Üretim ve Monovalent Kuantum Noktalarının Hedefleme

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

Canlı hücreler üzerinde tek moleküllerin dinamikleri biyolojik işlevine katkıda bulunur. Tek molekül floresan görüntüleme hücre yüzey 1,2,3 üzerinde tek bir molekül dinamiklerini incelemek için popüler bir yöntemdir. Bununla birlikte, bu çalışmalarda en yaygın olarak kullanılan görüntüleme sondaları, birçok önemli dezavantajları vardır. Örneğin, geleneksel organik boyalar ve floresan proteinleri 1 ila yaklaşık 10 5 -10 6 M, cm -1 orta parlaklık sağlar, ancak fotokimyasal olarak dengesiz olan, tipik bir canlı hücre görüntüleme koşulları altında yaklaşık 10 5 -10 6 foton emisyonu sonra ağartıcı 4,5. Buna karşın, yarı iletken nanopartiküller, sık aranan kuantum nokta (QDS), 6 10 -10 7 M-1 cm-1 aralığında ve photobl önce 10 7 -10 8 fotonların aşılmasına imha katsayıları olan, çok daha parlak ve daha kararlıdır5 eaching. Organik Flüoroforlann üzerinde QDS geliştirilmiş parlaklık ve fotostabilite önemli ölçüde daha hızlı kare hızında tek moleküllerin gözlem ve çok daha uzun 6 yörüngeleri sağlar.

Kendi avantajları ve ticari varlığına rağmen, çeşitli yükümlülükler bu güçlü görüntüleme ajanları için kalır. Birincisi, onlar kötü hedeflenen biyomoleküllerin 6 çapraz bağlantı neden olabilir hedefleme değerliği, tanımlanmış. İkincisi, genellikle belirli kalabalık hücresel ortamlarda 7 erişilebilirlik sınırlayan büyük bir hidrodinamik boyut (> 20 nm) sahip. Üçüncüsü, modülerlik 7 hedefleme sınırlıdır. Çeşitli stratejiler bu sorunların 8,9,10 değinmeye çalıştık, ama genellikle uygulamak uzmanlaşmış bilgi ve reaktifler ihtiyaç var.

Bu sorunları çözmek için, son zamanlarda tek değerli, küçük hazırlanması için bir "Siterik Dışlama" stratejisi rapor veModüler QDS 11. QDS tek bir uzun fosforotioat DNA'sı (ptDNA) polimeri ile birlikte sarılır. PtDNA yüzeye maruz kalan çinko atomu ve ptDNA polimerin fosforotioat grup arasında çoklu, Zn-S etkileşimler yoluyla QD yüzeyine bağlanır. Tek bir polimer bağlı sterik ve elektrostatik olarak önemli ölçüde partikülün toplam boyutu (yaklaşık 2 nm) arttırmadan, polimerin ilave eşdeğerlerinin bağlayıcı içermez. Tüm reaktifler ürünler yüksek verimle oluşturulmuştur, ticari olarak temin edilebilir, ve bu işlem saflaştırılması için sadece tuz giderme adımları gerektirir. Bir kez, hedef etki (örneğin, benzilguanin (BG), benzylcytosine veya alkilhalidlerin) taşıyan tamamlayıcı DNA ipliklerini tek bir ptDNA (MQDS) bind ile sarılmış QDS etiketlenmiş.

Bu işlevler genetik ilgilenilen protein ile birleştirildiği bir hamlede, CLIP, ve halo gibi enzimatik etiketler özel olarak hedef MQDS. Bu sentez için kullanılan bir protokoldür, Hedefleme ve sterik dışlama tarafından üretilen MQDS canlı hücre görüntüleme.

Protocol

Monovalent Kuantum Noktalarının 1. Üretimi

  1. Sulu faza, organik ikinci QDS faz aktarım
    1. 5 ml'lik bir cam şişe içinde 400 | il kloroform ile organik faz QDS bir 1 uM çözeltisi 200 ul seyreltin.
    2. Saf mPEG tiol (CH3 O (CH2 CH2 O) 6 C2Hs 5 SH) 36 ul 0.3 M tetrabutilamonyum bromid (TBAB) kloroform çözeltisi 400 ul karıştırın ve / N O sallayın.
    3. 0.2 M bir sulu NaOH çözeltisi 800 ul ilave edilir ve 30 saniye boyunca çalkalanır. , Bir faz transfer yoğun organik faz yukarıda sulu faza renkli parçacıkların transferi ile gösterilen bir kaç dakika içinde meydana gelir.
    4. Parçacıklar, sulu ve organik faz arasında Üçüncü aşamada agrega durumunda, mPEG tiyol ile inkübasyon süresi artar. Sulu faz berrak kalırsa, QDS faz transfer (Şekil 3A) yoktu. Seçenek olarak ise, yoğunlaşan artırmakAdım 2 mPEG tiol oranı kötü faz transfer hafifletmek için.
    5. (Renkli) bir sulu faz yeniden elde etmek ve sonra 1 ml'ye Centricon döndürme kolonuna (30 kDa molekül ağırlıklı bir kesim) ile toplanan QDS konsantre edilir.
    6. Bir Sephadex kolonu NAP10 30 mM NaCI (pH 8.0) ihtiva eden 10 mM Tris tamponu ile önceden dengelenmiş içine konsantre edildi QD solüsyonu ekleyin. Yerçekimi akışı ile elüsyon tamponu, 1.5 ml ile elüte QDS.
    7. 350 nm'de absorpsiyon spektroskopisi QDS konsantrasyonu ölçümü.
  2. MQDS hazırlanması
    1. Satınalma (veya sentez) ptDNA. Bu protokol dizisini kullanan, 5'-A 50 S (CT) 10 (ACTG) 5 -3 '(Tablo 1 e bakınız).
DNA Sırası
5'-A S 50 (BT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH2 - (CT) 10 (CAGT) 5 -3 ' NH2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA, BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tablo 1. DNA dizileri üreten ve hedef MQDS için kullanılır.

  1. 30 mM NaCI (pH 8) ihtiva eden 10 mM Tris diretkeni içinde, 100 nM QD çözeltisi 1 ml hazırlayın.
  2. Kuvvetlice karıştırarak 1 dakika boyunca sulu QDS için 100 nM ptDNA çözeltisi damla damla 500 ul ilave edin. Karıştırın veya ek 9 saat süre ile bir çalkalama yerleştirin.
    Not: ptDNA 2 oranını: QD Bu teorik bir 1 üretmek gerekir. Ancak, gerçek stokiyometri hiç mükemmel - genellikle sonuç 1 daha yakın olan: 1.5. 1 ptDNA oranı: 1 üretmek için QD, jel elektroforezi sonrası yoğunluk ölçümü yukarıda kullanılan bilinen miktarlar verilen konjügasyon tesisinin oranını ölçmek için gereklidir.
  3. Analitik bir agaroz jel üzerinde yürütülmüştür QD karışımın ~ 10 ul çıkarın. Ayrıca (adım 1.2.1) sulu faz indirekt QDS benzer bir konsantrasyon kaldırın.
    1. ~ 2 μ ekleme, 6x, Ficoll yükleme tamponu (solüsyon yoğunluğunu arttırmak için) ve yakın geçiş konjüge edilmemiş kontrol şeritte 150 V de 15 dakika boyunca, sodyum borat tampon maddesi içinde bir% 0.8 ağ / v agaroz jeli üzerinde tek bir bant birlikte bu iki örnekleri çalıştırmak iyi ve konjuge QDS ile şeritte iki bantları (Şekil 2B'de jeller bakınız) görülür.
  4. İki bandın nispi yoğunluğu kullanılarak birleşmemiş QD oranını hesaplamak (Şekil 2B denklem bakınız). Sonra QDS sayısını eşleşmesi için gerekli 100 nM ptDNA çözeltisi ilave hacmini hesaplamak için o kısmını kullanabilirsiniz.
  5. Tekrar, bu hesaplanan hacim ile veya tüm QDS tam konjugasyon gösteren jeli üzerinde tek bir bant halinde birleşmiş QDS çöküşüne kadar bir kez daha 1.2.5 1.2.3 adımları tekrarlayın.
  6. 10 mM Tris tamponu içinde 10 mM co (CO 2H) CH2 O (CH2 CH2 O) 6 C 11 23, H SH (karboksi PEG6 alkan tiyol), 100 ulYukarıda elde edilen konjüge MQDS 30 mM NaCI (pH 8) ntaining ve 10 dakika boyunca çalkalayın.
    Not: Bu, PEG ligandlar QD yüzeyini pasifleştirme. Daha uzun PEG Ancak, aynı zamanda onların boyutu artacak, QDS daha iyi pasifize edecektir. Hidrofobik alkan tiyol işlevselliği faz transferi için daha az hidrofobik, PEG-tiol el göre, toplam olarak QDS için çok yüksek bir afiniteye sahiptir. Bu nedenle, bu adım çok uzun süre devam etmesi için izin yoktur ya da ptDNA alkan-PEG-tiol ile değiştirilecektir. ~ 30 dakika inkübasyondan sonra, DNA önemli bir kısmının QDS (Şekil 3B) ayrılmak zorunda olacaktır.
  7. , Fazla alkan PEG-tiol kaldırmak bir Sephadex kolonu NAP5 QD çözeltiden 0.5 ml eklemek için işlem tampon maddesi ile önceden dengelenmiş (30 mM NaCI ihtiva eden 10 mM Tris tamponu). Yerçekimi akışı ile elüsyon tamponunun 1.0 ml MQDS toplayın.
  8. Centricon döndürme kolonuna (30 kDa) ile toplanan QDS konsantre edilir. Ay boyunca 4 ° C 'de bu MQDS saklayın. Fr etmeyinOnları eeze.
    Not: tüpün alt renkli bir topak görüldüğü takdirde nokta haline getirilir ve artık kullanılamaz olan muhtemeldir.

Hedefleme (Benzylguanine-) DNA 2. Üretim

  1. Üretin veya amin sonlandırılmış DNA satın. Bu protokol sırasını kullanır 5'-NH2 - (CT) 10 - (CAGT) 5 -3 '(Tablo 1 e bakınız). Poli-CT bağlayıcı glikokaliksin derinliklerine gömülü işlevsellik ulaşılabilirliği artırır ancak tüm uygulamalar için gerekli olmayabilir. Bir DNA sentezleyicisi erişimi vardır, uygun bir 5 '-amino-değiştirici (5'-amino-modifikatörü C6) kullanılarak amino-modifiye DNA üretir.
  2. 10 mg / ml 'lik bir konsantrasyonda kuru dimetil sülfoksit (DMSO) içinde BG-, N-hidroksisüksinimid (NHS-BG) içinde çözülür.
    Not: BG-NHS, özellikle DMSO ve dimetilformamit (DMF) gibi çözücü maddeler içinde, hidroskopik, reaktıf NHS-ester hidrolizine havadan su emme ve yol açacaktır. BG-NHS en iyi mağazaikinci bir kap içeren kurutucu içinde kendi şişe içinde bir toz halinde -80 ° C d. Şişeyi açmadan önce oda sıcaklığına kadar sıcak. Alternatif olarak, tek kişilik kullanım için hemen kuru bir polar bir çözücü içinde, BG-NHS ester kısım ve -80 ° C'de dondurma, ya da kademe 2,2 amin DNA ile tam olarak reaksiyona girmektedir.
  3. HEPES, amin ile sona eren DNA (4-(2-hidroksietil) -1-piperazinetansülfonik asit) tamponlu (pH 8,5), su ile adım 2.1, DMSO içinde, BG-NHS karıştırılması ile tepkimeye sokulur. (BT) - 10 - (CAGT) 20 ul 0.5 M HEPES pH 8.5 ile tamponlanmış 5 58 ul deiyonize su, tipik olarak 2 mM NH2, 2 ul DMSO içerisinde 10 mg 20 ul reaksiyona / ml BG-NHS. 1.5 ml mikrosantrifüj tüp içinde reaksiyonlar yürütmek. Reaksiyon hızlı bir şekilde ilerler hızlı bir şekilde karıştırın ve NHS-ester hidrolizi ile rekabet etmek zorundadır.
  4. Iyice karışmasını sağlamak için 5-10 dakika boyunca ultrasonik titremeye maruz bırakılır. Oda sıcaklığında ~ 1 saat inkübe edin. BG stoikiometrik oranı: DNA, reaksiyonu tamamlanmaya götürmek için değiştirilebilir.
  5. % 8 ve 30 dakika boyunca% 95 asetonitril arasında asetonitril (ACN) gradyan: 100 mM TEAA çalışan ters fazlı HPLC ile, reaksiyona girmemiş amin DNA'dan BG-DNA arındırın. Girmemiş amin-DNA BG-DNA önce Zehir. Konik bir tüp içinde, BG-DNA fraksiyonu toplamak.
    1. Standart oligonükleotid saflaştırma için bir C 18 Zorbax® sütun ve aşağıdaki degrade kullanın:
      0 → 15 dk: 8% 30 ACN →;
      15 → 21 dk:% 30-90 ACN;
      21 → 25 dk: 90 →% 8 ACN;
      25 → 30 dk:% 8 ACN;
  6. Sıvı azot içinde dondurulması ve toplanan fraksiyonu liyofilize edin. Iyonu giderilmiş suda yeniden süspanse DNA. Artık TEAA çıkarmak için iki kez daha lyophilize, ekstra dikkatli olun. Kalıntı TEAA yüksek konsantrasyonlarda hücreler için toksik olabilir.
  7. Th yanlarının yıkanması için emin olun, su içinde liyofilize BG-DNA yeniden süspansee tüp, ve ~ 25 mcM stok sulandırmak. 4 ° C'de kısım saklayın. Numuneler fark bozulma olmadan ~ 9 ay boyunca depolanmıştır.

Monovalent Kuantum Noktalarının 3. Etiketleme Canlı Hücreler

  1. İsteğe bağlı olarak, kasein (% 0.5) ya da sığır serum albumini (BSA,% 1-3) gibi reaktifler kullanılarak bir görüntüleme deneyden hemen önce MQDS pasifleştiren.
  2. Toplam iç yansıma floresan (TIRF) -quality camına SNAP-etiketli proteini ifade plaka hücreleri. Bu deneyde, SNAP-etiketli Notch1 reseptörü ve yüksek kaliteli cam yüzeyleri ifade eden bir hücre hattı U2OS kullanın.
  3. Hücreler cam (~ 24 saat) bağlı sonra, PBS ile yıkayın, büyüme ortamı alın ve ~ içinde oda sıcaklığında 10-30 dakika boyunca 100-150 ul PBS ya da ~ 1 uM ihtiva eden hücre ortamı hücrelerin inkübe BG- yukarıdaki aşama 2.6 DNA.
  4. BG ile inkübasyondan sonra, dikkatli bir şekilde, PBS veya ortam ile hücre hücreleri yıkayın. Th ~ 5-10 dakika için kuluçkalayınAdım 1.2.9 üretilen E MQDS (ve isteğe bağlı olarak aşama 3.1 pasive).
  5. İsteğe bağlı olarak, ilişkisiz MQDS yıkama ve görüntüleme hem de kültüre uygun bir tampon / medya hücreleri dönün. Çözelti içinde bağlanmamış MQDS analiz esnasında tespit edilemez düzeyde olduğu gibi bağlı MQDS ile karşılaştırıldığında çok hızlı bir şekilde dağılmış olarak TIRF modunda, görüntülenecek olan hücrelerin, bir son yıkama aşaması genellikle gereksizdi.

4. Mikroskopi ve Analiz

  1. Görüntü bir TIRF mikroskobu kullanılarak hücreler.
    Not: kapsam ayrılabilir uyarma ve emisyon filtreleri, ya da özel bir QD filtre küpü olmalıdır. QDS düşük dalga boylu lazer (405 veya 488 nm) ile en iyi heyecanlıyız. Farklı çapta QDS genellikle büyük bir Stokes kayması ile ilişkili karakteristik emilim dalga boyuna sahiptir.
  2. Canlı hücrenin bazal tarafını görüntüleme çünkü süre MQDS bir parlaklık, TIRF yüksek kare hızları görüntüleri toplamak.
    Not: Alternatif olarak, tek-molekül dinamiği Follo olabilirdönen bir disk konfokal mikroskop kullanılarak diğer odak düzlemleri evlenmek. Otomatik tek-parçacık izleme yazılımı doğru parlak ve ışığa MQDS izleme genellikle başarılı olur.

Representative Results

Bir sulu faza, organik bir ikinci QDS faz transfer MQDS üretimi için önemlidir, fakat koşullandırma ve QD özgü de olabilir. 1.1 bölümünde faz transfer Şekil 3'te ilk iki flakon gibi temiz görünmelidir. Transferi daha flakon 3 gibi görünüyorsa, o zaman biri farklı koşullar ile tekrar denemelisiniz.

QDS negatif yüklü DNA ile kaplanır sonra, her sarılmış-olmayan QDS ayrı bir jeli üzerinde geçiş gerekir. Şekil 2B'de birinci jel görüldüğü gibi, bir kontrol, bir saniye olarak Çizelgesi QDS bir kısım kullanılarak, daha hızlı göç eden bant, ptDNA ilavesinden sonra görünmelidir. MQDS tam oluşumu hareketsiz bandın kaybı, ve Şekil 2B, son jel görüldüğü gibi mobil bant içine çökmesi ile gösterilmiştir. Kullanıcı MQD'nin ürünün eşit bir tek bant halinde Çizelgesi QDS ayrılabilir göç ederse, o zaman tek değerli MQDS ve r eady fazla aşamada kullanılır.

Hücre etiketleme istediğiniz hedefe özgü olmalıdır ve protein ekspresyon seviyeleri ile MQD konsantrasyonuna bağlı olmalıdır. MQD konsantrasyonu ile MQD pasivasyon hem deneysel optimizasyonu genellikle herhangi bir belirli bir uygulama için gereklidir. Şekil 4B, 0.5 nM ila 10 nM arasında değişen konsantrasyonda MQDS olan SNAP-etiketli Çentik reseptörünü ifade U2OS hücrelerin işaretlenmesini göstermektedir.

Şekil 1
Şekil 1. Modüler MQDS hedeflenmesi. MQDS çeşitli hedef moleküllerin işlevselleştirilmiş ssDNA'ya hibridize olur. Füzyon proteinleri-etiketli SNAP DNA hedefleri MQDS benzilguanin bağlantılı. Diğer 5 'modifikasyonları ve DNA sekansları diğer biyomoleküllerin çeşitli MQDS hedeflenmesini sağlar./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> Bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 2
MQDS üretimi için 2. Düzen Şekil. (A) organik faz QDS ptDNA ile sarılmış, mPEG tiol ve TBAB ile muamele ile sulu faza aktarılır ve karboksi PEG6 alkan tiyol ile pasifleştirilmiş edilir. Örnek TEM görüntüleri, sırasıyla, organik QD545, QD585 ve QD605 bulunmaktadır. (B) Yukarıdaki ampirik olarak ikinci adımda QDS ve ptDNA arasındaki etkileşimin stokiyometri belirlemek için bir yöntem. 1 (QD: ptDNA) QD ve ptDNA stoichiometries ampirik nihai reaksiyon stoikiometri 1 olacak şekilde densitometri tarafından doğrulanmadı. PtDNA mol sayısı başlangıç ​​olarak QD oranı ile çarpılır: MQD ve gerçek ses AF ile ayarlandı ter konjugasyon 1 elde etmek için gerekli mol sayısını vermek üzere:. 1 konjugasyonunu bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3. MQDS üretimi için deneysel ayrıntıları. (A) Başarılı Temsilcisi fotoğraflar ve faz transferi başarısız oldu. QDS görsel olarak yoğun ve organik faz, daha az yoğun bir sulu faz arasında aktarmak gerekir. Eksik faz ayrılması kötü transferi gösterir. (B) ptDNA alkan-PEG-tiyol ile ikame edilmiş olabilir. Sağ jel veri ptDNA önemli bir kısmı nedeniyle aşırı pasiflefltirilmesi QDS deplase olmuş bir reaksiyon temsilcisidir.es.jpg "target =" _blank "> Bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 4
Şekil 4. Etiketleme canlı hücreler üzerinde proteinleri SNAP-etiketli. (A) şematik bir BG-hedefli arabirimine SNAP-etiketli reseptörünün ifadesi, eki ve etiketleme gösteren. (B), SNAP-Çentik MCherry çeşitli konsantrasyonlarda MQD yapısını ifade eden hücrelerin etiketlenmesi Örnek. PEG12 ile pasifize MQDS MCherry özel etiketleme belirtilerek colocalize. Alt etiketleme yoğunlukları (<0.5 nM) tek parçacık takibi için genellikle tercih edilir. Ölçek çubuğu 10 mikron. , bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Discussion

MQD'nin tasarım modülerlik deneysel esneklik artan bir derecede sağlar. Örneğin, MQDS çeşitli hızla birden fazla hedefin aynı anda görüntülenmesi için izin benzersiz renk hazırlanabilir. SsDNA hedef sekansı, proteinlere şeker 12, lipidler MQDS yönlendirmek ve 13 yüzeyleri edebilirsiniz. Enzimatik etiketleri bir dizi çoklu hedefleri farklı olarak hedeflenen MQDS ile aynı anda görüntülü sağlayan, dik reaktivitelerinin mevcuttur. SNAP etiketiyle hedefleme ek olarak, CLIP etiketi HALO etiketi kullanılarak MQDS ve biyotinile edilmiş proteinleri ile hedef proteinlerin etiketleme de başarılı olmuştur. Bu protokol, bu MQDS canlı hücreler üzerinde bir yüzey reseptörünün özel işaretlemeyi açık olarak gösteren, ancak protokol kolay bir şekilde farklı bağlamlarda bir dizi uyarlanabilir.

Tanımlı değerliği ile MQDS üretiminde önemli metodolojik fikir olduğunu ~ 50 fosforotıyoat bağlantılıbazlar QDS sarın (ve dolayısıyla aynı zamanda bağlanma için iki moleküllerinin önlenmesi) için gereklidir. Bir poli-A S 50 dizisi yeniden üretilebilir ve kararlı biçimde Life Technologies'den 605 nm QDS bağlandı. Bu ürün üretilmiyor olmasına rağmen, sterik dışlama stratejisinin farklı boyutlarda, şekiller, spektral özelliklere sahip diğer satıcılardan benzer ürünlere genellenebilir.

PtDNA sarılmış QDS etkinliği ve stabilitesi QDS yüzey kimyası ve yapısının kritik bağlıdır. Bu nedenle, bir protokol başarısı QDS ticari bir kaynağı, kimyasal yapıya bağlı olacaktır. Bu protokolün amaçları için, farkı üç ana puan QDS çeşitli ticari kaynaklardan arasındaki mevcut: faz transferi için gerekli koşulların bir fark; ptDNA tarafından ön PEG-tiol-ligandı bağlanma muhtemelen engelleyen değiştirme mukavemetinde bir farktır; ve maruz CdSe çekirdeğin miktarda bir fark, bu yararlı bir LemPEG tiol, faz aktarım koşulları ile QD soğutulması için reklam.

Yayın tarihi itibariyle MQDS üretimi için en iyi yapı ile QDS 545, 585, 605 ve 625 nm (Şekil 2A) emisyon spektrumu ile Life Technologies'den satın alınan 4-10 nm CdSe / ZnS çekirdek / kabuk QDS bulunmaktadır. 'Canlı' formülasyon (545, 605, vb) bağlı olarak QDS mPEG tiol eklenmesi ile söndürülmüş ve bu uygulama için uygun değildir. Aldrich ve Okyanus Nanotech.'in gelen QDS iyi çalışır, ancak daha uzun faz transfer adımları ve trioctylphosphine oksit ile ön hazırlık gerektirmez. Bu protokol, Life Technologies'den QDS için optimize edilmiştir.

QDS sarmak için kullanılan Poli-A fosforotioat sekansı, hedef iplik hibridize kalabileceği (ACTG) 5 dizisini içeren bir doğal 20-mer, DNA kuyruk ile sonlandırılır. Bu dizi sekonder yapısına az olduğu gibi, uygundur ve hybridiz kalacakPBS içinde 37 ° C'de ed. Bir DNA sentezleyicisi ile erişim mümkün değilse, bir Cı-8 ptDNA kolonu kullanılarak sentezlenebilir ve daha sonra ters fazlı yüksek performanslı sıvı kromatografisi (HPLC) ile saflaştırılmıştır olabilir. PtDNA yerli omurga ile eşdeğer oligonükleotitlerden daha HPLC daha sonra Zehir. Bu tipik olarak saflaştırma sonrası fosforotioat oligonükleotitlerin koruma grubu ile DMT, '5 bırakın.

PtDNA sarılmış QDS pasifleştirme genellikle QDS peltelenmiş kararlılığını iyileştirmek ve deneysel uygulamalar için bağlayıcı arka planı azaltmak için gereklidir. Protokol QDS pasifleştirilmesi için bir PEG-katmanı kullanır. Karboksi PEG ilave PEG birimlerinin sahip alkan tiyol ((CO 2H) CH2 O (CH2 CH2 O) C 12 11, H 23, SH karboksi-PEG12 alkan tiyol) belirgin bir azalma sağlamaktadır arka uzun PEG hem de daha büyük olmasına rağmen, ve genellikle daha pahalı. karboksi PEG alka kaplanmış MQDSNE tiol ligandlar örneğin fosfat tamponlu salines ve kültür ortamı olarak fizyolojik tamponların son derece stabildir. 4 ° C'de MQDS uzun süreli saklama (> 8 ay) belirgin ve toplanmasını ptDNA dekolmanı 11 göstermiştir. Deney bağlı olarak, QDS PEG pasivasyon, tek başına her zaman yeterli miktarda spesifik-olmayan bağlanmasını MQDS azaltmaz. Bu ~% 50 MQDS belirgin hidrodinamik yarıçapını artırmak yok ama esas olarak kullanımdan önce 20 dakika süreyle% 3 BSA ihtiva eden fosfat tamponlu tuzlu su (PBS) içinde hücreleri ve hem de kuluçkaya MQDS hücrelere spesifik olmayan bağlanma azaltır. % 0.5 kasein ile pasifleştirilmesi spesifik olmayan bağlanma daha da azaltır ama BSA göre daha büyük bir ölçüde belirgin boyutunu artırır.

MQDS tamamlayıcı bir DNA kolunun 5 'ucu, farklı biyomoleküllerin bir dizi hedef sağlamak için modifiye edilebilir. Kovalent proteinlerin modifiye edilmesi için bilinen teknikler kullanılabilir bir dizi L. varipids ve tek kordonlu DNA (ssDNA) ile şeker. SsDNA ekstraselüler sunulmuştur sürece, o çözünebilir MQDS erişilebilir. yukarıdaki dizilerin ile MQDS hızlı hücre kültürü koşulları altında tamamlayıcı DNA bağından ile hibridize olur. Hücrenin kalın ve negatif yüklü glikokaliksin yukarıdaki bağlama sekansı yükseltecek şekilde ptDNA ve hedefleme dizisi arasında bir 10-20x poli (BT) boşluk hedefleme etkin için gerekli olabilir. Bu protokol için biz de MQDS hibridize kovalent hızlı ve spesifik etiketleme için SNAP-işareti proteiniyle kendini bağlamayı (CAGT) içindeki bir 5 tamamlayıcı dizisi ile bir BG-DNA üretilmesi için seçtik. De amin ile modifiye edilmiş oligonükleotitler, NHS-esterlerin bağlanması için benzer bir protokol işlevleri.

Tek molekül görüntüleme için, etiketleme, düşük bir yoğunluğu, genellikle tek tek oluşturucu moleküllerin çözmek için gereklidir. Pasifleştirme maddesi ile PBS içinde ± 0.5 nM'lik bir son konsantrasyon MQDiyi bir hedeftir. Bununla birlikte, bu yüksek dilüsyonlar bazen altında etiketleme hücreleri ile sonuçlanmıştır. Böyle bir durumda etiketleme optimum yoğunluk gözlenene kadar, ek MQD eklenebilir. 0.5 nM MQD'nin hedef hücrenin basal yüzeyinde 20 MQDS (Şekil 4B 'ye bakınız) ~ ekinde sonuçlanırken, SNAP-etiketli insan Notch1 durumunda,> 10 nM MQD'nin konsantrasyonları yoğun etiketleme hücresinde üretilir. MQDS ile hücre etiketleme kaplı hücreler konfluansa yüksek ölçüde bağlı idi. Aşırı birleşen hücreler bazal yüzeylerinde etiket yok.

Özetle, tek değerli basit bir yöntem elde etmek ve modüler QDS tanımlanmıştır. Canlı U2OS hücreleri üzerindeki Çentik alıcısı görüntüleme ile gösterildiği gibi bu MQDS, canlı hücre görüntüleme uygulamaları geniş kullanım alanı bulur. MQDS Uygulanabilirliği Bu özel durumda ile sınırlı değildir, ancak potansiyel olarak bu tür diğer proteinler, nükleik asitler ve enzimler gibi diğer hücresel hedefler için uzatılabilir.

Acknowledgements

DOD W81XWH-1023/10/01 (ZJG), Sistemler için ucsf Merkezi ve Sentetik Biyoloji (ZJG) hibe P50 GM081879, NIH 5R21EB015088-02 (YJ) ve NIH 1R21EB018044 (ZJG & YJ) tarafından sağlanan finansmanın transferi. DS İnsan Frontier Bilim Programı Çapraz disiplin doktora sonrası araştırma bursu ile desteklenmiştir.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats