Системная бактериальная инфекция и иммунная Фенотипы обороны в

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Плодовой мушки дрозофилы является одним из ведущих модельных организмов для изучения функции и эволюцию иммунной защиты. Многие аспекты врожденного иммунитета сохраняются между насекомых и млекопитающих, а с дрозофилы могут быть легко генетически и экспериментально манипулировать, они являются мощным для изучения функции иммунной системы и физиологические последствия болезни. Процедура продемонстрировали здесь позволяет инфекции мух путем введения бактерий непосредственно в полость тела, минуя эпителиальные барьеры и более пассивные формы защиты и позволяет сосредоточиться на системной инфекции. Процедура включает в себя протоколы для измерения скоростей принимающей смертности, системной нагрузки патогена, и степень индукции иммунной системы хозяина. Эта процедура инфекция недорогой, надежный и количественно повторяемые, и может быть использован в исследованиях функциональных генетики, эволюционной истории жизни и физиологии.

Introduction

Плодовой мушки дрозофилы является одним из ведущих модельных организмов для изучения функции и эволюцию иммунной защиты. Дрозофилы являются недорогой и простой в тылу, очень поддаются экспериментальной манипуляции, и подкреплены обширным научным сообществом, которая сложилась широкая массив исследовательских инструментов. Многие аспекты врожденного иммунитета сохраняются между насекомых и млекопитающих, в том числе передачи сигнала, опосредованного Toll-подобных рецепторов и NF-KB факторов транскрипции, семья ЯК / STAT сигнализации и JNK ответов пути. 1,2 функция этих генов и путей может быть запрошены в D. MELANOGASTER помощью мутаций или РНК-интерференции нокдаун, что увеличение или уменьшение пути деятельности. 3 - 6 Кроме того, дрозофилы могут быть использованы для изучения физиологических последствий инфекции и заболевания, в том числе в контексте эволюционной теории истории жизни 7.- 9 Все такие исследования, однако, зависит от способности надежно инфицировать экспериментальных мух при определенных условиях обработки. Описанная здесь процедура представляет методологическую основу для предоставления надежных и воспроизводимых бактериальных инфекций в дрозофилы, а затем измерения тяжести инфекции и количественной оценки иммунного ответа.

Дрозофилы могут быть, естественно, и экспериментально зараженных широкого спектра патогенных микроорганизмов и паразитов, в том числе бактерий, грибков, вирусов, нематод и паразитоид ос. Текущий протокол ориентирован на достижение системной бактериальной инфекции. Много различных бактерий может использоваться, чтобы заразить мух, и выбор экспериментатора должны быть основаны на точных научных вопросов, задаваемых. Например, клинические изоляты человека могут быть использованы для изучения бактериальных механизмов вирулентности 10, или экологически соответствующие изоляты могут быть preferreд эволюционного исследования. 11 Некоторые бактерии являются возбудителями компетентные D. MELANOGASTER, пролиферирующих на инфекции и вызывая хозяина болезнь или смерть. Другие бактерии эффективно управляется иммунной системы хозяина и очищены в течение нескольких дней. В этой демонстрации, Providencia rettgeri будет использоваться в качестве пролиферативного патогена, что может привести к хост смертности и сохраняется в живых хозяев. Кишечной палочки будет использоваться в качестве не патогена, который очищается от иммунной системы хозяина.

Заражение будет установлено путем введения бактерий непосредственно в полость тела лету. Этот подход обходит эпителиальные барьеры и защитные поведения, позволяя расследование системной инфекции независимо от естественного режима передачи. Есть два основных метода для создания экспериментально системной инфекции. В-первых, а nanoinjector и вытащил стеклянный капилляр иглы используются, чтобы ввести точное числоБактерии в лету. Этот метод имеет преимущества позволяет большой динамический диапазон инфекции дозах и бытия количественно высокой повторяемостью. Второй подход заключается в предоставлении инфекции с септическим укол. Этот подход имеет преимущества быть быстрым и не требует специального оборудования. После инфекции установлено, становится возможным измерить системную нагрузку патогенных микроорганизмов, хоста смертности и индуцируемый активности иммунной системы. Конечно, любое число дополнительных фенотипов теоретически может быть измерена в инфицированной D. MELANOGASTER, в том числе пост-инфекции плодовитость 12, способность к обучению 13 метаболического статуса 14 или практически любой другой признак, что можно себе представить.

Protocol

1. Сбор и подготовка Мухи

  1. Задняя Д. MELANOGASTER под желаемых условий эксперимента. Позаботьтесь, чтобы не переполнять мух в период выращивания и убедитесь, что личинки плотности согласуются по лечения, так как условия окружающей среды во время личиночной стадии может глубоко затронуть иммунной защиты фенотипы во взрослой стадии. 15
  2. Сбор экспериментальных мух 0 - 3 дней после вылупления из куколки случае и передать их на свежую среду.
  3. Дом собранные мухи на желаемой температуры (температура между 22 ° C и 28 ° C, как правило, подходят), пока они не будут в возрасте 5 - 7 дней после вылупления.
    ПРИМЕЧАНИЕ: Это позволяет достаточно времени для мух, чтобы завершить метаморфоз и стать зрелым взрослым, но задолго до того, начинается старение.
  4. Сортировать нужное количество мух в отдельном флаконе до заражения, снова стараясь избежать переполненности.
    ПРИМЕЧАНИЕ: Только мале инфицированы в этой демонстрации, но в равной степени можно заразить самок, используя процедуру, описанную.

2. Культура и подготовка бактерии

  1. Подготовка мастер-пластины выбранных бактерий, по крайней мере за 2 дня до инфекции. Подряд бактерии из 15% глицерина складе хранить неопределенно долго при -80 ° С. Храните мастер пластину на 4 ° C в течение 2 недель. Всегда полоса мастер пластины непосредственно из замороженного глицерина складе. Избегайте серийный прохождение бактерий от пластины к пластине, а повторное прохождение в культуре может привести к бактериям развиваться ослабленный вирулентность.
    ПРИМЕЧАНИЕ: Этот пример использует Провиденсия rettgeri и кишечной палочки.
  2. Используйте следующую процедуру, чтобы подготовить бактериальной суспензии для инъекций.
    1. Выращивают культуру в 2 мл бактерий путем инокуляции стерильной среды с одной колонии, выделенной из основной пластины. Вырастить бактерии в стационарной фазе (например, ПРИМЕЧАНИЕ: Оба П. rettgeri и E.coli, хорошо растут в бульоне Luria при температуре от 20 - 37 ° С при осторожном встряхивании.
    2. Как только культура достигла стационарной фазы, осторожно гранул клетки от прибл. 600 мкл культуры в настольной центрифуге (3 мин при 5000 мкг), отбросить супернатант, и ресуспендируют бактерий в ок. 1000 мкл стерильной фосфатным буферным раствором (PBS; 137 мМ NaCl, 2,7 мМ KCl, 10 мМ Na 2 PO 4, 1,8 мМ KH 2 PO 4, рН 7,4).
    3. Развести ресуспендировали клеток в стерильной PBS для достижения оптической плотности (OD), подходящий для бактерии используются, измеренной на спектрофотометре как поглощение при 600 нм. Используйте этот подвеску, чтобы заразить мух.
      ПРИМЕЧАНИЕ: 600 = 0,1 или 1,0 соответствует соответственно примерно 10 и 8 10 9 Провиденсия rettgeri или E. палочка на мл. Потому что оба живутй мертвые бактерии способствуют оптической плотности, важно, чтобы собрать культур в начале стационарной фазы, прежде чем бактериальные трупы накапливаются и искажают отношения между оптической плотностью и количеством жизнеспособных бактерий, введенных во время инфекции.

3. заразить Мухи

Примечание: В дрозофилы иммунитета зависит от суточного ритма, очень важно, чтобы выполнить инфекции в подобной времени суток через экспериментальных повторов 16.

3.1) Использование Nanoinjector

  1. Подготовьте стеклянные иглы для инфекции.
    1. Подготовка стекла иглы, потянув боросиликатного стекла капилляр с помощью микропипетки съемник.
    2. Использование щипцов, разорвать кончик иглы, чтобы создать отверстие приблизительно 50 мкм диаметром, чтобы выброс жидкости.
  2. Соберите форсунку.
    1. Поместите уплотнительное кольцо круглого сечения, а затем белый SpAcer (большой вмятина наружу) на металлической поршень.
    2. Заполните стеклянную иглу с минеральным маслом с помощью шприца с иглой 30 G.
    3. Поместите заполненную стеклянной иглу через цангу, а затем поместить большее уплотнительное кольцо вокруг его основания, около 1 мм от тупого конца иглы.
    4. Слайд иглу на металлическую поршня и не аккуратно заверните цанги до упора.
    5. Извлечение большую часть минерального масла из инжектора, но убедитесь, что все еще существует небольшой объем масла в иглу, чтобы действовать в качестве барьера между инжектором и бактериальной суспензии. Убедитесь, что нет воздушных пузырьков внутри минерального масла или бактериальной суспензии, или между двумя жидкостями.
    6. Установите форсунку до желаемого объема для инъекций (между 9 и 50 NL NL).
  3. Создание ранив управления.
    1. Заполните иглу инжектора стерильным PBS аккуратно вставив кончик капиллярной иглы в трубке СМИ и Pressiнг кнопку "Заполнить" на форсунки.
      Примечание: стерильными средами рост бактерий также могут быть использованы в ранив контроль, если эксперимент требует инъекцию бактерий, взвешенных в их среде для выращивания. Однако, поскольку бактериальные питательные среды содержат компоненты, которые могут стимулировать иммунную систему или другие эффекты на хосте, инертный носитель, такой как PBS, является предпочтительным.
    2. Анестезировать нужное количество мух под световым потоком CO 2.
    3. Вводите мух в передней части живота на вентролатеральной поверхности стерильной PBS.
      Примечание: Можно также вводить летит на других сайтах, таких как sternopleural пластины грудной клетки, но важно, чтобы сохранить место инъекции последовательное течение каждого эксперимента 17.
    4. Поместите инъекционные мух в свежих флаконах с новой средой, укладка флаконов на их стороне, пока все мухи оправились от анестезии, чтобы предотвратить мух от застревали в пищу. <ш /> Примечание: Рекомендуется вводить управляющие PBS мух перед инъекцией бактерии экспериментальных мух так же иглы могут быть использованы как для лечения. Это не всегда можно будет использовать тот же иглу в течение всего эксперимента. В этом случае, может быть желательно, чтобы записать котором игла была использована, с которой летит и включить идентичность иглы в качестве экспериментальной фактор статистического анализа.
  4. Вводите бактериальной патогена.
    1. Извлечение оставшейся стерильный носитель от инжектора и пополнить ту же иглу с бактериальной суспензией.
    2. Повторите описанную выше процедуру (3.1.3), в настоящее время инъекционных мух бактериальной суспензии, полученной в процедуре 2.2.

3.2) с септическим укол

  1. Подготовьте иглу для прокалывания.
    1. Растопить конец микропипетки наконечник 200 мкл и вставьте 0,15 мм насекомых minutien штифт в расплавленной пластмассы. Разрешить пластик, чтобы укрепить суч, что штифт удерживается на месте с приблизительно 0,5 см штифта, выступающих из пластика.
  2. Создание ранив управления.
    1. Анестезировать нужное количество мух под световым потоком CO 2.
    2. Укол мух в sternopleural пластины грудной клетки с иглой, избегая вложений сайты крыльев и ног. При необходимости, осторожно удалить мух от minutien контактный использованием мягких щипцы.
      Примечание:. Можно также, чтобы проколоть летит на других сайтах, таких как передней брюшной полости на поверхности вентролатеральной, но важно, чтобы сохранить место инъекции последовательное течение каждого эксперимента 17 Укалывание через кутикулу живота имеет тенденцию быть более труднее, чем прокалывание грудной клетки и, следовательно, реже.
    3. Поместите кололи мух в свежем флакон с новой летучей среды, укладка флакон на его стороне, пока все мухи были извлечены из анестезии, чтобы предотвратить мух от ВЕпридя застрял в пищу.
  3. Представьте бактериальной инфекции.
    1. Анестезировать нужное количество мух под световым потоком CO 2.
    2. Укол друг летать в том же месте, управления СМИ, опуская кончик пальца в бактериальной суспензии, полученной в порядке, прежде чем колоть 2.2 каждый муху.
    3. Поместите кололи мух в свежем флакон с новым лету среды, закладывая флакон на его стороне, пока все мухи не оправились от анестезии, чтобы предотвратить мух от застревали в пищу.

3.3) Оценка инфекционная доза Поставляется

  1. Инфекция набор мух, как описано выше, в любом порядке, 3.1 или 3.2, только вместо возвращения мух в пищевой флакон, чтобы оправиться от наркоза, поместите каждый летать в микроцентрифужных трубки на льду.
  2. Добавить 250 мкл PBS в каждую пробирку и гомогенизируют мух либо с помощью пестика или шарик било. </ LI>
  3. Плита гомогената на агар пластины LB, либо с помощью спиральной Plater или серийное разведение.
    1. К пластине с помощью последовательного разбавления, передавать каждый мухи гомогената к первому ряду 96-луночного планшета.
    2. Заполните каждую лунку остальных строк с 90 мкл PBS.
    3. Используя многоканальную пипетку, возьмите 10 мкл из первого ряда, содержащего летать гомогената и обойтись во второй ряд.
    4. Внесите вверх и вниз, по крайней мере 10 раз, чтобы тщательно перемешать, а затем принять 10 мкл и перенести к третьему ряду. Повторите эту процедуру, используя оставшиеся строки.
    5. Начиная с нижнего ряда (наиболее разбавить бактерий подвески), использовать многоканальную пипетку принять 10 мкл из каждой лунки и депозит на LB пластины, заботясь о том, что образцы отпускаются в виде дискретных точек, которые не касаются друг друга. Повторите, пока все лунки не были отобраны образцы из каждой строки, выдачи их в порядке убывания разбавления на LB пластины. Оставьте пластину при комнатной температуре до тех пор, пятна не полностью всасывается в LB пластины.
      Примечание: Сушка LB пластины в течение нескольких дней при комнатной температуре перед использованием рекомендуется, чтобы гарантировать, что жидкость быстро всасывается, минимизировать вероятность случайного контакта между образцом пятен.
  4. Инкубируйте пластины O / N, заботясь, чтобы не зарастают пластины так колонии остаются маленькими и дискретные.
    Примечание: В зависимости от средой роста бактерий и используемой температуры инкубации, колонии, полученные из эндогенных микрофлоры кишечника мухи в конечном итоге может появиться на пластине. Тем не менее, большинство бактерий, используемых для патогенных инфекций растут гораздо быстрее, чем микрофлоры кишечника на LB агаре при 37 ° С.
  5. Удалить пластины из инкубатора, когда экспериментальные бактерии выросли видимые колонии (обычно 8 - 12 ч), но прежде, чем Drosophila микрофлоры кишечника колонии появляются (примерно 36 ч). Для медленно растущих экспериментальных бактерий, использовать селективныйантибиотик в агар LB, чтобы удалить любые колоний от микрофлоры кишечника.
  6. Подсчитайте количество колоний для каждого гомогената.
    1. Для спиральных пластин, подсчет колоний, которые растут с использованием автоматического счетчика колоний, которые можно оценить бактериальной нагрузки на мл гомогената на основе количества и положения колоний на пластине.
      Примечание: Спиральные рассчитывает наиболее точным при бактериальной концентрации в диапазоне от 5 × 10 2 до 5 · 10 4 бактерий на мл.
    2. Для спот пластин вручную рассчитывать колонии для каждой из любого лету разведение содержит 30 - 300 колоний и подсчитать количество бактерий на миллилитр гомогената оригинальной.

4. Охарактеризуйте выживаемость инфекции

  1. Анализ смертности после инъекции.
    1. Поместите инфицированных мух и раненых управления в свежих флаконах и поддерживать в инкубаторе при требуемой температуре (25 ° C с 12:12 осветиHT: темно цикл рекомендуется). Не ставьте больше, чем 15 мух в одном флаконе, как она становится трудно рассчитывать более чем на 15 жизни мух.
    2. Подсчитайте количество живых и мертвых мух каждый день или чаще, если это необходимо.
    3. В целях поддержания качества продуктов питания, флип мух в новой пищи на регулярной основе.
      1. Если флакон содержит только мужчин, передавать их на свежие флаконах каждые три дня. Если флакон содержит самок, передать свежих флаконах каждые два дня, потому что личиночной потомство разжижения пищи, увеличивая риск того, что взрослые мухи может застрять и в результате завышенных показателей смертности из-за инфекции.
  2. Статистического анализа данных.
    1. Выживание земля в виде кривой Каплана-Майера, которая указывает вероятность того, что человек будет выжить измеренному после инъекции времени точки. 18 Для кривых выживания, которые не пересекают, выполнять парные сравнения с использованием лог-рангового TEST (также называется каминные Кокс тест) или выполнять более сложные анализы, используя модели пропорциональных рисков Кокса, который может включать несколько факторов и их взаимодействий. Для кривых выживания, которые пересекают, выполнять анализ Кокса расслаивается. 17

5. Анализ бактериальной нагрузки Post-инфекции

  1. Измерьте бактериальной нагрузки.
    1. В заданного времени после инъекции, повторить процедуру, используемую для оценки инфицирующей дозы для определения бактериальной нагрузки по ходу инфекции (см протокол 3.3).
      Примечание: При использовании спиральной Plater, разбавленные гомогенатов, так что бактериальную суспензию находится в пределах от 1000 - 100000 на мл бактериальной.
  2. Анализ данных.
    1. Если бактериальная нагрузка не является нормальным, либо преобразовать данные, чтобы лучше приблизить нормальное распределение или анализировать данные, используя непараметрический статистический анализ (например, тест Манна-Уитни). Используйте анализ Бокса-Кокса для Fинд оптимальное преобразование; натуральный логарифм или базу -10 преобразования журнала часто эффективны. 19
    2. Если данные достаточно нормально распределены, и есть только два процедуры их контрастные, выполнить т Испытайте для определения привести два метода лечения в различных средних бактериальных нагрузок. Если есть несколько экспериментальных переменных или других потенциально прогностические факторы, использовать дисперсионный анализ (ANOVA) для определения, какие факторы являются значимыми предикторами бактериальной нагрузки. 19

6. Анализ активации транскрипции генов иммунной системы

  1. Чтобы визуализировать грубо иммунную активацию после заражения, заражают трансгенных мух, которые экспрессируют зеленый флуоресцентный белок (GFP) под контролем промотора из противомикробного пептида гена, как описано выше. 18
  2. Просмотр зараженных мух под флуоресцентным микроскопом с поддержкой; Индукция GFP должно стать visibле в жировом теле в течение первых 6 - 10 часов после заражения.
  3. Для более точного количественного определения иммунной активации, используйте количественный ПЦР на кДНК шаблон (Qrt-PCR) для измерения обилие противомикробных гена пептид-транскриптов.
    ПРИМЕЧАНИЕ: выражение иммунных генов может быть измерена в любое время после (или до) инфекции. Вообще говоря, индукция экспрессии генов иммунной начинается примерно 4 часа после инъекции и увеличивается в течение следующего 24 часа.
    1. Обезболить мух, используя CO 2.
    2. Поместите 15 мух в пробирке для каждой экстракции РНК.
      ПРИМЕЧАНИЕ: Рекомендуется, чтобы собрать по меньшей мере, три одинаковых образцов для каждого условия лечения.
    3. Экстракт РНК от мух и генерировать первой нити кДНК с использованием любой из ряда стандартных процедур или коммерческих наборов. Магазин РНК при -80 ° С. Магазин кДНК при -20 ° С в течение периодов в несколько недель, а при -80 ° С в течение длительного хранения. До экстракции РНК, магазин ележит при -80 ° С.
    4. Выполнение количественной ПЦР (КПЦР) на генов-мишеней, представляющих интерес с использованием кДНК в качестве матрицы. В Таблице 1 для последовательностей праймеров для амплификации генов антибактериальных пептидов Diptericin A, Drosomycin, дефенсина, Attacin A и Metchnikowin, а также ген rp49 управления уборка (также известный как rpL32).
      ПРИМЕЧАНИЕ: Гены, кодирующие антимикробные пептиды Diptericin А и Drosomycin обеспечивают очень хорошие показания Д. MELANOGASTER иммунной активности, вызванной, главным образом, через IMD и Toll путей, соответственно. Для того, чтобы контролировать для образца к образцу изменчивости доходности РНК и эффективности обратной транскрипции, стандартизировать записанный экспрессию генов-мишеней против гена ссылка домашнего хозяйства, экспрессия которого не должна измениться с инфекцией, таких как rp49 (также известных как RPL 32).
    5. Анализ данных. <ол>
    6. Для грубом приближении различий экспрессии, вычислить отношение (SQ) значения начальной величины, полученной из гена испытаний (например, Diptericin) по отношению к значению SQ полученной от контрольного гена (например, rp49) для каждого образца (в пересчете на SQ - DPTA / SQ - rp49). Масштаб этих коэффициентов к базовой терапии управления, например, неинфицированных контроля обработки. Произвольно установить контроль уровня экспрессии, равный 1,0, и визуализировать экспериментальные процедуры, как изменения относительных сгиба. Оценить значение SQ для каждого гена против стандартной кривой, полученной из серии разведений известных-количество кДНК.
      ПРИМЕЧАНИЕ: Статистический анализ соотношений может быть сложным, поэтому такой подход лучше для быстрого приближения, чем для тщательного анализа. Если эффективность ПЦР низкий, разрабатывать новые праймеры для улучшения кинетики ПЦР, если это возможно. Для КПЦР реакции с почти идеальной эффективности (объявлениеoubling продукта ПЦР в каждом цикле), пороговый цикл (С Т) может быть заменен на значение SQ.
    7. Для простых экспериментов с оптимально эффективного усиления, данные могут быть проанализированы с помощью метода ΔΔC T. 19 Для каждого образца, вычтите значение С Т контрольного гена (например, rp49) от C T гена испытаний (например,., Diptericin ) с получением & delta; C T. Затем вычесть delta; C T от исходного контроля со стороны delta; C T для каждого экспериментального образца, получая значение ΔΔC T для каждого образца; это ΔΔC Т свидетельствует относительных различий в уровнях экспрессии генов между курсами лечения, где 2 (-ΔΔCT) аппроксимирует раза изменение экспрессии.
      Примечание: Этот анализ может плохо неверная оценка раскладочное изменение экспрессии гена-мишени, если ПЦР либо гена испытаний или ссылкиген имеет низкую эффективность.
    8. Для наиболее тщательного анализа, проводить анализ отклонений (ANOVA) с использованием оцененного экспрессию гена испытаний (например, Diptericin A) в качестве переменной отклика и расчетное выражение гена управления (например, rp49) и других экспериментальных факторов в качестве независимых переменных.
      ПРИМЕЧАНИЕ: Этот подход является относительно устойчивым к неэффективности в ПЦР-амплификации и позволяет анализ более сложных экспериментальных конструкций.

Representative Results

В этом разделе представлены результаты, которые могут быть получены после бактериальной инфекции дрозофилы. 1 показано, что инфицирование доза изменяется в зависимости от оптической плотности бактериальной суспензии, используемой для инъекций, и что доза может быть доставлен надежно оценена путем гомогенизации и обшивки летит сразу после инъекции , Как показано на рисунке 2, различные патогены могут вызывать различные уровни принимающей смертности (фиг.2А) и принимающей смертности может быть дозозависимое (фиг.2В). Важно отметить, что этот протокол позволяет различные виды инфекций должны быть достигнуты: Провиденсия rettgeri может вызвать хроническое, суб-смертельная инфекция, которая сохраняется в течение 20 дней и более (рис 3а). Тем не менее, другие бактерии, такие как Escerichia палочки в основном будут удалены принимающей лету в течение шести часов после заражения (рис 3b). Индукция иммунной SYSTEM может быть оценена с помощью выделения РНК и последующей Qrt-PCR антибактериальных пептидных транскриптов (фиг.4А и Б). Аналогично, но менее количественно, мухи выражают GFP под контролем антимикробного пептида промоторов генов может быть использован для визуализации индукции иммунной системы (фиг.4С).

Фигура 1
. Рисунок 1: Определение инфекционная доза Мухи вводили 50 NL бактериальных суспензий, охватывающих широкий круг оптических плотностей (0,0001 - 0,05). Мухи были немедленно гомогенизировали и высевали для определения количества бактериальной введены путем инъекции. Первоначальная бактериальная нагрузка сильно коррелирует с начальным ОД вводят (R 2 = 0,96)

Рисунок 2
(А) Дикие мухи типа вводили приблизительно 5000 бактерий из одного из трех разных видов. Скорость принимающей смертности в значительной степени зависит от вида бактерий, используемых для инфекции. (B) Тип Дикие мухи вводили в трех различных дозах Enterococcous аесаИз - 50, 500 и 5000 бактерий на лету. Мухи умирают быстрее при инфицировании выше инфекционных доз (C) иммунной системы и ее мутант дикого типа изогенных линии управления вводили примерно 500 Burkholderia cepacia. Попарно сравнение Войти ранга показывает, что дикого типа мухи выживает инфекции значительно лучше, чем мутанта (χ 2 = 59,02, DF = 1, р <0,0001).


Рисунок 3: бактериальной нагрузки. После инъекции мух вводили примерно (A) 5000 P. rettgeri (Б) 3400 Е. палочка. Бактериальной нагрузки была определена сразу же после инъекции и в различных последующих моментов времени. Каждая точка данных представляет собой бактериальную нагрузку одной лету. Е. палочка быстро очищается от зараженных хостов в то время как P. rettgeri сохраняется в течение оставшейся жизни хозяина ,.

Рисунок 4
Рисунок 4: Индукция экспрессии генов иммунной после инъекций. (A) Мухи вводили 50 нл Р. rettgeri или стерильной PBS, либо в брюшной полости или грудной клетки, или остались в стороне от unmanipulated CO Diptericin была определена с использованием QRT-PCR. (A) Уровни экспрессии графически как отношение Diptericin транскрипт к rp49 транскрипта и масштабируется таким образом, что управление СО 2 определен как имеющий уровень экспрессии 1. бары представляют собой среднее и стандартную ошибку коэффициентов из каждого состояния (п = 4). Уровни (Б) Экспрессия графически в виде 2 ΔΔCT со средним значением С Т от СО 2 мух управления эстезия, используемых в качестве стандартного неиндуцированном состоянии. Столбики представляют среднее и стандартную ошибку ΔΔC T от каждого состояния (п = 4). Хотя нет никакой разницы в индукции транскрипта из-месте инъекции, сравнение панели А и В показывает, как метод ΔΔC Т может приводить к завышению уровня индукции. ) Мухи выражая GFP под контролем промотора Diptericin вводили 50 нл Р. rettgeri (OD = 0,1), а затем отображены 7 дней. GFP панель показывает экспрессию GFP в брюшной жир тела зараженных мух, указывая активации Diptericin промоутер в бактериально-инфицированных мух, но не СМИ впрыском управления.

Ген Вперед Обратный
rp49 (также называется rpL32) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Дефенсина 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

Таблица 1: Праймеры для Qrt-PCR.

Discussion

Описанная здесь процедура дает строгий и качественный инфекции дрозофилы. Изображенные примеры, прежде всего, направлены на инфекции Провиденсия rettgeri и Е. палочка, но протокол является весьма гибкой и может быть применен к инфекции с различных бактерий в диапазоне условий выращивания хост и техническое обслуживание.

Детали оптимального экспериментальный подход будет зависеть от бактерии, используемой для инфекции, генотипа хозяина, и общих условий эксперимента. Настоятельно рекомендуется пилотного тестирования любые новые экспериментальные условия до начала более амбициозные проекты. Хорошая отправная точка, чтобы проверить три инфекции дозы в диапазоне 100-кратным. Высоко вирулентные патогены часто лучше представлены на очень низких инфекционных доз, порядка 10 - 100 бактериальных клеток на лету. Более умеренные патогены могут быть введены в более высоких дозах около 1000 бактерий на FLу, и не-патогены могут быть введены в дозах до 10000 бактерий на лету. Это часто полезно определить кинетику новых инфекций путем отслеживания патогена нагрузку, хост смертности, и деятельность иммунной системы на продольной временных рядов. Поскольку измерение патогена нагрузки и экспрессии генов хозяина разрушающие анализы, надо заразить различных мух в начале эксперимента для каждой временной точки, которая должна быть измерена.

При принятии решения, следует ли использовать укол или микрокапиллярных основе инъекции, важно отметить, что преимущества и ограничения для каждого подхода. Капиллярная впрыска вводит объем жидкости в лету, что обе незначительно увеличивает давление тургора и вводит солей или других молекул, которые, суспендированные или растворенные в носителе. Инъекции капиллярной также требует доступа к инъекции объекта или приобретение необходимого оборудования. не Септик укол булавкой не требует специального оборудования и вводитнезначительные СМИ в лету, и, как правило, более эффективны для заражения большого количества мух. Тем не менее, укол инфекции не позволяют точно контролировать дозу инфекции, что может быть достигнуто с капиллярной инъекции. Настоящий Протокол сосредоточены на инжекционного устройства, которое механически регулирует объем впрыска, но существуют также системы впрыска на основе дискретных импульсов сжатого воздуха. 20,21 Это, как правило, дороже, чем аппарат признакам здесь и требует калибровки воздушного импульса для каждого игла для того, чтобы обеспечить устойчивые объемы инъекций.

Существует значительная дискуссия, но очень мало данных о том, как мухи стали системно инфицированных бактериями в дикой природе. Некоторые исследователи постулируют, что большинство природных инфекций происходят, когда дрозофилы глотать патогенные бактерии и бактерии впоследствии удалось избежать кишку, чтобы установить системные инфекции. Тем не менее, есть очень FeW бактерии, известные, чтобы иметь возможность пересечь кишечник D. MELANOGASTER, и те, которые имеют эту способность очень смертельной для мух 22,23. Альтернативная теория, что летит регулярно поддерживать кутикулы повреждения через бегство от неудачных попыток хищничества или нападения эктопаразитарными клещей. Эта гипотеза подтверждается частым сбора дикого D. MELANOGASTER подшипник меланизации пятна, которые свидетельствуют о исцелил раны (неопубликованные наблюдения). Клещи, как было показано для передачи бактериальных инфекций у дрозофилы 24 и раны, оставленные клещей может быть вторичной инфекции бактериями в медоносных пчел 25. Тем не менее, частота в природе клещей-приводом или иначе оппортунистической инфекции в D. MELANOGASTER через кутикулы нарушений не известно. Протокол, описанный здесь, позволяет введение бактерий непосредственно в гемолимфе через количественного инъекции в обход каких-либо эпителиальные барьеры или поведенческие IMMUщества. Методы для кормления патогенных бактерий D. MELANOGASTER были описаны в Vodovar и др. 22 и Nehme и др. 23.

Многие бактерии представляют энтомопатогенные мало или вообще не человеческое риск для здоровья, что позволяет исследователям работать с ними удобно. Кроме того, очень немногие бактерии имеют способность инфицировать дрозофилы при контакте без вмешательства при, так что риск "эпидемия" распространения бактериальной инфекции через лаборатории через загрязненных поверхностей или бежали мух, как правило, очень низкий. Тем не менее, желательно, чтобы гарантировать, что адекватные меры по сдерживанию в месте, чтобы предотвратить зараженные мух от побега и отбить любой избежал мух. Лаборатория должна быть оборудована на биологическом уровне безопасности соразмерно, что возбудителей используются, и должны быть использованы стандартные передового опыта в области микробиологии.

Экспериментальная infectiпо методу, описанному здесь позволяет инфекции дрозофилы с любой дозе произвольной бактерии. После инфекции было установлено, что это просто для измерения кинетики бактериальной пролиферации или зазор, чтобы отслеживать хоста смертности, и для анализа индукции иммунной системы хозяина. Зараженные мухи могут быть легко применены и другие фенотипические анализы, в том числе испытаний физиологических функций, которые могут форму или иметь форму инфекцией. Процедуры, описанные недороги, требует относительно мало специализированного оборудования, и легко узнаются, что делает их поддаются для использования в различных проектах на широтой научных и учебных лабораторий.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics