متساوي التضخيم (LAMP) فحوصات بوساطة حلقة للكشف عن أنواع محددة من

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

إنتاج الدجاج العالمي زاد عشرة أضعاف على مدى السنوات ال 50 الماضية مع العالم النامي تستضيف ما يقرب من أربعة أضعاف التوسع الذي شهدته بلدان العالم المتقدم (www.faostat.org) . كما نمت أهمية إنتاج الدجاج للأمن الغذائي العالمي كذلك فعلت الملف الشخصى مسببات الأمراض التي يمكن أن تسبب مرض خطير في الدجاج. واحد مثال هي الأنواع الأيمرية، الطفيليات في كل مكان والتي يمكن أن تسبب المرض المعوي الكوكسيديا 1. أينما وتربى الدجاج من المرجح أن تكون مشتركة 2-4 واحد أو أكثر من الأنواع الأيمرية. في العالم المتقدم يتم التحكم الأيمرية المقام الأول عن طريق الوقاية الكيميائية، وتوظيف برامج المكوك أو دوران للحد من تأثير المقاومة 5. وتستخدم اللقاحات الحية أيضا في أنظمة حيث القيمة الطيور كافية لتبرير التكلفة (على سبيل المثال، تربية الماشية، والطبقات وبعض الفراريج 5). ونتيجة لدورة الفتشوبLT هذه التدابير غالبا ما تسيطر الكوكسيديا السريري بشكل جيد، على الرغم من العدوى دون السريرية هو شائع 5. في التطعيم العالم النامي أمر نادر وتطبيق المخدرات في كثير من الأحيان أبلغ أقل أيضا. ونتيجة لذلك الكوكسيديا الفرعي السريرية والسريرية هو أكثر شيوعا ويمارس تأثير اقتصادي كبير 3.

وقد اعتمد تشخيص العدوى eimerian تقليديا على الآفة وسجل بعد الوفاة، على الرغم من أن الكتاب من سجل النظام الأكثر استخداما على نطاق واسع وعلق أنه بالنسبة لبعض الأنواع "يبدو المشكوك فيه ما إذا كان ينبغي حاول هذا الإجراء في أي ولكن باعتدال شديدة العدوى" (6). ويمكن جمع أدلة التكميلي من خلال الكشف المجهري للمقاومة للبيئة مرحلة البيوض المتكيسة دورة الحياة في عينات البراز أو القمامة، على الرغم من تداخل التشكل يمكن أن نخلط جميع ولكن الخبير 6،7. بدائل الجزيئية باستخدام تفاعل البلمرة المتسلسل (PCR)، amplificatio عشوائيوقد ن من متعدد الأشكال DNA PCR (RAPD-PCR) والتكنولوجيات PCR الكمي متاح لمدة تصل إلى 20 سنوات 8-10، ولكن حتى الآن فشلوا لتصبح شعبية. حساب النسبي ومتطلبات معدات المختبرات المتخصصة أو معالجة حدت امتصاص، وعلى الرغم من الطبيعة في كثير من الأحيان غير موضوعية وتطلبا من الناحية الفنية من pathology- كبار السن والنهج القائم على الفحص المجهري 10،11. وهذه القيود يمكن أن يكون مبالغا فيه في كثير من المناطق الأكثر فقرا من العالم مثل جنوب شرق آسيا، حيث قد يكون تأثير الكوكسيديا على الفقر أكبر نسبيا 12. وردا على ذلك هناك طلب واضح عن الجديد واضحة وحساسة، ولكن فعالة من حيث التكلفة، فحوصات تشخيصية الأيمرية أنواع محددة.

متحاور التضخيم (LAMP) بوساطة حلقة هو وسيلة سهلة لإعداد DNA تقنية يحركها البلمرة التي هي قادرة على تضخيم كميات كبيرة من الحمض النووي. الأهم من ذلك، يستخدم LAMP على polymera بتوقيت جرينتش DNAحد ذاته بدلا من البلمرة DNA طق التي يشيع استخدامها في PCR، مما يسهل تضخيم DNA عند درجة حرارة ثابتة واحدة دون الحاجة لركوب الدراجات الحرارية 13،14. LAMP يمكن أن تكون قابلة للتطبيق حتى في المختبر الأكثر بدائية أو في الميدان. ومن خلال تميزها المقاومة النسبية للعديد من مثبطات PCR، وحساسية عالية وخصوصية، تم وضع المقايسات LAMP لمجموعة واسعة من مسببات الأمراض بما في ذلك فيروس داء الغومبورو، المطثية الحاطمة والكريبتوسبوريديوم 15-17. وردا على الطلب على التشخيص الأيمرية فعالة من حيث التكلفة أنواع محددة جديدة وقد وضعت لجنة من المقايسات LAMP محددة لكل من سبعة أنواع الأيمرية التي تصيب الدجاج 18. وتشمل التطبيقات لفحوصات جديدة للرصد الطفيل واقعة ذات قيمة خاصة نظرا لارتباط الأنواع مثل الأيمرية ماكسيما أو الأيمرية الفاتكة مع المؤسسة العامة الاقتصادي الضعيفrformance 3،4. وتشمل التطبيقات الأخرى تقييم فعالية الاستراتيجية المزرعة anticoccidial، تشخيص العدوى دون السريري أو المرض السريري وتقييم المخاطر التي يشكلها الأيمرية إلى مزرعة.

Protocol

1. قالب التحضير

ملاحظة: أي قالب الحمض النووي الجيني يشتبه في احتوائها على DNA المستمدة من واحدة من سبعة أنواع الأيمرية التي تصيب الدجاج ويمكن استخدام قالب لتحديد الأنواع الأيمرية القائم على LAMP. عينات الأنسجة المعوية لتحليل تشخيصي المجال ينبغي جمع خلال روتينية بعد الوفاة كما هو موضح هنا.

  1. اختيار القسم (أو الأقسام) من الأمعاء لفحصها. انظر الجدول رقم 1 لدليل لاختيار الموقع العينة والأنواع الأيمرية الأكثر احتمالا أن يكون حاضرا 18 والشكل 1 لمجموعة أنواع محددة من التوزيع وموقع من مواقع أخذ العينات.
    ملاحظة: هذا هو ذات أهمية رئيسية منذ الأيمرية هي أبرزها الموقع المضيف معين. كل الأنواع التي تصيب الدجاج تم تعريفه من قبل المنطقة المعوية أنه يستهدف 19. قد تكون أثرت على قرار من خبرة سابقة في المزرعة، والفائدة في واحد أو موإعادة الأنواع الأيمرية محددة أو المؤشرات التشخيصية الأخرى 6.
  2. المكوس 5 سم أو أطوال أطول من قسم الأمعاء (ق) المختارة لاختبار الأيمرية باستخدام مقص العقيمة أو مشرط. اختياريا، وتخزين العينات لتحليلها لاحقا في تثبيتي مثل على سبيل المثال في RNAlater 18 أو 95٪ من الإيثانول.
    ملاحظة: إذا تخزينها في الإيثانول العينة يجب غسلها جيدا في العقيمة تريس ethylenediaminetetraacetic حمض (TE) العازلة قبل الاستخدام.
  3. قطع العينة مفتوحة طوليا، وإزالة محتويات الأكثر المعوية (إذا كان موجودا) وكشط الخلايا من الطبقة المخاطية مجانا باستخدام إما حافة معقمة شريحة ميكروسكوب زجاجية أو شفرة مقص الإيثانول / اللهب تعقيمها. اختياريا لعينة المجمعة تشمل الخلايا من كل أربعة من المواقع الأنواع محددة في الامعاء في أنبوب واحد.
  4. وضع مواد كشط في العقيمة 1.5 مل المسمار أعلى أنبوب microcentrifuge تحتوي على 100 ميكرولتر العقيمة العازلة TE بما في ذلك 10٪ (ث / ت) Chelex 100 الراتنج.
  5. يهز كل عينة بقوة لمدة 1 دقيقة. تأكد من أن رأس المسمار مغلق بإحكام ثم احتضان في حمام الماء المغلي لمدة 10 دقيقة.
  6. بعد الغليان تسمح لكل عينة لتبرد في درجة حرارة الغرفة لمدة 1-2 دقيقة.
  7. الطرد المركزي كل عينة باستخدام microcentrifuge في سرعة قصوى (على سبيل المثال، ~ 10،000 x ج) لمدة 1 دقيقة.
  8. جمع 2 ميكرولتر من طاف مما أدى إلى أن يكون القالب في كل فحص LAMP التي يتعين الاضطلاع بها. اختياريا، تجمع أكثر من موقع الأمعاء في أنبوب واحد لتوفير الفحص في مواقع متعددة.

2. الأيمرية LAMP التمهيدي إعداد (ما قبل الفحص)

  1. إعداد الأسهم التمهيدي الأيمرية LAMP كافية ل100 المقايسات:
    1. إعادة تشكيل كل lyophilised الأيمرية LAMP التمهيدي بإضافة الماء الصف الجزيئية إلى تركيز 100 ميكرومتر (كما هو محدد من قبل الشركة المصنعة). إذا لم يكن محددا، وحساب حجم الصف الجزيئية المياه اللازمة النقيبز الأوزان البدنية والجزيئية من كل التمهيدي.
    2. ماصة 60 ميكرولتر الصف الجزيئية المياه إلى 0.5 مل الوجه العلوي أنبوب microcentrifuge منفصلة لكل نوع الأيمرية أن يعاير.
    3. إضافة الاشعال FIP، BIP، F3، B3، LF وLB محددة إلى الهدف الأنواع الأيمرية إلى الماء باستخدام كميات هو مبين في الجدول رقم 2، وخلق سلسلة من يمزج التمهيدي سبعة أنواع محددة.
    4. لفترة وجيزة دوامة مزيج الحل التمهيدي، ثم نبض microfuge وتجميد حتى المطلوبة.
  2. إعداد mastermix رد فعل LAMP لكل الأنواع الأيمرية أن يعاير. مضاعفة كميات هو مبين في الجدول 3 من قبل عدد من العينات وإضافة ثلاثة إلى مراقبة إيجابية، والسيطرة السلبية وpipetting لالغيار. ماصة إلى 0.5 أو 1.5 مل الوجه العلوي أنبوب microcentrifuge.

3. الأيمرية LAMP الفحص

  1. ماصة 23 ميكرولتر الأيمرية أنواع محددة بتوقيت جرينتش DNA بوليميريز / LAMP mastermix إلى 0.5 مل أنبوب microcentrifuge.
  2. إضافة قالب DNA 2 ميكرولتر (المعد في القسم 1)، مما يجعل حجم رد الفعل النهائي من 25 ميكرولتر.
  3. إضافة الحمض النووي الجيني 2 ميكرولتر الأيمرية أنواع محددة لرد فعل واحد (مراقبة إيجابية). إضافة 2 ميكرولتر المياه الصف الجزيئية إلى رد فعل (المراقبة السلبية).
    ملاحظة: إذا كان الحمض النووي الجيني أنواع محددة لا يتوفر على LAMP إيجابي السابق أو منتج PCR القياسية يمكن أن تستخدم بدلا من ذلك.
  4. احتضان في حمام مائي أو كتلة الحرارة عند 62 درجة مئوية لمدة 30 دقيقة. اختياريا، دي-تفعيل البلمرة بتوقيت جرينتش DNA عن طريق التسخين إلى 80 درجة مئوية لمدة 10 دقيقة إذا كان رد الفعل لن تكون قراءة الفور.

4. LAMP الفحص للقراءة خارج

  1. وفي ختام حضانة تقييم اللون من كل رد فعل من جانب العين تحت ضوء داخلي. نتائج سلبية تظهر الوردي إلى البنفسجي في اللون، وتظهر نتائج إيجابية السماء الزرقاء 20.
  2. اختياريا، تأكيد نتيجة الفحص LAMP في laboratأوري عن طريق خلط 5 ميكرولتر ناتج التفاعل LAMP مع 1 ميكرولتر عازلة هلام DNA تحميل لالاغاروز الكهربائي هلام باستخدام 2٪ هلام الاغاروز في 1 × تريس / البورات / EDTA (TBE) العازلة، ملطخة مسبقا باستخدام صمة عار الحمض النووي (5 ميكرولتر في 50 مل الاغاروز). إضافة 5 ميكرولتر من 1KB الجزيئي سلم DNA حجم حارة 1 من هلام للسماح حساب حجم شظية.

Representative Results

التحقق من صحة الفحص

أثناء التحقق من الصحة تم اختبار كل الأيمرية أنواع محددة LAMP الفحص باستخدام لوحة عينات DNA نقية تمثل جميع سبعة أنواع الأيمرية التي تصيب الدجاج، وكذلك الحمض النووي الجيني الدجاج كعنصر تحكم المضيف. وقد استخدم الاغاروز الكهربائي للهلام لحل كل فحص وأظهرت خصوصية الأنواع المطلقة مع أي مضيف عبر التفاعل 18. وبعد ذلك، أعدت عشرة أضعاف مسلسل سلسلة التخفيف باستخدام النقى الرهيفة الأيمرية كشف الحمض النووي الجيني حدا حساسية الفحص من بين واحد وعشر نسخ الجينوم 18. تم تحديد أي حد العلوي مع النتائج الإيجابية التي تحققت وبما يصل إلى أعلى تركيز (100،000 نسخة الجينوم) 18.

التطبيق مع العينات الميدانية

العينات التي تم جمعها للاختبار الأيمرية من المرجح أن تكون مستمدة من الدجاج عثر عليه ميتا، أعدمت نتيجة لصOOR الصحية أو أعدمت للمراقبة الصحية الخافرة، مما يدل على أن من المرجح حجم العينة من بين واحد وثلاثة عندما جزءا من روتين. اختبار ثلاثة طيور التي تم جمعها من مزرعة الدجاج اللاحم الولايات المتحدة كجزء من برنامج المراقبة أسفرت عن ثلاث مجموعات من عينات الأمعاء. تستهدف تطبيق أنواع محددة المقايسات LAMP، إعطاء الأولوية لمواقع المعوية المفضلة لكل نوع الأيمرية (الجدول 1)، يسمح التعرف البصري للعدوى eimerian في جميع الطيور اختبارها باستخدام hydroxynaphthol الأزرق كمؤشر (الشكل 2A). لون يتحقق مع رد فعل سلبي LAMP عند استخدام hydroxynaphthol الأزرق يمكن أن تتراوح من البنفسجي إلى الوردي، ولكن هو دائما متميزة من اللون الأزرق من قبل نتيجة الإيجابية التي تحققت. تأكيد الاغاروز الكهربائي للهلام قدمت نتائج مماثلة (الشكل 2B). خلال التطبيق الميداني قد يختار المستخدم لتطبيق كامل الشاشة ضد جميع الأنواع السبعة، أو تستهدف فقط تلك الأنواع ذات الأولوية كماأهمية أو المعروف أن تعميم في المزرعة أو المنطقة المحيطة بها.

فشل النهج القائمة على PCR لأصبح راسخا باعتباره التشخيص لحدوث الأيمرية يشدد على الحاجة إلى البساطة في أي اختبار جديد. في حين LAMP يقدم إعداد بساطة ومعالجة من PCR، واشتراط اختبار المواقع المعوية متعددة لكل الطيور لا يزال غير مشجع. إنتاج عينة DNA المجمعة واحدة لكل الطيور، ومن ثم يمكن اختبار مع واحد أو أكثر من المقايسات LAMP، ومن المرجح أن يكون أكثر جاذبية. تجهيز العينات المجمعة واحد لكل الطيور، وتمثل المواد التي تم جمعها من كل موقع من المواقع المعوية محددة وصفها في الجدول 1 والمجمعة قبل إعداد DNA، للاختبار مع جميع المقايسات LAMP سبعة شريطة نفس النتيجة كما هو الحال عندما تم معالجتها كل موقع على حدة الأمعاء (الشكل 2 مقارنة مع الشكل 3).

الشكل (1) الشكل 1. مواقع أخذ العينات المعوية للكشف LAMP من الطفيليات التي تصيب الأنواع الأيمرية الدجاج. ومن أبرز المناطق المعوية مستهدفة من قبل كل الأنواع الأيمرية من قبل خطوط ملونة، مع المواقع المفضلة لأخذ العينات المشار إليها بواسطة رقم بين خطوط سوداء منقطة (E. acervulina: أصفر / 1، E. برونيتي: الوردي / 2، E. ماكسيما: أزرق / 3، E. هين: البرتقال / 4، E. الفاتكة: أحمر / 5، E. مبتسر: الأخضر / 6 و E. الرهيفة: الرمادي / 7). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. LAMP تشخيص العدوى eimerian جيئة وذهابام ثلاث الدجاج اللاحم التجارية. ردود الفعل LAMP حلها باستخدام (A) hydroxynaphthol الزرقاء، حيث كان رد فعل السماء الزرقاء إيجابي وكان البنفسجي إلى رد فعل سلبي الوردي، و (ب) الاغاروز الكهربائي للهلام. المواقع المعوية عينات كما عرضت في الجدول 1 لكل أنواع الطفيليات. A = E. acervulina، B = E. برونيتي، ما = E. ماكسيما، مي = E. هين، N = E. الفاتكة، P = E. مبتسر وT = E. الرهيفة. حارة 1 يرد سلم GeneRuler 1KB DNA. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. LAMP تشخيص العدوى eimerian باستخدام العينات المجمعة من ثلاث الدجاج اللاحم تجارية منفصلة. REAC LAMPحل ستعقد باستخدام الأزرق hydroxynaphthol، حيث كان رد فعل السماء الزرقاء إيجابي وكان البنفسجي إلى رد فعل سلبي الوردي. A = E. acervulina، B = E. برونيتي، ما = E. ماكسيما، مي = E. هين، N = E. الفاتكة، P = E. مبتسر وT = E. الرهيفة. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

موقع نموذج فحص الأنواع الأيمرية (على الأرجح)
العفج (D) E. acervulina، E. مبتسر
الصائم / الدقاق * (J / I) E. ماكسيما، E. الفاتكة
Caeca (C) E. الفاتكة، E. الرهيفة
محطة الدقاق (TI) E. برونيتي، E. هين عينة المجمعة (P) E. acervulina، E. برونيتي، E. ماكسيما، E. هين، E. الفاتكة، E. مبتسر، E. الرهيفة

الجدول 1. المعوية منطقة معينة مختارة من المقايسات الأنواع مرشح الأيمرية. إن اختيار المنطقة لأخذ عينات يختلف عن كل نوع من الأنواع الأيمرية كما هو موضح في الشكل (1). وتشمل العينات المجمعة المواد التي تم جمعها من جميع مواقع محددة الأربعة التي تم بعد ذلك جنبا إلى جنب من أجل إعداد DNA.

التمهيدي * تركيز الأسهم (ميكرومتر) الحجم (ميكرولتر)
ماء - 60
إلى الأمام التمهيدي الداخلية (FIP) 100 40
متخلف الحزب الثوري المؤسسي الداخليةمير (BIP) 100 40
إلى الأمام الخارجي التمهيدي (F3) 100 10
متخلف التمهيدي الخارجي (B3) 100 10
حلقة الأمام (LF) 100 20
حلقة الخلف (LB) 100 20
مجموع 200

الجدول 2. إعداد الخلطة الجاهزة LAMP التمهيدي. المكونات والنسب المطلوبة لإعداد الخلطة الجاهزة التمهيدي لLAMP. كميات المعروضة هي 100 ردود الفعل LAMP. * الهويات التمهيدي كما هو مبين في المواد وBarkway وآخرون (2011) 18.

الأسهم اضرب ن رد الفعل النهائي اضرب ن حجم في رد الفعل (ميكرولتر)
أحواض دبي الجافة العالمية - - 10.1
عازلة ThermoPol 10 × 1 × 2.5
MgSO 4 100 ملي 2 مم 0.5
مزيج التمهيدي * الجدول 2 2.5
dNTPs 25 ملي 400 أوقية 0.4
البيتين 5 M 1 M 5
Hydroxynaphthol الأزرق 3 مم 120 ميكرومتر 1
BST DNA بوليميريز 8،000 U / مل 8 U 1
مجموع 23

الجدول 3. إعداد LAMmastermix رد فعل P. * الأيمرية أنواع محددة.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics