Loop-mediert Isotermisk forsterkning (LAMP) Analyser for Artenes spesifikke Påvisning av

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Globalt kylling produksjonen har økt ti ganger i løpet av de siste 50 årene med den tredje verden hosting nesten fire ganger utvidelsen vitne i den utviklede verden (www.faostat.org) . Som relevansen av kylling produksjon til verdens matsikkerhet har vokst så altfor har profilen til patogener som kan forårsake alvorlig sykdom hos høns. Ett godt eksempel er Eimeria arter, allestedsnærværende protozo parasitter som kan føre til tarmsykdom hos koksidiose en. Uansett hvor kyllinger er alet opp en eller flere Eimeria arter er sannsynlig å være vanlig 2-4. I den industrialiserte verden Eimeria er primært styrt av kjemoprofylakse, ansette transporttjenester eller rotasjons programmer for å minimere virkningen av motstand 5. Levende vaksiner er også brukt i systemer hvor fugle verdi er tilstrekkelig til å rettferdiggjøre kostnadene (f.eks avlsdyr, lag og noen slaktekylling 5). Som et result av disse tiltakene klinisk koksidiose er ofte godt kontrollert, selv om subklinisk infeksjon er vanlig 5. I utviklingsland vaksinasjon er sjeldne og narkotika søknad ofte mindre godt informert. Som en konsekvens sub-klinisk og klinisk koksidiose er mer vanlig og utøver en betydelig økonomisk effekt 3.

Diagnostisering av eimerian infeksjon har tradisjonelt støttet seg på lesjon scoring obduksjon, selv om selv de forfatterne av den mest brukte scoring system kommenterte at for noen arter "det virker tvilsomt om en slik prosedyre bør være forsøkt i noen men moderat alvorlige infeksjoner" 6. Supplerende bevis kan samles gjennom mikroskopisk påvisning av miljø motstandsdyktig oocyst livssyklus scenen i avførings eller søppel prøver, selv om overlappende morfologi kan forvirre alle, men den sakkyndige 6,7. Molekylære alternativer ved hjelp av polymerase kjedereaksjon (PCR), tilfeldig amplification av polymorfe DNA PCR (RAPD-PCR) og kvantitative PCR teknologier har vært tilgjengelig for opp til 20 år 8-10, men hittil har de ikke klart å bli populære. Relative kostnad og kravet til spesialist laboratorieutstyr eller foredling har begrenset deres opptak, til tross for den ofte subjektive og teknisk krevende arten av den eldre pathology- og mikrosbaserte tilnærminger 10,11. Slike begrensninger kan være overdrevet i mange av de fattigere delene av verden som Sør-Øst Asia, hvor virkningen av koksidiose på fattigdom kan være forholdsmessig større 12. Som reaksjon er det et klart behov for et nytt ukomplisert og følsom, men kostnadseffektiv, Eimeria-arter som er spesifikke diagnostiske analyser.

Loop-mediert isoterm amplifisering (lampe) er en enkel å fremstille DNA-polymerase-drevet teknikk som er i stand til å forsterke store mengder av DNA. Viktigst, bruker LAMP en Bst DNA polymerase i stedet for Taq-DNA-polymerase som vanligvis brukes i PCR, noe som letter DNA-amplifikasjon ved en enkelt konstant temperatur uten behov for termisk sykling 13,14. LAMP kan være mottagelig for søknad i selv de mest elementære laboratoriet eller ute i felten. Karakterisert ved relativ resistens mot mange PCR-inhibitorer, med høy sensitivitet og spesifisitet, har LAMPE analyser blitt utviklet for et bredt spekter av patogener, inkludert infeksiøs bursal sykdomsvirus, Clostridium perfringens og Cryptosporidium 15-17. Som svar på etterspørselen etter nye kostnadseffektive Eimeria artsspesifikke diagnostikk et panel av LAMP-analyser som er spesifikke for hver av de syv Eimeria arter som infiserer kyllinger har blitt utviklet 18. Søknader om nye analyser inkluderer overvåking parasitt forekomst av spesiell verdi gitt sammenslutning av arter som Eimeria maxima eller Eimeria necatrix med dårlig økonomisk performance 3,4. Andre bruksområder er å vurdere effekten av en gårdens anticoccidial strategi, diagnostisering av subklinisk infeksjon eller klinisk sykdom og vurdering av risiko som utgjøres av Eimeria til en gård.

Protocol

1. Mal Forberedelse

MERK: Enhver genomisk DNA mal mistenkes å inneholde DNA som stammer fra en av de syv Eimeria arter som infiserer kyllinger kan brukes som mal for LAMP-basert Eimeria artsbestemmelse. Tarm vevsprøver for feltet diagnostisk analyse bør samles under rutinemessig obduksjon som beskrevet her.

  1. Velger den delen (eller delene) av tarmen som skal testes. Se tabell 1 for en guide til prøvested utvalg og Eimeria arter som mest sannsynlig vil være til stede 18 og Figur 1 for den artsspesifikke spekter av distribusjon og plassering av prøvetakingsstedene.
    MERK: Dette er av avgjørende betydning siden Eimeria er særlig vertsstedsspesifikke. Hver art som infiserer kyllinger er definert av den intestinale området at det er rettet mot 19. Avgjørelsen kan påvirkes av tidligere erfaring av gården, interesse i ett eller more spesifikke Eimeria arter eller andre diagnostiske indikatorer 6.
  2. Avgifts 5 cm eller lengre lengder av tarmdelen (e) er valgt for å teste for Eimeria ved hjelp av steril saks eller en skalpell. Eventuelt kan lagre prøver for etterfølgende analyse i et fikseringsmiddel slik som for eksempel i RNAlater 18 eller 95% etanol.
    MERK: Ved lagring i etanol prøven må vaskes grundig i sterilt tris-etylendiamintetraeddiksyre (TE) buffer før bruk.
  3. Kutt prøven åpen på langs, fjern mest tarminnholdet (hvis det finnes) og skrape celler fra slimhinnen gratis ved hjelp av enten kanten av et sterilt glass objektglass eller en etanol / flamme sterilisert sakseblad. Eventuelt for en samleprøve omfatter celler fra alle fire av de artsspesifikke tarm områder i et enkelt rør.
  4. Sett skrapt materialet i en steril 1,5 ml skrue-top mikrosentrifugerør inneholder 100 mikroliter sterilt TE buffer inkludert en0% (vekt / volum) Chelex 100-harpiks.
  5. Rist hver prøve kraftig i 1 min. Sørg for at skrukork er fast lukket og deretter inkuberes i et kokende vannbad i 10 min.
  6. Etter koking tillate hver prøve avkjøles i den omgivende temperatur i 1-2 min.
  7. Sentrifuger hver prøve ved hjelp av en mikro i full fart (f.eks ~ 10.000 xg) i 1 min.
  8. Samle 2 ul av den resulterende supernatant som templat i hver lampe analyse som skal utføres. Eventuelt bassenget mer enn en intestinal område i et enkelt rør for å tilveiebringe en flersete-assay.

2. Eimeria LAMP Primer Forberedelse (Pre-analyse)

  1. Forberede Eimeria LAMP primer aksjer tilstrekkelig for 100 analyser:
    1. Rekonstituere hver frysetørret Eimeria LAMP primer ved å legge molekylær grade vann til en konsentrasjon på 100 mikrometer (som spesifisert av produsenten). Hvis ikke spesifisert, beregne volumet av molekylær grade vann som er nødvendig using de fysiske og molekylvekter av hver primer.
    2. Pipetter 60 mL molekylær grade vann inn i en egen 0,5 ml flip-top mikrosentrifugerør for hver Eimeria arter som skal analyseres.
    3. Legg primere FIP, BIP, F3, B3, LF og LB er spesifikke for målet Eimeria-arter til vannet ved hjelp av de volumer som er vist i tabell 2, noe som skaper en serie av syv artsspesifikke primerblandinger.
    4. I korthet vortex blander primer oppløsning, og deretter pulsmikrofuge og fryse inntil påkrevet.
  2. Forberede en LAMP reaksjon Mastermix for hver Eimeria arter som skal analyseres. Multipliser volumene vist i tabell 3 ved antall prøver og tilsett tre til en positiv kontroll, negative kontroll og pipettering reserve. Pipette i en 0,5 eller 1,5 ml flip-top mikrosentrifugerør.

3. Eimeria LAMP-analyse

  1. Pipetter 23 mL Eimeria artsspesifikke Bst DNA polymerase / LAMP MASTERMIX inn en 0.5 ml mikro tube.
  2. Tilsett 2 pl DNA mal (utarbeidet i kapittel 1), tar en endelig reaksjon volum på 25 pl.
  3. Tilsett 2 ul Eimeria artsspesifikk genomisk DNA til en reaksjon (positiv kontroll). Tilsett 2 ul molekylær klasse vann til reaksjon (negativ kontroll).
    MERK: Hvis artsspesifikke genomisk DNA er ikke tilgjengelig en tidligere positiv LAMP eller standard PCR produktet kan brukes i stedet.
  4. Inkuber i et vannbad eller i varmeblokk ved 62 ° C i 30 min. Eventuelt kan de-aktivere Bst-DNA-polymerase ved oppvarming til 80 ° C i 10 min hvis reaksjonen ikke kommer til å bli avlest umiddelbart.

4. LAMP analysen Les-out

  1. Ved avslutningen av inkubasjonen vurdere fargen av hver reaksjon ved øyet i henhold til innendørs belysning. Negative resultater vises rosa til fiolett i fargen, synes positive resultater himmel blå 20.
  2. Eventuelt bekrefte LAMP analyseresultat i en Laboratdingen ved å blande 5 ul LAMPE reaksjonsproduktet med 1 pl DNA-gel lastebuffer for agarose gel-elektroforese ved anvendelse av en 2% agarosegel i 1 x Tris / borat / EDTA (TBE) buffer, pre-farget ved anvendelse av en nukleinsyre-flekk (5 ul per 50 ml agarose). Tilsett 5 ul av en 1 kb molekylstørrelse DNA stige til lane en av gelen for å tillate fragmentstørrelse beregning.

Representative Results

Analysen validering

Under valideringen hver Eimeria artsspesifikke LAMPE analysen ble testet ved bruk av et panel av ren DNA-prøver som representerer alle de syv Eimeria-arter som infisere kylling, samt kylling genomisk DNA som en vert kontroll. Agarosegelelektroforese ble brukt til å løse hver analyse og viste absolutt artspesifisitet med ingen vert kryssreaktivitet 18. Deretter utarbeidet en ti-fold serie fortynningsserier bruke renset Eimeria tenella genomisk DNA avslørte en assayfølsomhet grense på mellom ett og ti genom kopier 18. Ingen øvre grense ble bestemt med oppnådd opp til positive resultater og inkludert den høyeste konsentrasjonen (100000 genom eksemplarer) 18.

Søknad med feltprøver

Prøver samlet for Eimeria testing er sannsynlig å være avledet fra kyllinger funnet døde, hentet som en konsekvens av poor helse eller hentet for sentinel helseovervåking, noe som indikerer en sannsynlig utvalgsstørrelse på mellom ett og tre år da en del av en rutine. Testing tre fugler innsamlet fra et amerikansk broiler gården som en del av et overvåkingsprogram ga tre sett av tarmprøver. Målrettet anvendelse av artsspesifikke LAMPE assays, prioritere de foretrukne seter for intestinal hver Eimeria-arter (Tabell 1), tillates visuell identifisering av eimerian infeksjon i alle fugler testet ved hjelp hydroxynaphthol blått som indikator (figur 2A). Fargen oppnådd med en negativ LAMPE reaksjon ved bruk hydroxynaphthol blå kan variere fra fiolett til rosa, men er alltid forskjellig fra den blå oppnås ved et positivt resultat. Bekreftelse av agarosegelelektroforese gitt sammenlignbare resultater (figur 2B). Under felt programmet brukeren kan velge å bruke hele skjermen mot alle sju arter, eller målrette bare de arter prioritert somviktig eller kjent for å være sirkulerer på gården eller området rundt.

Svikt i PCR-baserte metoder for å bli etablert som diagnostikk for forekomsten av Eimeria understreker behovet for enkelhets skyld i en ny test. Mens LAMP tilbyr enklere forberedelse og behandling enn PCR, kravet om å teste flere intestinalsteder per fugl er fortsatt nedslående. Produksjonen av en enkelt samle DNA-prøve pr fugl, som deretter kan testes med en eller flere LAMPE assays, er sannsynlig å være mer attraktivt. Behandler en samleprøve av fugl, som representerer materiale oppsamlet fra hver av de bestemte områder i tarmen som er beskrevet i tabell 1, og sammenslåtte før DNA-preparatet, for testing med alle syv LAMPE analyser tilgjengelig samme resultat som når hver intestinale området ble behandlet hver for seg (figur 2 sammenlignet med figur 3).

Figur 1 Figur 1. Tarmprøvetakingssteder for LAMP påvisning av Eimeria arter parasitter som infiserer kyllinger. Tarm regioner målrettet av hver Eimeria arter er markert med fargede linjer, med de foretrukne stedene for prøvetaking indikeres med antall mellom de stiplede svarte streker (E. acervulina: gul / 1, E. brunetti: rosa / 2, E. maxima: blå / 3, E. mitis: orange / 4, E. necatrix: rød / 5, E. praecox: grønn / 6 og E. tenella: grå / 7). Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. LAMP diagnose av eimerian infeksjon from tre kommersielle slaktekylling. LAMP reaksjoner løst ved hjelp av (A) hydroxynaphthol blå, hvor en himmel blå reaksjon var positiv og en fiolett til rosa reaksjon var negativ, og (B) agarosegelelektroforese. Tarmsider samplede ble som vist i tabell 1 for hvert parasittarter. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox og T = E. tenella. Kjørefelt 1 inneholdt den GeneRuler 1 kB DNA stigen. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. LAMP diagnose av eimerian infeksjon ved hjelp av samleprøver fra tre separate kommersielle slaktekylling. LAMP REACsjoner løst ved hjelp hydroxynaphthol blå, hvor en himmel blå reaksjon var positiv og fiolett til rosa reaksjon var negativ. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox og T = E. tenella. Klikk her for å se en større versjon av dette tallet.

Prøvested Eimeria arter assay (mest sannsynlig)
Tolvfingertarmen (D) E. acervulina, E. praecox
Jejunum / ileum * (J / I) E. maxima, E. necatrix
Caeca (C) E. necatrix, E. tenella
Terminal ileum (TI) E. Brunetti, E. mitis Samleprøve (P) E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella

Tabell 1. Intestinal region-spesifikt valg av kandidat Eimeria-arter analyser. Valget av regionen som skal avsøkes, varierer for hver Eimeria-arter som er vist på figur 1. Samleprøver omfatter materiale som samles fra alle fire spesifikke seter som deretter ble kombinert for DNA-preparat.

Primer * Lager konsentrasjon (mikrometer) Volum (mL)
Vann - 60
Forward Indre Primer (FIP) 100 40
Bakover Indre Primer (BIP) 100 40
Forward Ytre Primer (F3) 100 10
Bakover Ytre Primer (B3) 100 10
Loop Forward (LF) 100 20
Loop bakover (LB) 100 20
Total 200

Tabell 2. Utarbeidelse av en LAMP primer premix. Komponentene og proporsjoner som kreves for å forberede en primer premiks for LAMP. Volumene er oppgitt er for 100 LAMP reaksjoner. * Primer identiteter som vist i de Materialer og Barkway et al (2011) 18.

Lager kons n Endelig reaksjon kons n Volum per reaksjon (pl)
DDW - - 10.1
ThermoPol buffer 10 x 1 x 2,5
MgSO4 100 mM 2 mm 0.5
Primerblandingen * Tabell 2 2,5
dNTPs 25 mM 400 um 0.4
Betain 5 M 1 M 5
Hydroxynaphthol blå 3 mm 120 mikrometer 1
Bst DNA polymerase 8000 U / ml 8 U 1
Total 23

Tabell 3. Fremstilling av en LAMP reaksjon Mastermix. * Eimeria artsspesifikke.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics