Loop-medierad Isothermal Amplification (LAMP) Analyser för de artspecifika Upptäckt av

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Den globala kycklingproduktionen har ökat tiofaldigt under de senaste 50 åren med utvecklingsländerna värd nästan fyra gånger expansionen bevittnat i den utvecklade världen (www.faostat.org) . Som relevansen av kycklingproduktion till globala livsmedelsförsörjningen har ökat så har också den profil av patogener som kan orsaka allvarlig sjukdom hos kycklingar. Ett utmärkt exempel är de Eimeria-arter, ubiquitous protozoiska parasiter som kan orsaka den enter sjukdomen koccidios 1. Varhelst kycklingar föds upp en eller flera Eimeria arter kommer sannolikt att vara vanliga 2-4. I den utvecklade världen Eimeria främst styrs av kemoprofylax, anställa transporttjänster eller rotationsprogram för att minimera effekterna av motståndet 5. Levande vacciner används också i system där fågelvärdet är tillräcklig för att motivera kostnaden (t.ex. avelsdjur, lager och några broilers 5). Som Result av dessa åtgärder klinisk koccidios ofta väl kontrollerade, även subklinisk infektion är vanligt 5. I utvecklingsländerna vaccinering är sällsynt och drogansökan ofta mindre välinformerade. Som en konsekvens subklinisk och klinisk koccidios är vanligare och har ett betydande ekonomisk effekt 3.

Diagnos av eimerian infektion har traditionellt förlitat sig på lesion scoring efter slakt, men även författarna till den mest använda poängsystem kommenterade att för vissa arter "det verkar tveksamt om ett sådant förfarande bör försök i några men måttligt svåra infektioner" 6. Kompletterande bevis kan samlas in genom mikroskopisk detektering av miljötålig oocyst livscykel stadium i fekala eller strö prover, även om överlappande morfologi kan förbrylla alla utom experten 6,7. Molekylära alternativ använder polymerase chain reaction (PCR), slumpmässig amplification av polymorf DNA PCR (RAPD-PCR) och kvantitativa PCR-teknik har funnits i upp till 20 år 8-10, men hittills har de misslyckats med att bli populär. Relativ kostnad och kravet på specialistlaboratorieutrustning eller behandling har begränsat deras upptag, trots den ofta subjektiva och tekniskt krävande natur äldre pathology- och mikroskopi baserade strategier 10,11. Sådana begränsningar kan överdrivas i många av de fattigare regionerna i världen, såsom Sydostasien, där effekten av koccidios på fattigdom kan vara proportionellt större 12. Som svar finns det en tydlig efterfrågan på ny enkel och känslig, men kostnadseffektiva, Eimeria artspecifika diagnostiska analyser.

Loop-medierad isotermiska förstärkning (LAMP) är en lätt att förbereda DNA-polymeras driven teknik som kan förstärka stora mängder DNA. Viktigast använder LAMP en Bst DNA PolymeraSE istället för Taq-DNA-polymeras som vanligen användes i PCR, vilket underlättar DNA-amplifiering vid en enda konstant temperatur utan krav på termisk cykling 13,14. LAMP kan vara mottagliga för tillämpning i även de mest rudimentära laboratorium eller i fält. Kännetecknas av relativ resistens mot många PCR-inhibitorer, hög känslighet och specificitet, har LAMP analyser utvecklats för ett brett spektrum av patogener inklusive smitt bursasjukdom virus, Clostridium perfringens och Cryptosporidium 15-17. Som svar på efterfrågan på nya kostnadseffektiva Eimeria artspecifika diagnostik en panel av LAMP-analyser som är specifika för var och en av de sju Eimeria arter som infekterar kycklingar har utvecklats 18. Ansökningar om nya analyser inkluderar övervakning parasit förekomst, av särskilt värde med tanke på sammanslutning av arter som Eimeria maxima eller Eimeria necatrix med dålig ekonomisk performance 3,4. Andra tillämpningar inkluderar bedöma effekten av en gårdens anticoccidial strategi, diagnos av subklinisk infektion eller klinisk sjukdom och utvärdering av risk som Eimeria till en gård.

Protocol

1. Mall Framställning

NOTERA: Alla genomisk DNA-mall som misstänks innehålla DNA härrörande från en av de sju Eimeria arter som infekterar kycklingar kan användas som mall för LAMP-baserad Eimeria artidentifiering. Tarmvävnadsprover för fält diagnostisk analys bör samlas under rutin obduktion som beskrivs här.

  1. Välj sektionen (eller avsnitt) av tarmen som ska testas. Se tabell 1 för en guide till val provplatsen och de Eimeria arter som mest sannolikt att vara närvarande 18 och Figur 1 för artspecifika utbredningsområde och placering av provtagningsställen.
    OBS: Detta är av central betydelse eftersom Eimeria är särskilt värd platsspecifik. Varje art som infekterar kycklingar definieras av det intestinala området att det riktar 19. Beslutet kan påverkas av tidigare erfarenheter av gården, intresset för en eller more specifika Eimeria arter eller andra diagnostiska indikatorer 6.
  2. Punkt 5 cm eller längre längder i tarm sektion (er) som valts för att testa för Eimeria använder steril sax eller skalpell. Eventuellt lagra prover för senare analys i ett fixativ såsom exempelvis i RNAlater 18 eller 95% etanol.
    OBS: Om lagring i etanol provet bör tvättas noga i sterilt tris-etylendiamintetraättiksyra (TE) buffert före användning.
  3. Skär provet öppet längsled, ta bort de flesta tarminnehåll (om den finns) och skrapa cellerna från slemhinneskiktet gratis med antingen kanten av en steril glasobjektglas eller en etanol / flamma steriliserad saxbladet. Eventuellt för ett samlat prov inkluderar celler från alla fyra artspecifika tarm platser i ett enda rör.
  4. Sätt skrapade materialet i en steril 1,5 ml skruvkork mikrocentrifugrör innehållande 100 pl steril TE-buffert med 10% (vikt / volym) Chelex 100-harts.
  5. Skaka varje prov om kraftigt under 1 min. Se till att skruvlock är ordentligt stängd och sedan inkubera i ett kokande vattenbad under 10 minuter.
  6. Efter kokning låta varje prov att svalna vid omgivande temperatur under 1-2 minuter.
  7. Centrifugera varje prov med användning av en mikrocentrifug vid topphastighet (t.ex. ~ 10.000 xg) i en minut.
  8. Samla 2 pl av den erhållna supernatanten vara mall i varje LAMP-analys som ska utföras. Eventuellt poolen mer än en intestinal plats i ett enda rör för att åstadkomma en multi-site-analysen.

2. Eimeria LAMP Primer Förberedelser (Pre-assay)

  1. Förbered Eimeria LAMP primer lager tillräckliga för 100 analyser:
    1. Bered varje frystorkat Eimeria LAMP primer genom att lägga molekylär kvalitet vatten till en koncentration av 100 iM (enligt uppgift från tillverkaren). Om inte angiven, beräkna volymen av molekylär kvalitet vatten krävs using de fysiska och molekylvikterna för varje primer.
    2. Pipettera 60 | il av molekylärbiologisk kvalitet vatten till ett separat 0,5 ml flip-top-mikrocentrifugrör för varje Eimeria ämnen som skall analyseras.
    3. Lägg primers FIP, BIP, F3, B3, LF och LB specifikt för målgrupp Eimeria arterna till vattnet med hjälp av de volymer som anges i tabell 2, skapar en serie av sju artspecifika primer mixar.
    4. Kortfattat virvel blanda primerlösningen, sedan puls mikrofug och frysa tills de behövs.
  2. Förbered en LAMP reaktion mastermix för varje Eimeria art som skall analyseras. Multiplicera de volymer som anges i tabell 3 med antalet prover och lägga tre till en positiv kontroll, negativ kontroll och pipettering reservdel. Pipett till en 0.5 eller 1.5 ml flip-top mikrocentrifugrör.

3. Eimeria LAMP Assay

  1. Pipett 23 pl Eimeria artspecifika Bst DNA-polymeras / LAMP Mastermix till en 0.5 ml mikrocentrifugrör.
  2. Tillsätt 2 l DNA-mall (framställd i avsnitt 1), gör en slutlig reaktionsvolym av 25 ul.
  3. Lägg 2 pl Eimeria artspecifik iskt DNA till en reaktion (positiv kontroll). Lägg 2 pl av molekylärbiologisk kvalitet vatten till reaktionen (negativ kontroll).
    OBS: Om artspecifik iskt DNA är inte tillgänglig ett tidigare positivt LAMP eller standard PCR-produkt kan användas i stället.
  4. Inkubera i ett vattenbad eller värmeblock vid 62 ° C i 30 min. Eventuellt de-aktivera Bst DNA-polymeras genom värmning till 80 ° C under 10 min om reaktionen inte kommer att avläsas omedelbart.

4. LAMP Assay Läs-out

  1. Vid slutet av inkubationen bedöma färgen på varje reaktion genom ögat under inomhusbelysning. Negativa resultat verkar rosa till violett färg, positiva resultat visas himmelsblå 20.
  2. Eventuellt bekräfta LAMP analysresultatet i en Laboratory genom blandning 5 pl LAMP reaktionsprodukt med 1 | il DNA-gel-laddningsbuffert för agarosgelelektrofores med användning av en 2% agarosgel i 1 x Tris / borat / EDTA (TBE) buffert, för-färgades med användning av en nukleinsyra fläck (5 pl per 50 ml agaros). Tillsätt 5 pl av en 1Kb molekylstorlek DNA stege för att bana 1 av gelen att tillåta fragmentstorlek beräkning.

Representative Results

Assay validering

Under validering varje Eimeria artspecifik LAMP-analysen testades med hjälp av en panel av rena DNA-prover som representerar alla sju Eimeria arter som infekterar kycklingen, liksom kyckling iskt DNA som värd kontroll. Agarosgelelektrofores användes för att lösa varje analys och visade absolut artspecificitet utan värd korsreaktivitet 18. Nästa, en tio-faldig seriespädserie beredd att använda renat Eimeria tenella iskt DNA avslöjade ett analyskänslighet gräns på mellan en och tio genomkopior 18. Ingen övre gräns bestämdes med positiva resultat fram till och inklusive den högsta koncentrationen (100.000 genomkopior) 18.

Ansökan med fältprov

Prov som samlats för Eimeria testning kommer sannolikt att komma från höns hittats döda avlivats till följd av poor hälsa eller avlivas för övervakning sentinel hälsa, vilket indikerar en sannolikhet stickprovsstorlek på mellan en och tre när en del av en rutin. Testa tre fåglar som samlats in från en amerikansk broiler gård som en del av ett övervakningsprogram gav tre uppsättningar tarmprover. Målinriktad tillämpning av de artspecifika LAMP-analyser, prioritera de föredragna tarm platser för varje Eimeria arter (Tabell 1), tillät visuell identifiering av eimerian infektion hos alla fåglar testats med hydroxynaphthol blå som en indikator (Figur 2A). Färgen uppnås med en negativ LAMP reaktion när du använder hydroxynaphthol blå kan variera från violett till rosa, men är alltid skild från den blå uppnås genom ett positivt resultat. Bekräftelse med agarosgelelektrofores förutsatt jämförbara resultat (Figur 2B). Under fält ansökan kan användaren välja att tillämpa helskärm mot alla sju arter, eller rikta endast de arter prioriteras somviktigt eller känt att cirkulera på gården eller omgivningen.

Misslyckandet i PCR-baserade metoder för att etablera sig som diagnostik för uppkomsten av Eimeria betonar kravet på enkelhet i varje nytt test. Medan LAMP erbjuder enklare bearbetning och beredning än PCR, kravet på att testa flera intestinala ställen per fågel förblir nedslående. Produktion av en enda sammanslagen DNA-prov per fågel, som sedan kan testas med en eller flera glöd analyser, kommer sannolikt att vara mer tilltalande. Bearbetning ett samlingsprov per fågel, representerande material samlas in från var och en av de specifika tarm platserna som beskrivs i tabell 1 och poolade före DNA förberedelse, för att testa med alla sju LAMP analyser förutsatt samma resultat som när varje tarm plats behandlades separat (Figur 2 jämfört med figur 3).

Figur 1 Figur 1. Tarmprovtagningsplatser för LAMP upptäckt av Eimeria arter parasiter som infekterar kycklingar. Tarm regioner som omfattas av varje Eimeria art framhävs av de färgade linjerna, med föredragna ställen för provtagning anges av antalet mellan de streckade svarta linjer (E. acervulina: gul / 1, E. Brunetti: rosa / 2, E. maxima: blå / 3, E. mitis: orange / 4, E. necatrix: röd / 5, E. praecox: grön / 6 och E. tenella: grå / 7). Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2. LAMP diagnos av eimerian infektion from tre kommersiella broilerkycklingar. LAMP reaktioner lösas med hjälp av (A) hydroxynaphthol blått, där en himmelsblå reaktion var positiv och en violett till rosa reaktion var negativ, och (B) agarosgelelektrofores. Tarm platser i urvalet som visas i tabell 1 för varje parasitarter. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox och T = E. tenella. Bana 1 innehöll GeneRuler 1Kb DNA-stege. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. LAMP diagnos av eimerian infektion använder sammanställda prover från tre separata kommersiella slaktkycklingar. LAMP REACtioner lösas med hjälp hydroxynaphthol blått, där en himmelsblå reaktion var positiv och violett till rosa reaktion var negativ. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox och T = E. tenella. Klicka här för att se en större version av denna siffra.

Prov site Eimeria arter analys (troligen)
Duodenum (D) E. acervulina, E. praecox
Jejunum / ileum * (J / I) E. maxima, E. necatrix
Blindtarmar (C) E. necatrix, E. tenella
Terminal ileum (TI) E. brunetti, E. mitis Samlingsprov (P) E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella

Tabell 1. Intestinal regionspecifika val av kandidat Eimeria arter analyser. Valet av regionen som ska provtas varierar för varje Eimeria arter som visas i figur 1. Samlingsprover innehålla material som samlats in från alla fyra specifika platser som sedan kombineras för DNA-preparation.

Primer * Lager koncentration (pM) Volym (^ il)
Vatten - 60
Framåt Inre primer (FIP) 100 40
Bakåt Inre Primeren (BIP) 100 40
Framåt Yttre Primer (F3) 100 10
Bakåt Yttre Primer (B3) 100 10
Loop Forward (LF) 100 20
Loop bakåt (LB) 100 20
Totalt 200

Tabell 2. Beredning av en LAMP primer förblandning. Komponenterna och proportionerna som krävs för att förbereda en primer förblandning för LAMP. Volymerna visas är för 100 LAMP reaktioner. * Primer identiteter som visas i Material och Barkway et al (2011) 18.

Lager konc n Slutlig reaktions konc n Volym per reaktion (pl)
DDW - - 10,1
ThermoPol buffert 10 x 1 x 2,5
MgSO 4 100 mM 2 mM 0,5
Primer mix * Tabell 2 2,5
dNTP 25 mM 400 uM 0,4
Betain 5 M 1 M 5
Hydroxynaphthol blå 3 mM 120 pM 1
Bst DNA-polymeras 8000 U / ml 8 U 1
Totalt 23

Tabell 3. Beredning av ett LAMP reaktion mastermix. * Eimeria artspecifik.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics