebundenen DNA-Ziele mQDs Fusionsproteine ​​SNAP-tag. Modifikationen andere 5 'und DNA-Sequenzen ermöglichen die Ausrichtung der mQDs zu einer Vielzahl von anderen Biomolekülen./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Schema für die Produktion von mQDs. (A) Organische Phase QD werden in die wässrige Phase durch Behandlung mit mPEG Thiol und TBAB mit ptDNA gewickelt übertragen und mit Carboxy PEG6 Alkanthiol passiviert. TEM-Bilder sind organische QD545, QD585 und QD605 sind. (B) Ein Verfahren zum empirischen Bestimmen der Stöchiometrie der Wechselwirkung zwischen QD und ptDNA oben in Schritt zwei. QD-ptDNA Stöchiometrien werden empirisch durch Densitometrie verifiziert, so daß das endgültige Reaktions Stöchiometrie von 1: 1 (QD: ptDNA). Die anfängliche Anzahl der Mole ptDNA wird durch das Verhältnis von QD multipliziert: MQD und durch die tatsächliche AF eingestellt ter Konjugation, um die Anzahl der Mole benötigt, um 1 zu erreichen. Ausbeute: 1 Konjugation Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Experimentelle Details zur Herstellung von mQDs. (A) Repräsentative Fotos von erfolgreichen und gescheiterten Phasentransfer. QDs visuell zwischen dem dichten organischen Phase und der weniger dichten wässrigen Phase zu übertragen. Unvollständige Phasentrennung zeigt schlechte Übertragung. (B) ptDNA durch die Alkan-PEG-Thiol ersetzt. Rechts Gel Daten repräsentativ für eine Reaktion, bei der ein signifikanter Bruchteil ptDNA wurden aus der QD durch Über Passivierung vertrieben.ES.jpg "target =" _blank "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 4
Abbildung 4. Labeling SNAP-markierten Proteine ​​an lebenden Zellen. (A) Schematische, welche die Expression, Befestigung und Kennzeichnung eines SNAP-markierten Rezeptors mit einem BG-Ziel MQD. (B) Repräsentative Kennzeichnung von Zellen, die ein SNAP-Notch-mCherry bauen bei verschiedenen Konzentrationen MQD. mQDs mit PEG12 passiviert colokalisieren mit mCherry zeigt spezifische Markierung. Nieder Kennzeichnung Dichten (<0,5 nm) sind in der Regel für Einzelpartikelverfolgung vorzuziehen. Maßstab ist 10 um. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Discussion

Die Modularität des MQD Design ermöglicht einen erhöhten Grad der experimentellen Flexibilität. Zum Beispiel kann eine Vielzahl von mQDs schnell in einzigartige Farben ermöglicht die gleichzeitige Darstellung von mehreren Zielen hergestellt werden. Die ssDNA-Zielsequenz können zu Proteinen mQDs lenken, Zucker 12, Lipide und Flächen 13. Eine Reihe von enzymatischen Tags sind mit orthogonaler Reaktivität, so dass mehrere Ziele gleichzeitig mit unterschiedlich gezielte mQDs abgebildet werden. Neben der Ausrichtung mit der SNAP-Tag, war auch die Kennzeichnung von Zielproteinen mit mQDs mit der CLIP-Tag, das HALO-Tag und biotinylierte Proteine ​​erfolgreich. Dieses Protokoll zeigt die spezifische Markierung von einem Oberflächenrezeptor auf lebende Zellen mit diesen mQDs, aber das Protokoll könnte leicht zu einer Reihe von verschiedenen Kontexten angepasst werden.

Die erhebliche methodische Einblick in die Herstellung mQDs mit definierten Wertigkeit ist, dass ~ 50 Phosphorothioat- gebundenenBasen sind erforderlich, um die Quantenpunkte wickeln (und damit verhindern zwei Moleküle gleichzeitig Bindung). Eine Poly-A-S 50-Sequenz reproduzierbar und stabil gebunden 605 nm QDs von Life Technologies. Obwohl dieses Produkt wurde eingestellt, ist die sterische Ausschluss Strategie verallgemeinerbar zu ähnlichen Produkten von anderen Anbietern mit unterschiedlichen Größen, Formen, spektralen Eigenschaften.

Die Effizienz und Stabilität der ptDNA-wickelte QDs hängt entscheidend von der Oberflächenchemie und Struktur der Quantenpunkte. Daher wird der Erfolg eines Protokolls von der kommerziellen Quelle und der chemischen Struktur der Quantenpunkte abhängen. Für die Zwecke dieses Protokoll drei Hauptpunkte der Unterschied existiert zwischen verschiedenen kommerziellen Quellen QD: ein Unterschied in der Phasentransferbedingungen erforderlich; ein Unterschied in der Stärke der ersten PEG-Thiol-Liganden-Bindung, möglicherweise behindern Verschiebung der ptDNA; und ein Unterschied in der Menge des belichteten CdSe-Kern, der LEAnzeige an der Löschung der QD von der MPEG-Thiol Phasentransferbedingungen.

Wie der Veröffentlichung, QDs mit der besten Struktur für die Produktion von mQDs sind 4-10 nm CdSe / ZnS Kern / Schale-QDs von Life Technologies bei 545, 585, 605 & 625 nm (Abbildung 2A) gekauft mit Emissionsspektren. QD auf der Basis der "Klare"-Formulierung (545, 605, etc.) zu löschen bei Zugabe von mPEG Thiol und sind nicht geeignet für diese Anwendung. QDs von Aldrich und Ocean Nanotech gut funktionieren, benötigen aber mehr Phasentransferschritte und Vorbehandlung mit Trioctylphosphinoxid. Dieses Protokoll wurde für QDs von Life Technologies optimiert.

Die Poly-A-Phosphorothioat-Sequenz verwendet, um die Quantenpunkte wickeln mit einer nativen 20-mer DNA-Schwanz, der die Sequenz von (ACTG) 5, an die ein Targeting-Strang hybridisieren beendet. Diese Sequenz ist praktisch, da es wenig bis gar keine Sekundärstruktur und wird hybridiz bleibenED bei 37 ° C in PBS. Wenn es Zugang zu einem DNA-Synthesizer, kann die ptDNA synthetisiert und dann durch Umkehrphasen-Hochleistungs-Flüssigkeitschromatographie (HPLC) gereinigt, unter Verwendung eines C 8-Säule. Die ptDNA wird später auf der HPLC als gleichwertige Oligonukleotide mit einer nativen Rückgrat eluieren. Wir in der Regel verlassen die 5 'DMT-Schutzgruppe an unserer Phosphorothioatoligonukleotide nach der Reinigung.

Passivierung der ptDNA-wickelte QDs ist in der Regel, um kolloidale Stabilität der QDs zu verbessern und die Hintergrundbindung für die meisten experimentellen Anwendungen erforderlich ist. Das Protokoll verwendet eine PEG-Schicht, um die QDs zu passivieren. Carboxy PEG Alkanthiol mit zusätzlichen PEG-Einheiten ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, Carboxy-PEG12 Alkanthiol) sieht der Hintergrund reduziert, wenn die längeren PEGs sind beide größer, und in der Regel teurer. mQDs mit Carboxy PEG Alka beschichtetne Thiolliganden sind in physiologischen Puffern sehr stabil, wie Phosphat-gepufferte Salzlösungen und Kulturmedien. Langfristigen Lagerung (> 8 Monate) von mQDs bei 4 ° C zeigte keine signifikante Aggregation oder ptDNA Ablösung 11. In Abhängigkeit von dem Versuch, PEG Passivierung der QD allein nicht immer ausreichend nicht-spezifische Bindung der mQDs reduzieren. Inkubieren sowohl Zellen und mQDs in phosphatgepufferter Salzlösung (PBS), enthaltend 3% BSA für 20 min vor dem Einsatz verringert wesentlichen nicht-spezifische Bindung an Zellen, obwohl es die scheinbare hydrodynamische Radius der mQDs von ~ 50%. Passivierung mit 0,5% Casein reduziert die nicht-spezifische Bindung noch weiter aber die scheinbare Größe in einem größeren Ausmaß als BSA erhöht.

Das 5'-Ende eines DNA-Strangs komplementär zu den mQDs kann modifiziert werden, um gezielt aus einer Anzahl von verschiedenen Biomolekülen ermöglichen. Es gibt eine Anzahl von etablierten Techniken zur Verfügung, um Proteine ​​kovalent zu modifizieren, lipids & Zucker mit Einzelstrang-DNA (ssDNA). Solange die ssDNA extrazellulär dargestellt, ist es zugänglich löslichen mQDs. mQDs mit den vorstehenden Sequenzen schnell hybridisieren mit komplementären DNA-Strang unter Zellkulturbedingungen. Ein 10-20x Poly (CT) Abstandshalter zwischen dem ptDNA und der Targeting-Sequenz für eine effiziente Ziel erforderlich, um die Bindungssequenz über der dicken und negativ geladenen Glykokalyx der Zelle erhöhen zu sein. Aus diesem Protokoll haben wir uns für einen BG-DNA mit einer komplementären Sequenz von (CAGT) 5, die sowohl zu den mQDs hybridisiert und kovalent selbst einen Link zu einer SNAP-tag-Protein für eine schnelle und spezifische Markierung produzieren wird. Ein ähnliches Protokoll-Funktionen auch für die Kopplung anderen NHS-Ester zu Amino-modifizierte Oligonukleotide.

Für Einzelmolekülbildgebung, eine geringe Dichte der Markierung in der Regel erforderlich, um einzelne Moleküle zu lösen. Eine endgültige MQD Konzentration von ~ 0,5 nm in PBS mit Passivierungsmittelsist ein gutes Ziel. Allerdings führte unter-Markierung der Zellen diese hohen Verdünnungen manchmal. Wenn dies auftritt, können zusätzliche MQD zugegeben, bis eine optimale Dichte der Markierung beobachtet werden. Im Fall von SNAP-markierten menschlichen Notch1 Konzentrationen von> 10 nM MQD erzeugt dichte Markierung von Zellen unter 0,5 nM MQD in Folge der Anbringung ~ 20 mQDs an der Grundfläche der Zielzelle (siehe Abbildung 4b). Zellmarkierung mit mQDs war stark abhängig von der Konfluenz der Zellen plattiert. Mäßig konfluenten Zellen nicht an ihren Grundflächen zu kennzeichnen.

Zusammenfassend, ein einfaches Verfahren zur Erzeugung monovalenten und modulare QD wurde beschrieben. Diese mQDs finden in breite Palette von Live Cell Imaging-Anwendungen, wie durch Abbildung der Notch-Rezeptor auf Live-U2OS-Zellen demonstriert. Anwendbarkeit mQDs nicht auf diesen speziellen Fall beschränkt, sondern kann möglicherweise für andere zelluläre Ziele, wie andere Proteine, Nukleinsäuren und Enzymen verlängert werden.

Acknowledgements

Finanzierung durch DOD W81XWH-1023.10.01 (ZJG), Grant P50 GM081879 von der UCSF Zentrum für Systemtechnik und Synthetische Biologie (ZJG), NIH 5R21EB015088-02 (YJ) und NIH 1R21EB018044 (ZJG & YJ) vorgesehen ist. DS wurde von Human Frontier Science Program Greifendes Postdoc Forschungsstipendium unterstützt.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats