Türler özgü Algılama Loop-aracılı İzotermal Amplifikasyon (LAMP) Tahliller

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Küresel tavuk üretimi gelişmekte olan dünyada gelişmiş ülkelerde tanık yaklaşık dört kat genişleme barındırma on kat üzerinde son 50 yıldır arttı (www.faostat.org) . Dünya gıda güvenliği tavuk üretiminin önemi büyüdü kadar çok tavuklarda ciddi hastalığa neden olabilir patojenlerin profiline sahiptir. Bir örnektir enterik hastalık koksidiyoz 1 neden olabilir Eimeria türleri, her yerde protozoon parazitler vardır. Tavuk yetiştirilen her yerde, bir ya da daha fazla Eimeria türleri 2-4 yaygın olması muhtemeldir. Gelişmiş dünyada Eimeria öncelikle direnç 5 etkisini en aza indirmek için servis veya rotasyon programları kullanılarak, kemoprofilaksi tarafından kontrol edilir. Canlı aşılar da kuş değeri elde etme maliyeti haklı göstermek için yeterli olduğu sistemlerde kullanılır (örneğin, stok, katmanları ve bazı piliç 5 damızlık). Bir resu olarakKlinik coccidiosis genellikle iyi kontrol edilir, bu önlemlerin lt, sub-klinik enfeksiyon 5 yaygın olmasına rağmen. Gelişen dünya aşılama nadirdir ve ilaç uygulaması sık sık az iyi bilgilendirilmiş. Sonuç olarak-sub klinik ve klinik coccidiosis daha yaygındır ve önemli bir ekonomik etkisi 3 uygular.

En yaygın olarak kullanılan skorlama sistemi bile yazarlar, bazı türler için "böyle bir prosedür herhangi fakat orta şiddetli enfeksiyonlarda denenmelidir şüphelidir görünüyor" yorumunu rağmen eimerian enfeksiyon tanısı geleneksel, otopsiyi puanlama lezyon dayandığı 6. Morfolojisi örtüşen uzman 6,7 ama bulandırabilir rağmen Ek delil, dışkı veya çöp örneklerinde çevre dirençli Ookist yaşam döngüsü aşamasında mikroskobik algılama yoluyla elde edilebilir. Polimeraz zincir reaksiyonu kullanılarak moleküler alternatifler (PCR) kullanılarak, rasgele amplificatiopolimorfik DNA PCR (RAPD-PCR) ve kantitatif PCR teknolojileri n 20 yıla kadar 8-10 mevcut olmuştur, ancak bugüne kadar popüler hale başarısız olmuştur. Bağıl gider ve uzman laboratuar ekipmanları veya işleme gereksinimi genellikle subjektif ve teknik olarak zor yaşlı pathology- doğası ve mikroskopi tabanlı 10,11 yaklaşımlar rağmen, kendi alımını sınırlıdır. Bu tür sınırlamalar yoksulluk üzerindeki koksidiyoz etkisi 12 orantılı büyük olabilir gibi Güney Doğu Asya gibi dünyanın yoksul bölgelerinde, birçok abartılı olabilir. Buna karşılık, Eimeria türe özgü teşhis deneyleri, yeni basit ve hassas, ancak maliyeti etkin bir açık bir talep var.

Döngü aracılı izotermal amplifikasyon (LAMP), büyük bir DNA miktarlarda büyütme yeteneğine sahip bir DNA polimerazı güdümlü bir yöntem hazırlamak çok kolaydır. En önemlisi, LAMP bir Bst DNA polymera kullanırse yerine termal çevrim 13,14 için gerek olmaksızın, tek bir sabit sıcaklıkta, DNA amplifikasyonu kolaylaştıran genel olarak PCR'de kullanılan Taq DNA polimerazı. LAMBA bile en ilkel laboratuvarda veya sahada uygulama için uygun olabilir. Birçok PCR inhibitörleri, yüksek duyarlılık ve özgünlüğü göre direnç ile karakterize, LAMP deneyleri enfeksiyöz bursa hastalığı virüsü, Clostridium perfringens ve Cryptosporidium 15-17 olmak üzere patojenlerin geniş bir yelpazede geliştirilmiştir. Buna karşılık tavuk enfekte yedi Eimeria türlerinin her özel LAMP tahliller panel 18 geliştirilmiştir yeni maliyet-etkin Eimeria türe özgü teşhis için talep. Yeni tahliller için başvurular böyle kötü ekonomik pe ile Eimeria maxima veya Eimeria necatrix gibi türlerin derneği verilen belirli değerin izlenmesi parazit oluşumunu içerir3,4 rformance. Diğer uygulamalar çiftlik antikoksidiyal stratejisi, sub-klinik enfeksiyon veya klinik hastalık ve bir çiftlik Eimeria yarattığı riskin değerlendirilmesi tanı etkinliğini değerlendirmek içerir.

Protocol

1. Şablon hazırlama

Not: tavuk enfekte yedi Eımerıa türü birinden türetilen DNA ihtiva ettiğinden şüphelenilen herhangi bir genomik DNA şablon lamba tabanlı Eimeria türleri tanımlanması için bir şablon olarak kullanılabilir. Burada açıklandığı gibi alan teşhis analizi için bağırsak doku örnekleri rutin otopsi sırasında alınmalıdır.

  1. Bağırsak bölümünde (veya bölümler) seçin test edilecek. Örnek site seçimi için bir rehber ve örnekleme siteleri dağıtımı ve konumu türe özgü aralığı için 18, mevcut ve Şekil 1 olması en muhtemel Eimeria türleri için Tablo 1'e bakınız.
    NOT: Eimeria özellikle ev sahibi sitesi özeldir çünkü bu anahtar öneme sahiptir. Tavuk bozar Her türün bu 19 hedef bağırsak bölgeye göre tanımlanır. Karar bir veya mo önceki çiftlik deneyimi, ilgi etkilenebilirBelirli Eimeria türlerinin ya da diğer tanısal göstergelere 6 yeniden.
  2. Tüketim 5 cm veya daha Eimeria steril makas veya bir bisturi bıçağını kullanarak test etmek için seçilen bağırsak bölüm (ler) in daha uzunlukları. İsteğe bağlı olarak, örneğin RNAlater 18 ya da% 95 etanol içinde, örneğin bir sabitleyici olarak bir sonraki analiz için numune depolamak.
    Not: etanol numune depolamak steril Tris-etilendiamintetraasetik asit iyice yıkanmalıdır (TE), kullanımdan önce tampon.
  3. Uzunlamasına açık örnek kesin ücretsiz steril cam mikroskop lamı kenarına ya da bir etanol / alev sterilize makas bıçak kullanarak mukoza tabakasının hücreleri en bağırsak içeriği kaldırmak (varsa) ve kazıyın. İsteğe bağlı olarak, bir araya getirilmiş numune için tek bir tüp içerisinde türe özgü bağırsak tüm siteleri dört gelen hücreler bulunmaktadır.
  4. 1 de dahil olmak üzere 100 ul steril TE tamponu ihtiva eden bir steril 1.5 ml'lik vidalı kapaklı mikrosantrifüj tüpü içine kazınmış malzemenin koyun0% (ağırlık / hacim) Chelex® 100 reçinesi elde edildi.
  5. 1 dakika boyunca kuvvetli bir şekilde her bir örnek çalkalayın. Vida üst sıkıca kapalı olduğundan emin olun ve daha sonra 10 dakika boyunca bir kaynar su banyosunda inkübe.
  6. Kaynatıldıktan sonra her bir numune 1-2 dakika süre ile oda sıcaklığına soğumaya bırakın.
  7. Santrifüj 1 dakika en yüksek hızda (örneğin, ~ 10.000 xg) mikrosantrifüj kullanarak her örnek.
  8. Her Lamba tayininde şablon gerçekleştirilecek olmak Elde edilen üstte 2 ul toplayın. İsteğe bağlı olarak, çok-taraflı bir deney temin etmek üzere tek bir tüp içerisinde birden fazla bağırsak sitesi havuz.

2. Eimeria LAMBA Astar Hazırlama (Ön-deneyi)

  1. 100 tahliller için yeterli Eimeria LAMBA astar stokları hazırlayın:
    1. (Üretici tarafından belirtildiği gibi), 100 uM bir konsantrasyona kadar moleküler sınıf su ilave edilerek her bir liyofilize Eimeria lamba primeri sulandırın. Belirtilen değilse, moleküler sınıf su gerekli usin hacmini hesaplamakg her bir primerden fiziksel ve moleküler ağırlıkları.
    2. Her Eimeria türleri için ayrı 0.5 ml flip-top mikrosantrifüj tüp içine Pipet 60 ul moleküler sınıf su tahlil edilecek.
    3. Ekleme primerleri FIP BIP F3, B3, yedi türe özgü primer karışımları, bir dizi oluşturma Tablo 2'de gösterilen miktarlar kullanılarak su hedef Eımerıa türü özel LF ve LB.
    4. Kısaca vorteks sonra, astar çözüm karıştırmak mikrofuge'de darbe ve gerekli kadar dondurma.
  2. Her Eimeria türleri tahlil edilmesi için bir lamba reaksiyon MasterMix hazırlayın. Örneklerin sayısına göre Tablo 3'te gösterilen miktarlar çarpın ve bir pozitif kontrol, bir negatif kontrol ve pipetleme yedek için üç ekleyin. 0.5 veya 1.5 ml pipet flip-top mikrosantrifüj tüp.

3. Eimeria LAMBA Testi

  1. Pipet 23 ul Eimeria türe özgü Bst DNA polimeraz / LAMP bir 0'a içine MASTERMIX.5 ml mikrosantrifüj tüpü.
  2. 25 ul bir son reaksiyon hacmini hale (Bölüm 1 'de hazırlandı) 2 ul DNA şablonu ekleyin.
  3. Bir reaksiyonda (pozitif kontrol) 2 ul Eimeria türe özel genomik DNA ekleyin. Reaksiyonun (negatif kontrol) 2 ul moleküler sınıf su ilave edilir.
    NOT: Bu tür özel genomik DNA, mevcut değilse, bir önceki pozitif lamba ya da standart PCR ürünü, bunun yerine kullanılabilir.
  4. 30 dakika boyunca 62 C 'de bir su banyosunda ya da ısıtma bloğu içinde inkübe edin. Reaksiyon hemen okumak olacak değilse İsteğe bağlı, 10 dakika boyunca 80 o C ısıtılarak Bst DNA polimeraz de-aktive.

4. LAMP Testi Okuma-out

  1. Inkübasyon bitiminde kapalı ışık altında gözle her reaksiyonun rengini değerlendirmek. Negatif sonuçlar, olumlu sonuçlar gökyüzü 20 mavi görünür renkli menekşe pembe görünür.
  2. İsteğe bağlı olarak, bir Laborat içinde lamba tahlil sonucunu teyit1 x Trıs / borat / EDTA (TBE) tampon maddesi içinde bir% 2 agaroz jel kullanılarak Agaroz jel elektroforez için 1 ul DNA, jel yükleme tampon maddesi ile 5 ul LAMP reaksiyonu ürünü karıştırarak Ory (5 ul başına bir nükleik asit leke kullanılarak önceden boyanmış 50 mi agaroz). Fragman boyutu hesaplama izin jel 1 şeritli bir 1Kb moleküler boyutta DNA merdiveni 5 ul ekleyin.

Representative Results

Tahlil doğrulama

Doğrulama esnasında, her Eimeria türe özgü lamba deney, bir ana kontrol olarak tavuk, hem de tavuk genomik DNA enfekte yedi Eimeria türü temsil saf DNA örnekleri oluşan bir panel kullanılarak test edilir. Agaroz jel elektroforezi her deney çözmek için kullanılan ve herhangi bir ana çapraz reaksiyon 18 mutlak türlere göre gösterilmiştir. Daha sonra, bir on misli seri seyreltme serileri genomik DNA, bir ila on genom kopyalarının 18'in bir deney hassasiyet limiti ortaya saflaştırılmış Eimeria tenella kullanılarak hazırlandı. Üst sınır yok, en yüksek konsantrasyon (100.000 genom kopya) 18 olmak üzere pozitif kadar elde edilen sonuçlara ve tespit edilmiştir.

Alan örnekleri ile Uygulama

Eimeria testleri için alınan örnekler p bir sonucu olarak itlaf ölü bulundu tavuklardan elde edilmesi olasıdıroor sağlık ya da bir ila üç olası örneklem büyüklüğü gösteren, sentinel sağlık gözetimi için itlaf zaman rutin bir parçası. Bir gözetim programının bir parçası olarak ABD broyler çiftliği toplanan üç kuş Test bağırsak örneklerinin üç set vermiştir. Her Eimeria türleri (Tablo 1) için tercih edilen bir bağırsak sitesi öncelik, türe özgü lamba deneyleri uygulanmasını hedefleyen bir göstergesi olarak mavi hydroxynaphthol (Şekil 2A) ile test edilen tüm kuşlarda eimerian enfeksiyonun görsel tespitine olanak tanıdı. hydroxynaphthol mavi kullanırken olumsuz LAMP reaksiyonu ile elde rengi pembe mor arasında değişir, ama her zaman pozitif bir sonuç elde mavi ayrıdır yapabilirsiniz. Agaroz jel elektroforezi ile teyit benzer sonuçlar (Şekil 2B) elde edilmiştir. Alan uygulaması sırasında kullanıcı yedi türlere karşı tam ekran uygulamak için tercih, ya da öncelik yalnızca türlerin hedefleyebilirÖnemli veya bilinen çiftlikte dolaşan veya çevredeki edilecek.

Eimeria oluşumu herhangi bir yeni test basitlik ihtiyacını vurgular için PCR-temelli yaklaşımların yetersizliği teşhisi olarak benimsenmesi. LAMP PCR daha basit hazırlık ve işleme sunarken, kuş başına birden fazla bağırsak sitelerini test etmek şartı kırıcı kalır. Bir veya daha fazla lamba tahlilleri ile test edilebilir kuş başına tek havuza DNA örneği, üretimi, daha çekici olması muhtemeldir. Her bağırsak Alanı ayrı ayrı işlendi olduğu gibi aynı sonucu (Şekil 2, yedi lamba deneyleri ile test edilmesi için, Tablo 1 'de tarif edilen DNA hazırlanmadan önce bir araya getirilmiş özel bağırsak sitelerinin yolunun her birinden toplanan malzemesini temsil eden, kuş başına bir araya getirilmiş numune Resim işleme ) Şekil 3 ile karşılaştırıldığında.

Şekil 1, Tavuk bulaştırmak Eimeria tür parazitlerin LAMP tespiti için Şekil 1. Bağırsak örnekleme siteleri. Her Eimeria türlerinin hedeflenen bağırsak bölgeleri E. (noktalı siyah çizgiler arasındaki sayısına göre belirtilen örnekleme tercih siteleri ile, renkli çizgilerle vurgulanır acervulina: Sarı / 1, E. brunetti: pembe / 2, E. maxima: mavi / 3, E. mitis: kırmızı / 5, E. praecox: turuncu / 4 E. necatrix yeşil / 6 ve E. tenella: gri / 7). Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 2,
Eimerian enfeksiyon Şekil 2. LAMBA tanı froBir gök mavisi tepki olumlu oldu ve pembe reaksiyona mor negatif oldu, ve (B) agaroz jel elektroforezi burada m, üç ticari etlik tavuk. LAMBA reaksiyonları, (A) kullanarak mavi hydroxynaphthol çözüldü. örneklenmiş bağırsak siteler gibi her parazit türleri için Tablo 1'de gösterilmiştir. A = E acervulina, B = E. brunetti, Ma = E. maksimum Mi = E. mitis, N = E. necatrix, p = E. praecox ve T = E. tenella. Şerit 1 GeneRuler 1Kb DNA merdiveni içeriyordu. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Eimerian enfeksiyon Şekil 3. LAMP tanı üç ayrı ticari etlik tavuk örnekleri toplanmış kullanarak. LAMBA REACları bir gök mavisi tepki olumlu oldu ve pembe reaksiyona menekşe negatif hydroxynaphthol mavi kullanılarak çözüldü. A = E acervulina, B = E. brunetti, Ma = E. maksimum Mi = E. mitis, N = E. necatrix, p = E. praecox ve T = E. tenella. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Örnek sitesi Eimeria türleri tahlil (büyük olasılıkla)
Duodenal (D) E acervulina, E. praecox
Jejunum / ileum * (J / I) E maxima, E. necatrix
Çekumu (C) E. necatrix, E. tenella
Terminal ileum (TI) E. brunetti, E mitis Bir araya toplanan numune (P) E acervulina, E. brunetti, E maxima, E mitis, E. necatrix, E. praecox, E tenella

Aday Eimeria türleri deneyleri Tablo 1. Bağırsak bölgeye özgü bir seçim. Bölgelerin seçimi, Şekil 1 'de gösterildiği gibi her bir Eımerıa turu için değişir numune için. Toplanmış örnek daha sonra DNA hazırlanması için bir araya getirilmiş dört özel sitelerde toplanan malzeme içerir.

Astar * Hazır konsantrasyonu (uM) Hacim (ul)
Su - 60
İleri İç Astar (FIP) 100 40
Geriye İç Primer (BIP) 100 40
İleri Dış Astar (F3) 100 10
Geriye Dış Astar (B3) 100 10
Döngü İleri (LF) 100 20
Geriye Döngü (LB) 100 20
Toplam 200

LAMP astar ön karışımın Tablo 2. Hazırlık. LAMP için bir astar ön karışım hazırlamak için gerekli bileşenleri ve oranlar. Gösterilen Ciltler 100 LAMBA reaksiyonlar içindir. * Malzeme gösterildiği gibi Astar kimlikleri Barkway ark (2011) 18.

Stok kons n Nihai reaksiyon kons n Reaksiyon başına Hacim (ul)
DDW - - 10.1
ThermoPol tampon 10 x 1 x 2.5
MgSO 4 100 mM 2 mM 0.5
Primer karışımı * Tablo 2 2.5
dNTP 25 mM 400 um 0,4
Betain 5M 1M 5
Hydroxynaphthol mavi 3mM 120 uM 1
Bst DNA polimerazı 8000 U / ml 8 U 1
Toplam 23

Bir LAM Tablo 3. HazırlıkP reaksiyon masterkarışım. * Eimeria türe özgü.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics