Isothermal הגברה מבחני בתיווך לולאה (LAMP) לאיתור המינים ספציפי של

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

ייצור עוף עולמי גדל פי עשר במהלך 50 השנים האחרונות עם העולם המתפתח אירוח כמעט פי ארבע מההתרחבות עדים בעולם המפותח (www.faostat.org). כרלוונטי של ייצור עוף לביטחון מזון בעולם גדל כך גם יש לו את הפרופיל של פתוגנים אשר יכול לגרום למחלה קשה בתרנגולות. דוגמה בולטת הם מיני Eimeria, טפילי protozoan בכל מקום שיכול לגרום למחל coccidiosis enteric 1. בכל מקום שתרנגולות גדלות מיני Eimeria אחד או יותר עשויים להיות נפוץ 2-4. בעולם המפותח Eimeria נשלטים בעיקר על ידי chemoprophylaxis, העסקת תוכניות הסעות או סיבוב כדי למזער את ההשפעה של התנגדות 5. חיסונים חיים משמשים גם במערכות שבן ערך ציפור מספיק כדי להצדיק את העלות (לדוגמא, גידול המניה, שכבות וכמה פטמים 5). כresult הצעדים הללו coccidiosis הקליני לעתים קרובות מבוקר היטב, אם כי הזיהום תת קליני שכיח 5. בחיסון העולם המתפתח הוא נדיר ויישום תרופה לעתים קרובות הודיע ​​פחות טוב. כתוצאה מכך coccidiosis תת-קליני והקליני הוא נפוץ יותר ומפעיל השפעה כלכלית משמעותית 3.

אבחנה של זיהום eimerian הסתמכה באופן מסורתי על נגע הבקיע שלאחר מוות, למרות שאפילו מחברי מערכת הניקוד ביותר בשימוש נרחב בתגובה, כי לכמה מינים "זה נראה ספק אם הליך כזה צריך להיות ניסיון בכל אבל חמור מתון זיהומים" 6. ראיות משלימות יכולות להיות שנאספו באמצעות זיהוי מיקרוסקופי של שלב מחזור החיים oocyst עמיד לסביבה בדגימות צואה או המלטה, אם כי חופף מורפולוגיה יכול לבלבל כל אבל המומחה 6,7. חלופות מולקולריות באמצעות תגובת השרשרת של פולימראז (PCR), amplificatio האקראיn של צורות DNA PCR (RAPD-PCR) וטכנולוגיות PCR כמותי היה זמין לתקופה של עד 20 שנים 8-10, אך עד כה הם לא הצליחו להפוך לפופולריים. חשבון יחסית והדרישה לציוד מעבדה מומחה או עיבוד מוגבל הספיגה שלהם, למרות הטבע לעתים קרובות סובייקטיבית ותובעני מבחינה טכנית של pathology- המבוגר ומבוססת מיקרוסקופיה גישות 10,11. יכולות להיות מוגזמות מגבלות כאלה ברבים מהאזורים העניים יותר של העולם, כגון דרום מזרח אסיה, שבו ההשפעה של coccidiosis על עוני עשויה להיות גדולה יותר באופן יחסי 12. בתגובה יש ביקוש ברור לפשוט חדשים ורגיש, אך חסכוני, מבחני אבחון Eimeria מינים ספציפיים.

הגברה בידוד התרמי (LAMP) בתיווך לולאה היא קל להכנת טכניקה מונע DNA פולימרז כי הוא מסוגל הגברת כמויות גדולות של DNA. והכי חשוב, LAMP משתמש polymera BST DNAse במקום פולימראז תקי DNA משמש בדרך כלל בPCR, המאפשר הגברה DNA בטמפרטורה קבועה יחידה ללא הדרישה לרכיבה על אופניים תרמיים 13,14. LAMP יכול להיות נוח ליישום באפילו המעבדה הבסיסית ביותר או בתחום. Characterised על ידי התנגדות ביחס למעכבי PCR רבים, רגישות גבוהה וספציפיות, מבחני LAMP פותחו עבור מגוון רחב של פתוגנים הכוללים וירוס מחלה מדבקת bursal, perfringens Clostridium וCryptosporidium 15-17. בתגובה לדרישה לאבחון Eimeria חסכוני מינים ספציפיים חדש פנל של מבחני LAMP ספציפיים לכל אחד משבעת המינים שEimeria להדביק תרנגולות פותח 18. בקשות למבחנים החדשים כוללות התרחשות טפיל ניטור, של ערך מסוים נתנה את הקשר בין מינים כגון מקסימום Eimeria או necatrix Eimeria עם PE הכלכלי הירודrformance 3,4. יישומים אחרים כוללים הערכת היעילות של אסטרטגית anticoccidial של החווה, אבחנה של דלקת תת קליניים או מחלה קלינית והערכה של הסיכון הנשקף Eimeria לחווה.

Protocol

1. תבנית הכנה

הערה: כל תבנית ה- DNA הגנומי חשודה להכיל DNA נגזר מאחד משבעת המינים שEimeria להדביק תרנגולות יכולה לשמש כתבנית לזיהוי מינים מבוסס LAMP Eimeria. דגימות רקמת מעי לניתוח אבחון שדה צריכים להיות שנאספו במהלך נתיחה שלאחר המוות שגרתי כפי שמתוארים כאן.

  1. בחר הקטע (או קטעים) של מעי להיבדק. ראה בטבלת 1 מדריך לבחירת אתר לדוגמא ומיני הסיכוי הטובים ביותר להיות נוכח 18 ואיור 1 למגוון מינים ספציפיים של הפצה ומיקומם של אתרי הדגימה Eimeria.
    הערה: זה הוא בעל חשיבות מרכזית מאז Eimeria הוא בעיקר אתר מארח ספציפי. כל מין שמדביק תרנגולות מוגדר על ידי אזור המעיים שמטרות 19. ההחלטה עשויה להיות מושפעת מניסיון הקודם של החווה, עניין באחד או מומחדש מיני Eimeria ספציפיים או אינדיקטורים אבחון אחרים 6.
  2. סנטימטר בלו 5 או אורכים ארוכים יותר של סעיף המעיים (ים) שנבחר לבדיקת Eimeria באמצעות מספריים סטרילי או אזמל. לחלופין, לאחסן הדגימות לניתוח שלאחר מכן במקבע כמו למשל בRNAlater אתנול 18 או 95%.
    הערה: אם האחסון באתנול המדגם יש לשטוף ביסודיות בחומצה טריס-ethylenediaminetetraacetic סטרילי (TE) חיץ לפני השימוש.
  3. חותך את המדגם הפתוח לאורך זמן, להסיר את תוכן המעיים ביותר (אם קיימים) ולגרד תאים מהשכבה הרירית חופשיים או באמצעות הקצה של שקופית מיקרוסקופ הזכוכית סטרילית או להב מספריים אתנול / להבה מעוקרת. לחלופין למדגם במאגר כולל תאים מכל ארבעת אתרי מעיים המינים ספציפיים בצינור אחד.
  4. שים את החומר המגורד לתוך צינור microcentrifuge סטרילי 1.5 מיליליטר בורג העליון המכיל מאגר TE סטרילי 100 μl כולל 10% (w / v) Chelex 100 שרף.
  5. נער כל דגימת מרץ 1 דקות. ודא שהחלק העליון הבורג סגור היטב ואז דגירה באמבט מים רותח למשך 10 דקות.
  6. לאחר הרתיחה לאפשר לכל מדגם להתקרר בטמפרטורת הסביבה במשך 1-2 דקות.
  7. צנטריפוגה כל דגימה באמצעות microcentrifuge במהירות שיא (לדוגמא, XG ~ 10,000) 1 דקות.
  8. אסוף 2 μl של supernatant וכתוצאה מכך להיות תבנית בכל assay LAMP להתבצע. לחלופין, בריכה יותר מאתר אחד במעיים בצינור בודד במטרה לספק assay רב באתר.

2. Eimeria LAMP פריימר הכנה (Pre-assay)

  1. הכן מניות פריימר Eimeria LAMP הולמות עבור 100 מבחני:
    1. מחדש כל צבע יסוד Eimeria LAMP Lyophilised על ידי הוספת מים כיתה מולקולריות לריכוז של 100 מיקרומטר (כמפורט על ידי היצרן). אם לא צוין, לחשב את הנפח של usin מים הנדרשים בכיתה מולקולריתg המשקולות הפיזיות ומולקולריות של כל צבע יסוד.
    2. מים כיתה מולקולרית 60 μl פיפטה לתוך צינור microcentrifuge 0.5 מיליליטר להעיף העליון נפרד לכל מיני Eimeria להיות assayed.
    3. להוסיף פריימרים FIP, BIP, F3, B3, LF וLB הספציפי ליעד מיני Eimeria למים באמצעות הכרכים מוצגים בטבלה 2, יצירת סדרה של תערובות פריימר שבעה מינים ספציפיים.
    4. בקצרה מערבולת לערבב פתרון פריימר, אז דופק microfuge ולהקפיא עד לרגע שימוש.
  2. הכן mastermix תגובת LAMP עבור כל מין Eimeria להיות assayed. להכפיל את הנפחים מוצגים בטבלה 3 במספר דוגמאות ולהוסיף שלוש עד ביקורת חיובית, שליטה שלילית וחילוף pipetting. פיפטה לתוך 0.5 או 1.5 מיליליטר להעיף עליונה צינור microcentrifuge.

3. Eimeria LAMP Assay

  1. מינים ספציפיים פיפטה 23 μl Eimeria BST DNA פולימראז / LAMP mastermix ל0.5 מיליליטר צינור microcentrifuge.
  2. להוסיף תבנית 2 μl DNA (מוכנה בסעיף 1), מה שהופך סופי נפח תגובה של 25 μl.
  3. להוסיף הדנ"א הגנומי 2 μl Eimeria מינים ספציפי לתגובה אחת (ביקורת חיובית). מוסיף מים כיתה מולקולריים 2 μl לתגובה (שליטה שלילית).
    הערה: אם הדנ"א הגנומי מינים ספציפיים אינו זמין LAMP החיובי קודם או מוצר PCR סטנדרטי ניתן להשתמש במקום.
  4. דגירה באמבט מים או לחסום חום בגיל 62 o C למשך 30 דקות. לחלופין, דה-להפעיל את פולימראז BST DNA על ידי חימום עד 80 מעלות צלזיוס במשך 10 דקות אם התגובה היא לא הולכת לקרוא באופן מיידי.

4. LAMP Assay קריאה מתוך

  1. בסיומו של הדגירה להעריך את הצבע של כל תגובה על ידי עין תחת אור הפנימי. תוצאות שליליות מופיעות הוורודות לסגולות בצבע, תוצאות חיוביות מופיעות שמיים כחולים 20.
  2. לחלופין, לאשר את תוצאת assay LAMP בLaboratאורי על ידי ערבוב מוצר תגובת LAMP 5 μl עם חיץ טעינת ג'ל DNA μl 1 לג'ל אלקטרופורזה agarose באמצעות ג'ל agarose 2% ב 1 x טריס Borate EDTA חיץ / / (TBE), מראש מוכתם באמצעות כתם חומצות גרעין (μl 5 ל 50 מיליליטר agarose). הוסף 5 μl של סולם ה- DNA הגודל מולקולרי 1KB לנתיב 1 של הג'ל לאפשר חישוב גודל שבר.

Representative Results

אימות assay

במהלך אימות כל assay LAMP מינים ספציפיים Eimeria נבדק באמצעות פנל של דגימות DNA טהורות המייצגות את כל שבעת מיני Eimeria כי להדביק את העוף, כמו גם הדנ"א הגנומי עוף כביקורת מארח. ג'ל אלקטרופורזה agarose שימשה כדי לפתור כל assay והפגינה סגוליות מינים מוחלטים ללא תגובתיות צולבת מארח 18. בשלב הבא, פי עשר סדרת דילול סדרתי הוכנה באמצעות tenella Eimeria המטוהר הדנ"א הגנומי חשף גבול רגישות של assay בין אחת לעשרה עותקי הגנום 18. אין גבול העליון נקבע עם תוצאות טובות שהושגו עד וכוללים הריכוז הגבוה ביותר (100,000 העותקים בגנום) 18.

יישום עם דגימות שדה

דגימות שנאספו לבדיקת Eimeria צפויות להיגזר מתרנגולות נמצאו מת, ונבחרים כתוצאה מpoor בריאות או שלוקט למעקב בריאות זקיף, מה שמעיד על גודל מדגם סביר של בין אחת לשלוש, כאשר חלק משגרה. בדיקת שלוש ציפורים שנאספו מחווה פטם ארה"ב כחלק מתכנית מעקב הניבה שלושה סטים של דגימות מעי. ממוקד יישום של מבחני LAMP מינים ספציפיים, תוך מתן עדיף לאתרי המעיים המועדפים עבור כל מין Eimeria (טבלה 1), אפשר זיהוי חזותי של זיהום eimerian בכל ציפורים נבדק באמצעות (איור 2 א) hydroxynaphthol הכחול כאינדיקטור. הצבע שהושג עם תגובת LAMP שלילית בעת השימוש hydroxynaphthol כחולה יכול לנוע בין סגול לורוד, אבל הוא תמיד שונה מכחול מושגת על ידי תוצאה חיובית. אישור על ידי ג'ל אלקטרופורזה agarose סיפק תוצאות דומות (איור 2). במהלך יישום שדה המשתמש יכול לבחור ליישם את המסך המלא נגד כל שבעת המינים, או להתמקד רק אלה מינים עדיפות כחשוב או ידוע להיות במחזור בחווה או סביבתה.

הכישלון של גישות המבוססות על PCR להתבסס כאבחון להתרחשות של Eimeria מדגישה את הדרישה לפשטות בכל מבחן חדש. בעוד LAMP מציע הכנה פשוטה ועיבוד מ PCR, החובה לבחון אתרי מעיים מרובים לכל ציפור נשארה מייאשת. ייצור של מדגם יחיד במאגר ה- DNA לכל ציפור, אשר לאחר מכן ניתן לבדוק עם מבחני LAMP אחד או יותר, עשוי להיות מושך יותר. עיבוד מדגם במאגר אחד לכל ציפור, המייצג את החומר שנאסף מכל אחד מאתרי מעיים הספציפיים מתוארים בטבלה 1 ויקוו לפני הכנת DNA, לבדיקה עם כל שבעת מבחני LAMP סיפק את אותה התוצאה כמו בעת כל אתר מעיים היה מעובד בנפרד (איור 2 לעומת איור 3).

איור 1 איור 1. אתרי דגימת מעיים לגילוי LAMP של טפילי מיני Eimeria להדביק תרנגולות. האזורים במעי הממוקדים על ידי כל מיני Eimeria מודגש על ידי הקווים בצבע, עם האתרים המועדפים של דגימה מצויינים על ידי המספר בין הקווים השחורים המקווקו (א ' acervulina: / 1, Brunetti הצהוב E.: / ורוד 2, מקסימום E.: כחול / 3, mitis א: / 4, necatrix הכתום E.: אדום / 5, praecox א: / ירוק 6 וtenella א: אפור / 7). אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
אבחון 2. מנורת איור של זיהום eimerian הלוך ושובשלוש תרנגולות מ 'מסחריות פטם. תגובות LAMP נפתרו באמצעות () hydroxynaphthol כחולות, שבו תגובה כחולה שמים הייתה חיובית וסגולה לתגובה הוורודה היה שלילי, וג'ל אלקטרופורזה agarose (B). אתרי המעיים נדגמו כפי שמוצגים בטבלה 1 עבור כל מין טפיל. = E. acervulina, B = E. Brunetti, מא = E. מקסימום, Mi = E. mitis, N = E. necatrix, P = E. praecox וT = E. tenella. ליין 1 מכיל סולם GeneRuler 1KB DNA. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
אבחון 3. מנורת איור של זיהום eimerian באמצעות נקווה דגימות משלושה עופות פטם מסחריים נפרדים. reac LAMPמשא ונפתר באמצעות כחול hydroxynaphthol, שבו תגובה כחולה שמים הייתה חיובית וסגולות לתגובה הוורודה היה שלילי. = E. acervulina, B = E. Brunetti, מא = E. מקסימום, Mi = E. mitis, N = E. necatrix, P = E. praecox וT = E. tenella. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

אתר לדוגמא assay מיני Eimeria (סביר להניח)
תריסריון (D) acervulina E., praecox E.
מעי ריק / מעי * (J / I) א 'מקסימום, necatrix E.
Caeca (C) necatrix E., tenella E.
מעי Terminal (TI) Brunetti E., mitis E. מדגם יקווה (P) acervulina E., Brunetti א, א מקסימום, mitis E., necatrix E., praecox E., tenella E.

טבלת 1. בחירת מעיים אזור ספציפי של מבחני מיני המועמד Eimeria. הבחירה של אזור שתדגם משתנה עבור כל מין Eimeria כפי שמודגם באיור 1. דגימות נקוו כוללות חומר שנאסף מכל ארבעת האתרים הספציפיים שאוחדו לאחר מכן להכנת DNA.

* פריימר ריכוז מניות (מיקרומטר) נפח (μl)
מים - 60
קדימה הפנימי פריימר (FIP) 100 40
אחורה פנימי פריmer (BIP) 100 40
קדימה החיצוני פריימר (F3) 100 10
אחורה החיצוני פריימר (B3) 100 10
לולאה קדמית (LF) 100 20
לולאה לאחור (LB) 100 20
סה"כ 200

הכנת טבלה 2. premix פריימר LAMP. הרכיבים והפרופורציות יידרשו להכין premix פריימר לLAMP. כרכים המוצגים הם עבור 100 תגובות LAMP. * זהויות פריימר כפי שמוצג בחומרים וBarkway et al (2011) 18.

n קונצרט כלשהו המניה n קונצרט כלשהו התגובה האחרונה נפח לכל תגובה (μl)
DDW - - 10.1
מאגר ThermoPol 10 x 1 x 2.5
4 MgSO 100 מ"מ 2 מ"מ 0.5
תערובת פריימר * טבלה 2 2.5
dNTPs 25 מ"מ 400 אום 0.4
Betaine 5 M 1 M 5
Hydroxynaphthol כחול 3 מ"מ 120 מיקרומטר 1
פולימראז BST DNA 8,000 U / ml 8 U 1
סה"כ 23

הכנת לוח 3. לאםmastermix תגובת P. * Eimeria מינים ספציפיים.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics