प्रणालीगत जीवाणु संक्रमण और प्रतिरक्षा रक्षा phenotypes में

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

फल ड्रोसोफिला मेलानोगास्टर प्रतिरक्षा रक्षा के समारोह और विकास के अध्ययन के लिए प्रमुख मॉडल जीवों में से एक है उड़। जन्मजात उन्मुक्ति के कई पहलुओं को कीड़ों और स्तनधारियों के बीच संरक्षित कर रहे हैं, और ड्रोसोफिला आसानी से आनुवंशिक रूप से और प्रयोगात्मक हेरफेर किया जा सकता है, क्योंकि वे प्रतिरक्षा प्रणाली समारोह और रोग के शारीरिक परिणामों के अध्ययन के लिए शक्तिशाली हैं। यहाँ का प्रदर्शन प्रक्रिया उपकला बाधाओं और बचाव का अधिक निष्क्रिय रूपों को दरकिनार और प्रणालीगत संक्रमण पर ध्यान केंद्रित करने की अनुमति देता है, सीधे शरीर गुहा में बैक्टीरिया के लागू होने से मक्खियों के संक्रमण की अनुमति देता है। प्रक्रिया मेजबान मृत्यु दर, प्रणालीगत रोगज़नक़ लोड, और मेजबान प्रतिरक्षा प्रणाली के शामिल होने की डिग्री के मापने दरों के लिए प्रोटोकॉल में शामिल हैं। इस संक्रमण की प्रक्रिया, सस्ती, मजबूत और मात्रात्मक repeatable है, और कार्यात्मक आनुवंशिकी, विकासवादी जीवन इतिहास, और शरीर विज्ञान के अध्ययन में इस्तेमाल किया जा सकता है।

Introduction

फल ड्रोसोफिला मेलानोगास्टर मक्खी, प्रयोगात्मक हेरफेर करने के लिए अत्यधिक उत्तरदायी हैं, और एक व्यापक विकसित किया गया है कि एक व्यापक वैज्ञानिक समुदाय का समर्थन कर रहे समारोह और प्रतिरक्षा रक्षा। ड्रोसोफिला के विकास सस्ती और पीछे करने के लिए आसान कर रहे हैं का अध्ययन करने के लिए प्रमुख मॉडल जीवों में से एक है अनुसंधान उपकरण की सरणी। जन्मजात उन्मुक्ति के कई पहलुओं को टोल की तरह रिसेप्टर्स और एनएफ-केबी परिवार प्रतिलेखन कारक, जे ए / स्टेट संकेतन, और JNK मार्ग प्रतिक्रियाओं द्वारा मध्यस्थता संकेत पारगमन सहित, कीड़े और स्तनधारियों के बीच संरक्षित कर रहे हैं। 1,2 इन जीनों और रास्ते सकते हैं का समारोह डी में पूछे जा मेलानोगास्टर म्यूटेशन का उपयोग कर या आरएनएआई कि वृद्धि या कमी मार्ग गतिविधियों knockdowns 3 -। इसके अतिरिक्त 6, ड्रोसोफिला विकासवादी जीवन इतिहास सिद्धांत के संदर्भ में भी शामिल है, संक्रमण और रोग के शारीरिक परिणामों का अध्ययन करने के लिए इस्तेमाल किया जा सकता है 7।- 9 सभी तरह के अध्ययन, हालांकि, मज़बूती से परिभाषित उपचार शर्तों के तहत प्रयोगात्मक मक्खियों को संक्रमित करने की क्षमता पर निर्भर करती है। यहाँ वर्णित प्रक्रिया ड्रोसोफिला मेलानोगास्टर करने के लिए मजबूत और repeatable जीवाणु संक्रमण पहुंचाने और बाद में संक्रमण की गंभीरता को मापने और मेजबान प्रतिरक्षा प्रतिक्रिया बढ़ाता के लिए एक methodological रूपरेखा प्रस्तुत करता है।

ड्रोसोफिला स्वाभाविक रूप से और प्रयोगात्मक बैक्टीरिया, कवक, वायरस, नेमाटोड और parasitoid का wasps सहित परजीवी और रोगज़नक़ों, की एक विस्तृत विविधता से संक्रमित हो सकते हैं। वर्तमान प्रोटोकॉल प्रणालीगत जीवाणु संक्रमण देने पर ध्यान केंद्रित कर रहा है। बहुत से विभिन्न प्रकार के बैक्टीरिया मक्खियों को संक्रमित करने के लिए इस्तेमाल किया जा सकता है, और प्रयोगकर्ता की पसंद से पूछा जा रहा सटीक वैज्ञानिक सवालों के जवाब के आधार पर किया जाना चाहिए। उदाहरण के लिए, मानव नैदानिक ​​वियोजन बैक्टीरियल विषैलापन तंत्र 10 अध्ययन करने के लिए नियोजित किया जा सकता है, या पारिस्थितिकी प्रासंगिक वियोजन preferre हो सकता हैविकासवादी अध्ययन के लिए डी। 11 कुछ बैक्टीरिया डी के सक्षम रोगजनक हैं मेलानोगास्टर, संक्रमण पर proliferating और मेजबान बीमारी या मृत्यु के कारण। अन्य जीवाणुओं को प्रभावी ढंग से मेजबान प्रतिरक्षा प्रणाली द्वारा प्रबंधित और कुछ दिनों के भीतर मंजूरी दे दी है। इस प्रदर्शन में, Providencia rettgeri मेजबान मृत्यु दर का कारण है और जीवित रहने के मेजबानों में बनी रहती है। Escherichia कोलाई मेजबान प्रतिरक्षा प्रणाली द्वारा मंजूरी दे दी है कि एक गैर रोगजनक के रूप में इस्तेमाल किया जाएगा कर सकते हैं कि एक प्रफलन रोगज़नक़ के रूप में इस्तेमाल किया जाएगा।

संक्रमण सीधे मक्खी के शरीर गुहा में बैक्टीरिया के लागू होने से स्थापित किया जाएगा। इस दृष्टिकोण पर ध्यान दिए बिना संचरण की प्राकृतिक मोड के प्रणालीगत संक्रमण की जांच की अनुमति देता है, उपकला बाधाओं और सुरक्षात्मक व्यवहार नजरअंदाज। प्रयोगात्मक प्रणालीगत संक्रमण की स्थापना के लिए दो प्राथमिक तरीके हैं। पहली बार में एक nanoinjector और खींच लिया गिलास केशिका सुइयों का एक सटीक संख्या इंजेक्षन करने के लिए इस्तेमाल कर रहे हैंमक्खी में बैक्टीरिया। इस विधि संक्रमण खुराक की एक बड़ी गतिशील रेंज की अनुमति के और मात्रात्मक अत्यधिक repeatable होने का लाभ है। दूसरा दृष्टिकोण एक सेप्टिक चिढ़ के साथ संक्रमण वितरित करने के लिए है। यह दृष्टिकोण तेजी से किया जा रहा है और कोई विशेष उपकरणों की आवश्यकता के फायदे हैं। संक्रमण स्थापित हो जाने के बाद, यह प्रणालीगत रोगज़नक़ लोड, मेजबान मृत्यु दर, और inducible प्रतिरक्षा प्रणाली गतिविधि को मापने के लिए संभव हो जाता है। बेशक, अतिरिक्त phenotypes के किसी भी संख्या क़यास संक्रमित डी में मापा जा सकता है बाद संक्रमण उपजाऊपन 12, सीखने की क्षमता 13, चयापचय की स्थिति के 14, या कल्पना की जा सकती है कि वास्तव में किसी भी अन्य विशेषता सहित मेलानोगास्टर।

Protocol

1. लीजिए और मक्खियों की तैयारी

  1. रियर डी वांछित प्रयोगात्मक शर्तों के तहत मेलानोगास्टर। पालन ​​के दौरान मक्खियों पल्ला झुकना और लार्वा चरण के दौरान पर्यावरण की स्थिति को गहराई से वयस्क अवस्था के दौरान प्रतिरक्षा रक्षा phenotypes को प्रभावित कर सकते हैं के बाद से लार्वा घनत्व, उपचार भर में लगातार कर रहे हैं सुनिश्चित करने के लिए नहीं ख्याल रखना। 15
  2. पोटा संबंधी मामले से eclosion के बाद 3 दिन और ताजा माध्यम पर उन्हें स्थानांतरण - प्रयोगात्मक मक्खियों 0 लीजिए।
  3. बाद के eclosion 7 दिन - वे 5 आयु वर्ग के हैं, जब तक सदन एक वांछित तापमान पर एकत्र मक्खियों (22 डिग्री सेल्सियस और 28 डिग्री सेल्सियस के बीच तापमान आम तौर पर उपयुक्त हैं)।
    नोट: यह परिपक्व वयस्कों कायापलट को पूरा करने और बनने के लिए मक्खियों के लिए पर्याप्त समय की अनुमति देता है, लेकिन वार्धक्य शुरू होने से पहले अच्छी तरह से है।
  4. फिर भीड़भाड़ से बचने के लिए, देखभाल करने के संक्रमण के लिए पहले एक अलग शीशी में मक्खियों की वांछित संख्या तरह।
    नोट: केवल मालेस इस प्रदर्शन में संक्रमित लेकिन वर्णित प्रक्रिया का उपयोग कर महिलाओं को संक्रमित करने के लिए समान रूप से संभव है कर रहे हैं।

2. संस्कृति और जीवाणु की तैयारी

  1. संक्रमण के लिए कम से कम 2 दिन पहले चुना बैक्टीरिया के एक मास्टर थाली तैयार है। स्ट्रीक -80 डिग्री सेल्सियस पर अनिश्चित काल के संग्रहीत एक 15% ग्लिसरॉल स्टॉक से बैक्टीरिया। 2 सप्ताह के लिए 4 डिग्री सेल्सियस पर मास्टर थाली स्टोर। जमे हुए ग्लिसरॉल स्टॉक से गुरु प्लेटें सीधे हमेशा लकीर। संस्कृति में दोहराया बीतने के बैक्टीरिया तनु डाह विकसित करने के लिए पैदा कर सकता है, के रूप में थाली करने के लिए थाली से बैक्टीरिया के धारावाहिक पारित होने से बचें।
    नोट: इस उदाहरण Providencia rettgeri और Escherichia कोलाई का उपयोग करता है।
  2. इंजेक्शन के लिए एक जीवाणु निलंबन तैयार करने के लिए निम्नलिखित प्रक्रिया का उपयोग करें।
    1. मास्टर थाली से अलग एक ही कॉलोनी के साथ बाँझ मध्यम inoculating से बैक्टीरिया के 2 मिलीलीटर संस्कृति विकसित। स्थिर चरण के लिए बैक्टीरिया बढ़ने (जैसे नोट: दोनों पी कोमल झटकों के साथ 37 डिग्री सेल्सियस - rettgeri और ई कोलाई 20 से तापमान में Luria शोरबा में अच्छी तरह से बढ़ता है।
    2. संस्कृति स्थिर चरण तक पहुँच गया है, धीरे करीब से गोली कोशिकाओं। एक tabletop अपकेंद्रित्र (5,000 XG पर 3 मिनट) में संस्कृति के 600 μl, सतह पर तैरनेवाला त्यागें, और लगभग में बैक्टीरिया resuspend। बाँझ फॉस्फेट बफर खारा के 1,000 μl (पीबीएस; 137 मिमी NaCl, 2.7 मिमी KCl, 10 मिमी ना 2 पीओ 4, 1.8 मिमी के.एच. 2 पीओ 4, पीएच = 7.4)।
    3. 600 एनएम पर absorbance के रूप में एक स्पेक्ट्रोफोटोमीटर के साथ मापा इस्तेमाल किया जा रहा जीवाणु के लिए उपयुक्त एक ऑप्टिकल घनत्व (ओवर ड्राफ्ट) को प्राप्त करने के लिए बाँझ पीबीएस में resuspended कोशिकाओं पतला। मक्खियों को संक्रमित करने के लिए इस निलंबन का प्रयोग करें।
      ध्यान दें: एक 600 = 0.1 या 1.0 लगभग 10 8 और 10 9 Providencia rettgeri या करने के लिए क्रमशः मेल खाती है मिलीलीटर प्रति कोलाई। दोनों रहते हैं क्योंकि एकएन डी मृत बैक्टीरिया ऑप्टिकल घनत्व के लिए, यह जीवाणु लाशों जमा करने से पहले जल्दी स्थिर चरण में संस्कृतियों फसल और ऑप्टिकल घनत्व और संक्रमण के दौरान पेश व्यवहार्य जीवाणुओं की संख्या के बीच संबंधों को विकृत करने के लिए महत्वपूर्ण है योगदान करते हैं।

3. मक्खियों संक्रमित

नोट: ड्रोसोफिला उन्मुक्ति circadian ताल से प्रभावित है, यह प्रयोगात्मक प्रतिकृति भर में दिन के एक ही समय में संक्रमण प्रदर्शन करने के लिए महत्वपूर्ण है 16।

3.1) एक Nanoinjector का प्रयोग

  1. संक्रमण के लिए गिलास सुई तैयार करें।
    1. एक micropipette खींचने का उपयोग एक borosilicate ग्लास केशिका खींच कर एक गिलास सुई तैयार करें।
    2. लगभग 50 माइक्रोन व्यास की एक खोलने बनाने के लिए सुई की नोक से दूर तोड़ने, संदंश का प्रयोग तरल के इंजेक्शन की अनुमति है।
  2. इंजेक्टर इकट्ठे।
    1. सील O- अंगूठी और फिर सफेद सपा रखेंएसर धातु सवार पर (बड़े डिंपल के बाहर का सामना करना पड़)।
    2. एक 30 जी सुई के साथ एक सिरिंज का उपयोग खनिज तेल के साथ कांच सुई भरें।
    3. सुई की कुंद अंत से 1mm के बारे में, इसके आधार पर चारों ओर बड़े-ओ-रिंग जगह तो कोलिट के माध्यम से भरे गिलास सुई रखो और।
    4. धातु सवार पर सुई स्लाइड और सुरक्षित तक कोलिट पर पेंच धीरे।
    5. इंजेक्टर से खनिज तेल के सबसे निकालें, लेकिन अभी भी इंजेक्टर और जीवाणु निलंबन के बीच एक बाधा के रूप में कार्य करने के लिए सुई में तेल की एक छोटी मात्रा है कि वहाँ सुनिश्चित करें। कोई हवा खनिज तेल या जीवाणु निलंबन के भीतर बुलबुले, या दो तरल पदार्थ के बीच कर रहे हैं कि सुनिश्चित करें।
    6. (9 nl और 50 nl के बीच) इंजेक्शन के लिए वांछित मात्रा को इंजेक्टर सेट करें।
  3. नियंत्रण घायल हो गए उत्पन्न करता है।
    1. ध्यान से मीडिया और pressi की एक ट्यूब में केशिका सुई की नोक डालने से बाँझ पीबीएस के साथ सुई लगानेवाला सुई भरेंइंजेक्टर पर "भरने" बटन एनजी।
      नोट: प्रयोग उनके मध्यम विकास में निलंबित कर दिया बैक्टीरिया के इंजेक्शन की आवश्यकता है बाँझ बैक्टीरियल वृद्धि मीडिया भी एक लोग घायल हो गए नियंत्रण के लिए इस्तेमाल किया जा सकता है। बैक्टीरियल वृद्धि मीडिया प्रतिरक्षा प्रणाली को उत्तेजित या मेजबान पर अन्य प्रभाव हो सकता है कि घटक शामिल हैं क्योंकि हालांकि, इस तरह के पीबीएस के रूप में एक निष्क्रिय वाहक बेहतर है।
    2. सीओ 2 के एक प्रकाश प्रवाह के तहत मक्खियों की वांछित संख्या चतनाशून्य।
    3. बाँझ पीबीएस के साथ ventrolateral सतह पर पूर्वकाल पेट में मक्खियों इंजेक्षन।
      यह इस तरह की छाती के sternopleural थाली के रूप में अन्य साइटों पर मक्खियों इंजेक्षन करने के लिए भी संभव है, लेकिन यह एक प्रयोग के भीतर लगातार इंजेक्शन साइट को सुरक्षित रखने के लिए महत्वपूर्ण है 17: ध्यान दें।
    4. मक्खियों के सभी जब तक उनके पक्ष में शीशियों बिछाने, नए माध्यम के साथ नए सिरे से शीशियों में इंजेक्शन मक्खियों प्लेस भोजन करने के लिए अटक बनने से मक्खियों को रोकने के लिए संज्ञाहरण से बरामद किया है। <br /> नोट: यह एक ही सुई दोनों उपचार के लिए इस्तेमाल किया जा सकता है ताकि प्रयोगात्मक मक्खियों को बैक्टीरिया इंजेक्शन लगाने से पहले पीबीएस नियंत्रण मक्खियों इंजेक्षन करने के लिए सिफारिश की है। यह हमेशा के लिए एक पूरे प्रयोग के लिए एक ही सुई का उपयोग करना संभव नहीं होगा। उस मामले में, यह मक्खियों के साथ जो इस्तेमाल किया गया था और सांख्यिकीय विश्लेषण में एक प्रायोगिक कारक के रूप में सुई पहचान को शामिल करने के लिए जो सुई रिकॉर्ड करने के लिए वांछनीय हो सकता है।
  4. बैक्टीरियल रोगज़नक़ इंजेक्षन।
    1. इंजेक्टर से शेष बाँझ मीडिया को निकाल और जीवाणु निलंबन के साथ एक ही सुई फिर से भरना।
    2. अब प्रक्रिया 2.2 में तैयार जीवाणु निलंबन के साथ मक्खियों इंजेक्शन लगाने उपरोक्त प्रक्रिया (3.1.3), दोहराएँ।

3.2) सेप्टिक चिढ़ के साथ

  1. शूल के लिए सुई तैयार करें।
    1. एक 200 μl micropipette टिप के अंत पिघला और पिघला हुआ प्लास्टिक में एक 0.15 मिमी कीट minutien पिन डालें। प्लास्टिक सु जमना करने की अनुमति देंपिन प्लास्टिक से देने पिन का लगभग 0.5 सेमी के साथ जगह में आयोजित किया जाता है कि Ch।
  2. नियंत्रण घायल हो गए उत्पन्न करता है।
    1. सीओ 2 के एक प्रकाश प्रवाह के तहत मक्खियों की वांछित संख्या चतनाशून्य।
    2. पंख और पैरों की कुर्की साइटों से परहेज है, सुई के साथ छाती के sternopleural थाली में मक्खियों चुभन। यदि आवश्यक हो, धीरे नरम संदंश का उपयोग minutien पिन से मक्खियों को हटा दें।
      नोट:। पेट की छल्ली के माध्यम से चुभ यह ऐसी ventrolateral सतह पर पूर्वकाल पेट के रूप में अन्य साइटों पर मक्खियों चुभन भी संभव है, लेकिन यह एक प्रयोग के भीतर लगातार इंजेक्शन साइट को सुरक्षित रखने के लिए महत्वपूर्ण है 17 अधिक हो जाता है छाती की चुभन और इसलिए कम आम है की तुलना में मुश्किल।
    3. मक्खियों के सभी जब तक उसकी तरफ से शीशी बिछाने, नई मक्खी मध्यम के साथ एक ताजा शीशी में चुभ मक्खियों जगह हो से मक्खियों को रोकने के लिए संज्ञाहरण से बरामद किया हैभोजन करने के लिए अटक आ रहा है।
  3. जीवाणु संक्रमण का परिचय।
    1. सीओ 2 के एक प्रकाश प्रवाह के तहत मक्खियों की वांछित संख्या चतनाशून्य।
    2. प्रत्येक मक्खी शूल से पहले प्रक्रिया 2.2 में तैयार जीवाणु निलंबन में पिन की नोक सूई, प्रत्येक मीडिया पर नियंत्रण के रूप में एक ही स्थान में उड़ान भरने चुभन।
    3. मक्खियों के सभी खाद्य के लिए अटक बनने से मक्खियों को रोकने के लिए संज्ञाहरण से बरामद किया है जब तक उसकी तरफ से शीशी बिछाने, नई मक्खी मध्यम के साथ एक ताजा शीशी में चुभ मक्खियों रखें।

3.3) संक्रामक खुराक वितरित आकलन

  1. प्रत्येक बर्फ पर एक microcentrifuge ट्यूब में उड़ान भरने के लिए जगह है, केवल बजाय संज्ञाहरण से उबरने के लिए भोजन शीशी मक्खियों लौटने के लिए, या तो प्रक्रिया 3.1 या 3.2 में ऊपर वर्णित के रूप में मक्खियों का एक सेट को संक्रमित।
  2. प्रत्येक ट्यूब पीबीएस μl 250 जोड़ें और एक पैर या एक मनका डिब्बा का उपयोग कर मक्खियों या तो homogenize। </ ली>
  3. एक लेग अगर प्लेट पर homogenate थाली, या तो एक सर्पिल plater या एक सीरियल कमजोर पड़ने का उपयोग कर।
    1. धारावाहिक कमजोर पड़ने का उपयोग कर थाली करने के लिए, एक 96 अच्छी तरह से थाली की पहली पंक्ति के लिए प्रत्येक मक्खी homogenate स्थानांतरण।
    2. पीबीएस के 90 μl के साथ शेष पंक्तियों में से प्रत्येक में अच्छी तरह से भरें।
    3. एक multichannel विंदुक का प्रयोग, homogenate के लिए उड़ान भरने और दूसरी पंक्ति में बांटना युक्त पहली पंक्ति से 10 μl ले।
    4. पिपेट ऊपर और नीचे कम से कम 10 बार मिश्रण अच्छी तरह से करने के लिए, और फिर 10 μl लेने के लिए और तीसरी पंक्ति के लिए स्थानांतरण। शेष पंक्तियों का उपयोग कर इस प्रक्रिया को दोहराएँ।
    5. नीचे पंक्ति (सबसे बैक्टीरिया निलंबन पतला) से शुरू नमूने, एक दूसरे को स्पर्श नहीं करते कि असतत धब्बे के रूप में तिरस्कृत कर रहे हैं, देखभाल करने के लिए एक लेग थाली पर प्रत्येक अच्छी तरह से और जमा राशि में से 10 μl लेने के लिए मल्टीचैनल पिपेट का उपयोग करें। सभी कुओं लेग प्लेट पर कमजोर पड़ने के अवरोही क्रम में उन्हें वितरण, प्रत्येक पंक्ति से जांचा गया है जब तक दोहराएँ। स्पॉट पूरी तरह से लेग थाली में भिगो कर दिया है जब तक आरटी पर थाली छोड़ दें।
      नोट: उपयोग करने के लिए पूर्व आरटी पर कुछ दिनों के लिए लेग प्लेट सुखाने नमूना स्पॉट के बीच आकस्मिक संपर्क की संभावना को कम करने, तरल आसानी से अवशोषित कर लेता है कि यह सुनिश्चित करने के लिए सिफारिश की है।
  4. कालोनियों छोटे और असतत रहते हैं इसलिए प्लेटों ऊंचा हो जाना करने के लिए नहीं ख्याल रख रही है, हे / एन प्लेटें सेते हैं।
    नोट: इस्तेमाल किया बैक्टीरियल वृद्धि मध्यम और ऊष्मायन तापमान पर निर्भर करता है, मक्खी के अंतर्जात पेट microbiota से निकाली गई कालोनियों अंततः प्लेट पर दिखाई दे सकते हैं। हालांकि, रोगजनक संक्रमण के लिए इस्तेमाल सबसे बैक्टीरिया 37 डिग्री सेल्सियस पर लेग अगर पर पेट microbiota तुलना में बहुत तेजी से बढ़ता है।
  5. प्रयोगात्मक बैक्टीरिया दिखाई दे कालोनियों हो गए हैं जब इनक्यूबेटर से प्लेटें निकालें (आमतौर पर 8-12 मानव संसाधन), लेकिन ड्रोसोफिला पेट microbiota कालोनियों (लगभग 36 घंटा) प्रदर्शित होने से पहले। धीमी गति से बढ़ रही है प्रयोगात्मक बैक्टीरिया के लिए, एक चयनात्मक उपयोगलेग अगर में एंटीबायोटिक पेट microbiota से किसी भी कालोनियों को हटाने के लिए।
  6. प्रत्येक homogenate के लिए कालोनियों की संख्या की गणना।
    1. सर्पिल प्लेटों के लिए, थाली पर कालोनियों की संख्या और स्थिति के आधार पर homogenate के प्रति मिलीलीटर बैक्टीरियल लोड अनुमान कर सकते हैं कि एक स्वचालित कॉलोनी काउंटर का उपयोग बढ़ने कालोनियों गिनती।
      नोट: बैक्टीरियल एकाग्रता मिलीलीटर प्रति 5 एक्स 10 2 से 4 10 एक्स 5 को बैक्टीरिया की सीमा में है जब सर्पिल मायने रखता है सबसे सटीक हैं।
    2. मौके प्लेटों के लिए, मैन्युअल रूप से कमजोर पड़ने 30 में शामिल है, जो भी से प्रत्येक मक्खी के लिए कालोनियों गिनती - 300 कालोनियों और मूल homogenate के मिलीलीटर प्रति जीवाणुओं की संख्या की गणना।

संक्रमण के 4. विशेषताएँ उत्तरजीविता

  1. परख मृत्यु दर के बाद इंजेक्शन।
    1. एक 12:12 निम्न आय वर्ग के साथ (25 डिग्री सेल्सियस ताजा शीशियों में संक्रमित मक्खियों और घायल नियंत्रण रखें और एक वांछित तापमान पर एक मशीन में बनाए रखने केहिंदुस्तान टाइम्स: अंधेरे चक्र की सिफारिश की है)। यह 15 से अधिक रहने की मक्खियों की गिनती करना मुश्किल हो जाता है के रूप में एक शीशी में 15 से अधिक मक्खियों मत डालो।
    2. प्रत्येक दिन जीवित और मृत मक्खियों की संख्या की गणना, या अधिक बार अगर उचित।
    3. , भोजन की गुणवत्ता बनाए रखने के लिए एक नियमित समय पर नया भोजन करने के लिए मक्खियों फ्लिप करने के लिए आदेश में।
      1. शीशी केवल पुरुषों हैं, तो हर तीन दिन ताजा शीशियों को हस्तांतरण। शीशी महिलाओं में शामिल है, तो लार्वा संतान भोजन दव्र बनाना होगा, क्योंकि है कि वयस्क मक्खियों फँस गया है और संक्रमण के कारण मृत्यु दर के overestimated दरों में जिसके परिणामस्वरूप मिल सकता है खतरा बढ़ रही है, हर दो दिन ताजा शीशियों के लिए स्थानांतरण।
  2. सांख्यिकीय डेटा का विश्लेषण।
    1. एक व्यक्ति को एक प्रवेश-रैंक टी का उपयोग जोड़ी के लिहाज से तुलना, पार नहीं करते कि अस्तित्व घटता के लिए 18। एक मापा समय बिंदु पद इंजेक्शन के लिए जीवित रहने के लिए प्रदर्शन करेंगे संभावना है कि इंगित करता है जो एक कापलान-मायर की अवस्था है, के रूप में प्लॉट अस्तित्व(यह भी मेंटल कॉक्स टेस्ट कहा जाता है) या कई कारकों और उनकी बातचीत शामिल कर सकते हैं जो एक कॉक्स आनुपातिक खतरों मॉडल, का उपयोग करते हुए और अधिक जटिल विश्लेषण प्रदर्शन स्था। पार कि अस्तित्व घटता के लिए, एक स्तरीकृत कॉक्स विश्लेषण करते हैं। 17

5. परख बैक्टीरियल के बाद संक्रमण लोड

  1. बैक्टीरियल लोड उपाय।
    1. एक निर्धारित समय के बाद इंजेक्शन में, संक्रमण के पाठ्यक्रम पर बैक्टीरियल लोड निर्धारित करने के लिए संक्रामक खुराक का आकलन करने के लिए इस्तेमाल प्रक्रिया को दोहराने (प्रोटोकॉल 3.3 देखें)।
      नोट: सर्पिल plater का उपयोग अगर जीवाणु निलंबन 1000 की एक सीमा के भीतर गिर जाता है, ताकि homogenates पतला - 100,000 जीवाणु प्रति मिलीलीटर।
  2. डेटा का विश्लेषण।
    1. बैक्टीरियल लोड गैर सामान्य है, तो बेहतर है एक सामान्य वितरण अनुमानित या गैर पैरामीट्रिक सांख्यिकीय विश्लेषण (जैसे मान व्हिटनी यू परीक्षण) का उपयोग कर डेटा का विश्लेषण करने के लिए डेटा को बदलने या तो। एफ के लिए एक बॉक्स कॉक्स विश्लेषण का प्रयोग करेंइष्टतम परिवर्तन इंडस्ट्रीज़; प्राकृतिक प्रवेश या आधार -10 प्रवेश परिवर्तनों अक्सर प्रभावी हैं। 19
    2. डेटा पर्याप्त सामान्य रूप से वितरित किया जा रहा है और विषम केवल दो उपचार कर रहे हैं कर रहे हैं, दो उपचार अलग मतलब जीवाणु भार में परिणाम निर्धारित करने के लिए एक टी -test प्रदर्शन करते हैं। कई प्रयोगात्मक चर या अन्य संभावित भविष्य कहनेवाला कारक हैं, तो विचरण के विश्लेषण (एनोवा) जीवाणु लोड की महत्वपूर्ण predictors हैं जो कारकों का निर्धारण करने के लिए इस्तेमाल करते हैं। 19

इम्यून सिस्टम जीन के 6. परख Transcriptional एक्टिवेशन

  1. कटा पहले से वर्णित के रूप में एक रोगाणुरोधी पेप्टाइड जीन से एक प्रमोटर के नियंत्रण के तहत हरी फ्लोरोसेंट प्रोटीन (GFP) व्यक्त कि ट्रांसजेनिक मक्खियों को संक्रमित, संक्रमण के बाद प्रतिरक्षा सक्रियण कल्पना करने के लिए। 18
  2. एक प्रतिदीप्ति सक्षम खुर्दबीन के नीचे संक्रमित मक्खियों देखें; GFP प्रेरण visib बन जाना चाहिएसंक्रमण के बाद 10 घंटा पहले - 6 के भीतर वसा शरीर में ले।
  3. प्रतिरक्षा सक्रियण के और अधिक सटीक मात्रा का ठहराव के लिए, रोगाणुरोधी पेप्टाइड जीन टेप की बहुतायत को मापने के लिए सीडीएनए टेम्पलेट (qRT- पीसीआर) पर मात्रात्मक पीसीआर का उपयोग करें।
    नोट: प्रतिरक्षा जीनों की अभिव्यक्ति (या पहले) संक्रमण के बाद किसी भी समय पर मापा जा सकता है। सामान्यतया, प्रतिरक्षा जीन अभिव्यक्ति की प्रेरण अगले 24 घंटा से अधिक इंजेक्शन और बढ़ जाती है के बाद लगभग 4 घंटा शुरू होता है।
    1. सीओ 2 का उपयोग मक्खियों anesthetize।
    2. प्रत्येक शाही सेना निकासी के लिए एक microfuge ट्यूब में 15 मक्खियों रखें।
      नोट: यह प्रत्येक उपचार हालत के लिए कम से कम तीन को दोहराने के नमूने एकत्र करने के लिए सिफारिश की है।
    3. मक्खियों से शाही सेना निकालें और मानक प्रक्रियाओं या वाणिज्यिक किट के एक नंबर से किसी का उपयोग पहली कतरा सीडीएनए उत्पन्न करते हैं। -80 डिग्री सेल्सियस पर स्टोर आरएनए। कुछ सप्ताह की अवधि के लिए -20 डिग्री सेल्सियस पर और लंबी अवधि के भंडारण के लिए -80 डिग्री सेल्सियस पर स्टोर सीडीएनए। शाही सेना निकासी के लिए पहले, दुकान च-80 डिग्री सेल्सियस पर स्थित है।
    4. एक टेम्पलेट के रूप में सीडीएनए का उपयोग करते हुए ब्याज का लक्ष्य जीन पर मात्रात्मक पीसीआर (qPCR) प्रदर्शन करते हैं। जीवाणुरोधी पेप्टाइड जीन Diptericin ए, Drosomycin, Defensin, Attacin ए, और Metchnikowin के रूप में अच्छी तरह से (जो भी rpL32 के रूप में जाना जाता है) गृह व्यवस्था नियंत्रण जीन rp49 बढ़ाना करने के लिए प्राइमर दृश्यों के लिए 1 टेबल का संदर्भ लें।
      नोट: रोगाणुरोधी पेप्टाइड्स Diptericin ए और Drosomycin कूटबद्ध करने वाले जीन डी का बहुत अच्छा readouts प्रदान क्रमश: आईएमडी और टोल रास्ते के माध्यम से मुख्य रूप से प्रेरित प्रतिरक्षा गतिविधि मेलानोगास्टर। नमूना नमूना शाही सेना उपज में परिवर्तन और रिवर्स प्रतिलेखन की दक्षता के लिए नियंत्रित करने के लिए आदेश में, जिनकी अभिव्यक्ति ऐसे rp49 (भी आरपीएल के रूप में जाना जाता है के रूप में संक्रमण के साथ बदलने की उम्मीद नहीं है एक संदर्भ के गृह व्यवस्था जीन के खिलाफ लक्ष्य जीन की दर्ज की अभिव्यक्ति का मानकीकरण 32)।
    5. डेटा का विश्लेषण। <राजभाषा>
    6. अभिव्यक्ति मतभेद के किसी न किसी सन्निकटन के लिए, परीक्षण के जीन से प्राप्त प्रारंभिक मात्रा (वर्ग) मूल्य के अनुपात की गणना (जैसे, Diptericin ए) संदर्भ जीन से प्राप्त वर्ग मूल्य के सापेक्ष (जैसे, rp49) प्रत्येक नमूने के लिए (के रूप में गणना वर्ग - DptA वर्ग / - rp49)। इस तरह के एक असंक्रमित से निपटने के नियंत्रण के रूप में एक आधारभूत नियंत्रण उपचार के लिए ये अनुपात स्केल। मनमाने ढंग से 1.0 के बराबर नियंत्रण अभिव्यक्ति स्तर सेट और रिश्तेदार गुना परिवर्तन के रूप में प्रयोगात्मक उपचार कल्पना। ज्ञात मात्रा सीडीएनए की एक कमजोर पड़ने श्रृंखला से उत्पन्न एक मानक वक्र के खिलाफ प्रत्येक जीन के लिए वर्ग मूल्य का अनुमान है।
      नोट: अनुपात का सांख्यिकीय विश्लेषण जटिल हो सकता है, इसलिए इस दृष्टिकोण कठोर विश्लेषण के लिए की तुलना में जल्दी सन्निकटन के लिए बेहतर है। पीसीआर दक्षता कम है, यदि संभव हो तो पीसीआर कैनेटीक्स में सुधार करने के लिए नए डिजाइन प्राइमरों। लगभग पूर्ण दक्षता (विज्ञापन के साथ qPCR प्रतिक्रियाओं के लिएपीसीआर उत्पाद हर चक्र) के oubling, सीमा चक्र (सी टी) वर्ग मूल्य के लिए प्रतिस्थापित किया जा सकता है।
    7. बेहतर कुशल प्रवर्धन के साथ सरल प्रयोगों के लिए, डेटा ΔΔC टी विधि का उपयोग कर विश्लेषण किया जा सकता है। 19 प्रत्येक नमूना के लिए, परीक्षण के जीन की सी टी (उदा।, Diptericin से संदर्भ जीन का सी टी मूल्य (जैसे, rp49) घटाना ए) एक ΔC टी उपज के लिए। तब प्रत्येक नमूने के लिए एक ΔΔC टी मूल्य उपज के लिए प्रत्येक प्रयोगात्मक नमूना के लिए ΔC टी से आधारभूत नियंत्रण के ΔC टी घटाना; इस ΔΔC टी 2 (-ΔΔCT) अभिव्यक्ति में गुना परिवर्तन का अनुमान लगाती है, जहां उपचार के बीच जीन अभिव्यक्ति के स्तर में रिश्तेदार मतभेदों का संकेत है।
      नोट: लक्ष्य जीन की अभिव्यक्ति में इस विश्लेषण misestimate बुरी तरह कर सकते गुना-बदलते हैं परीक्षण जीन या संदर्भ या तो पीसीआरजीन कम क्षमता है।
    8. सबसे कठोर विश्लेषण के लिए, प्रतिक्रिया चर के रूप में परीक्षण जीन (जैसे Diptericin ए) के अनुमान के अनुसार अभिव्यक्ति और व्याख्यात्मक चर के रूप में नियंत्रण जीन (जैसे rp49) और अन्य प्रयोगात्मक कारकों की अनुमानित अभिव्यक्ति का उपयोग विचरण (एनोवा) के विश्लेषण का संचालन।
      नोट: इस दृष्टिकोण पीसीआर प्रवर्धन में अक्षमता के लिए अपेक्षाकृत मजबूत है और अधिक जटिल प्रयोगात्मक डिजाइन के विश्लेषण की अनुमति देता है।

Representative Results

यह खंड 1 संक्रमण खुराक इंजेक्शन के लिए इस्तेमाल किया जीवाणु निलंबन के ऑप्टिकल घनत्व के साथ बदलता रहता है कि पता चलता है। ड्रोसोफिला मेलानोगास्टर के जीवाणु संक्रमण के बाद प्राप्त किया जा सकता है कि परिणाम दिखाता है, और मज़बूती से homogenizing और चढ़ाना से अनुमान लगाया जा सकता वितरित खुराक इंजेक्शन के बाद तुरंत कि मक्खियों । चित्रा 2 में सचित्र के रूप में, विभिन्न रोगजनकों खुराक पर निर्भर (चित्रा 2 बी) हो सकता मेजबान मृत्यु दर (2A चित्रा) और मेजबान मृत्यु दर के विभिन्न स्तरों के कारण हो सकता है। महत्वपूर्ण बात है, इस प्रोटोकॉल के संक्रमण के विभिन्न प्रकार प्राप्त किया जा करने के लिए अनुमति देता है: Providencia rettgeri 20 दिन या उससे अधिक समय (चित्रा 3) के लिए बनी रहती है कि एक पुरानी, ​​उप घातक संक्रमण पैदा कर सकता है। हालांकि, Escerichia कोलाई जैसे अन्य बैक्टीरिया ज्यादातर छह घंटे के बाद संक्रमण (3B चित्रा) के भीतर मेजबान मक्खी द्वारा मंजूरी दे दी जाएगी। प्रतिरक्षा व्यवस्था की प्रेरणमंदिर जीवाणुरोधी पेप्टाइड टेप (चित्रा -4 ए और बी) के शाही सेना अलगाव और बाद QRT- पीसीआर के माध्यम से अनुमान लगाया जा सकता है। Analogously लेकिन कम मात्रात्मक, रोगाणुरोधी पेप्टाइड जीन प्रमोटरों के नियंत्रण में GFP व्यक्त प्रतिरक्षा प्रणाली (चित्रा 4C) के शामिल होने की कल्पना करने के लिए इस्तेमाल किया जा सकता है मक्खियों।

चित्र 1
। चित्रा 1: संक्रामक खुराक निर्धारण मक्खियों ऑप्टिकल घनत्व (.0001-0.05) की एक रेंज को कवर बैक्टीरियल निलंबन के 50 nl इंजेक्शन के साथ किया गया। मक्खियों तुरंत homogenized थे और इंजेक्शन द्वारा शुरू जीवाणु की संख्या निर्धारित करने के लिए चढ़ाया। प्रारंभिक बैक्टीरियल लोड जोरदार प्रारंभिक आयुध डिपो इंजेक्शन के साथ संबद्ध (आर 2 = 0.96)

चित्र 2
(ए) जंगली प्रकार मक्खियों तीन अलग अलग प्रजातियों में से एक की से लगभग 5,000 बैक्टीरिया के साथ इंजेक्शन थे। मेजबान मृत्यु की दर संक्रमण के लिए इस्तेमाल किया बैक्टीरियल प्रजातियों पर काफी निर्भर करता है। 50, 500, और मक्खी प्रति 5,000 बैक्टीरिया - (ख) जंगली प्रकार मक्खियों Enterococcous faecalis के तीन अलग अलग खुराक के साथ इंजेक्शन थे। एक प्रतिरक्षा प्रणाली उत्परिवर्ती और उसके जंगली प्रकार isogenic नियंत्रण रेखा लगभग 500 Burkholderia cepacia साथ इंजेक्शन थे उच्च संक्रामक खुराक (सी) से संक्रमित जब मक्खियों और अधिक जल्दी मर जाते हैं। एक जोड़ो में प्रवेश रैंक तुलना जंगली प्रकार की मक्खी उत्परिवर्ती की तुलना में काफी बेहतर संक्रमण (χ 2 = 59.02, DF = 1, पी <0.0001) निकलता है कि पता चलता है।


चित्रा 3:। इंजेक्शन मक्खियों के बाद बैक्टीरियल लोड लगभग (ए) 5,000 पी के साथ इंजेक्शन थे rettgeri (बी) 3400 ई कोलाई। बैक्टीरियल लोड तुरंत इंजेक्शन के बाद और विभिन्न बाद के समय बिंदुओं पर निर्धारित किया गया था। प्रत्येक डेटा बिंदु एक भी मक्खी के जीवाणु भार का प्रतिनिधित्व करता है। ई कोलाई जल्दी से पी जबकि चुनौती दी मेजबान से मंजूरी दे दी है rettgeri मेजबान के जीवन के शेष के लिए बनी रहती है ,.

चित्रा 4
चित्रा 4: इंजेक्शन के बाद इम्यून जीन अभिव्यक्ति की प्रेरण। (ए) मक्खियों पी के 50 nl इंजेक्शन के साथ किया गया पेट या छाती में या तो rettgeri या बाँझ पीबीएस, या सीओ से अलग unmanipulated छोड़ दिया गया एक जीन QRT- पीसीआर का उपयोग करके निर्धारित किया गया था Diptericin की शाही सेना अलगाव और अभिव्यक्ति के लिए एकत्र किए गए थे। (ए) अभिव्यक्ति के स्तर Diptericin के अनुपात के रूप rp49 प्रतिलिपि करने के लिए एक प्रतिलिपि रेखांकन कर रहे हैं और एन (सीओ 2 नियंत्रण सलाखों के प्रत्येक हालत से अनुपात का मतलब है और मानक त्रुटि का प्रतिनिधित्व करते हैं 1. की अभिव्यक्ति के स्तर होने के रूप में परिभाषित किया गया है कि इस तरह बढ़ाया = 4)। (बी) अभिव्यक्ति के स्तर मानक uninduced शर्त के रूप में प्रयोग किया जाता है सीओ 2 aesthesia नियंत्रण मक्खियों से औसत सी टी मूल्य के साथ एक 2 ΔΔCT के रूप में रेखांकन किया जाता है। सलाखों के प्रत्येक हालत से ΔΔC टी का मतलब है और मानक त्रुटि का प्रतिनिधित्व करते हैं (एन = 4)। कारण इंजेक्शन की साइट के लिए प्रतिलिपि प्रेरण में कोई अंतर नहीं है, वहीं पैनलों ए और बी की तुलना ΔΔC टी विधि संभावित प्रेरण स्तरों overestimate कैसे कर सकते हैं दिखाता है। (सी) एक प्रमोटर पी के 50 nl साथ इंजेक्शन थे Diptericin के नियंत्रण के तहत व्यक्त GFP मक्खियों rettgeri (आयुध डिपो = 0.1) और फिर 7 दिन बाद imaged। GFP के पैनल Diptericin की सक्रियता एक bacterially संक्रमित मक्खियों में प्रमोटर नहीं बल्कि मीडिया इंजेक्शन नियंत्रण का संकेत है, संक्रमित मक्खियों की पेट की चर्बी शरीर में GFP की अभिव्यक्ति से पता चलता है।

जीन आगे रिवर्स
rp49 (भी rpL32 कहा जाता है) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin एक 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensin 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin एक 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

तालिका 1: QRT- पीसीआर के लिए प्राइमर।

Discussion

यहाँ वर्णित प्रक्रिया ड्रोसोफिला मेलानोगास्टर की कठोर और उच्च गुणवत्ता संक्रमण अर्जित करता है। सचित्र उदाहरण मुख्य रूप से Providencia rettgeri और के साथ संक्रमण पर ध्यान केंद्रित कोलाई, लेकिन प्रोटोकॉल अत्यधिक अनुकूल है और मेजबान पालन और रखरखाव की स्थिति की एक सीमा से अधिक विविध बैक्टीरिया से संक्रमण के लिए लागू किया जा सकता है।

एक इष्टतम प्रयोगात्मक दृष्टिकोण के विवरण के संक्रमण के लिए इस्तेमाल किया जीवाणु, मेजबान के जीनोटाइप, और समग्र प्रयोगात्मक शर्तों पर निर्भर करेगा। यह दृढ़ता से किसी भी नए प्रयोगात्मक शर्तों और अधिक महत्वाकांक्षी परियोजनाओं को शुरू करने से पहले प्रायोगिक परीक्षा के लिए सिफारिश की है। एक अच्छा प्रारंभिक बिंदु एक 100 गुना सीमा पर तीन संक्रमण खुराक परीक्षण करने के लिए है। मक्खी प्रति 100 बैक्टीरियल कोशिकाओं - अति उग्र रोगज़नक़ों अक्सर सबसे अच्छा 10 के आदेश पर बहुत कम संक्रामक खुराक पर पेश कर रहे हैं। और अधिक उदार रोगज़नक़ों फ्लोरिडा के अनुसार लगभग 1,000 जीवाणुओं की अधिक मात्रा में इंजेक्ट किया जा सकतावाई, और गैर रोगज़नक़ों मक्खी प्रति 10,000 बैक्टीरिया के रूप में उच्च मात्रा में इंजेक्ट किया जा सकता है। यह एक अनुदैर्ध्य समय श्रृंखला पर रोगज़नक़ लोड, मेजबान मृत्यु दर, और प्रतिरक्षा प्रणाली गतिविधि पर नज़र रखने से उपन्यास में संक्रमण के कैनेटीक्स परिभाषित करने के लिए अक्सर शिक्षाप्रद है। रोगज़नक़ लोड और मेजबान जीन अभिव्यक्ति की माप विनाशकारी assays के होते हैं, क्योंकि यह मापा जा रहा है कि हर समय बिंदु के लिए प्रयोग के शुरू में अलग मक्खियों को संक्रमित करने के लिए आवश्यक है।

चिढ़ या microcapillary आधारित इंजेक्शन का उपयोग करने के लिए जब तय है कि, यह फायदे और सीमाएं प्रत्येक दृष्टिकोण करने के लिए कर रहे हैं नोट करना महत्वपूर्ण है। केशिका इंजेक्शन दोनों विनय टर्गर दबाव बढ़ जाती है और लवण या निलंबित या कैरियर में भंग कर रहे हैं कि अन्य अणुओं का परिचय है, जो मक्खी, में तरल पदार्थ की एक मात्रा का परिचय। केशिका इंजेक्शन भी आवश्यक उपकरणों का एक इंजेक्शन की सुविधा या खरीद करने के लिए उपयोग की आवश्यकता है। सेप्टिक चिढ़ कोई विशेष उपकरणों और परिचय की आवश्यकता हैनगण्य मक्खी में मीडिया, और आम तौर पर मक्खियों की बड़ी संख्या को संक्रमित करने के लिए और अधिक कुशल है। हालांकि, चिढ़ संक्रमण केशिका इंजेक्शन के साथ प्राप्त किया जा सकता है कि संक्रमण खुराक पर सटीक नियंत्रण की अनुमति नहीं देते। वर्तमान प्रोटोकॉल यंत्रवत् इंजेक्शन की मात्रा को नियंत्रित करता है कि एक इंजेक्शन तंत्र पर ध्यान केंद्रित किया है, लेकिन दबाव हवा के असतत दालों पर आधारित इंजेक्शन सिस्टम भी कर रहे हैं। 20,21 ये आम तौर पर तंत्र यहाँ विशेषताओं की तुलना में अधिक महंगे हैं और प्रत्येक के लिए हवा नाड़ी की जांच की आवश्यकता होती है आदेश में सुई लगातार इंजेक्शन संस्करणों सुनिश्चित करने के लिए।

मक्खियों जंगली में बैक्टीरिया से संक्रमित हो जाते हैं प्रणालीबद्ध तरीके पर काफी बहस लेकिन बहुत कम डाटा नहीं है। कुछ जांचकर्ताओं ड्रोसोफिला रोगजनक बैक्टीरिया निगलना जब प्राकृतिक संक्रमण के बहुमत होते हैं और बैक्टीरिया बाद में एक प्रणालीगत संक्रमण की स्थापना के लिए पेट भागने में सफल रहे हैं कि मंज़ूर। हालांकि, फ़े बहुत कुछ कर रहे हैंनाम से जाना जाता डब्ल्यू बैक्टीरिया डी के पेट को पार करने में सक्षम होने के लिए मेलानोगास्टर, और यह क्षमता है कि उन मक्खियों 22,23 करने के लिए अत्यधिक घातक हैं। एक वैकल्पिक सिद्धांत में विफल रहा है शिकार के प्रयास या ectoparasitic के कण के हमले से बच के माध्यम से चर्म संबंधी चोटों को बनाए रखने के लिए नियमित रूप से मक्खियों है। इस परिकल्पना जंगली डी के लगातार संग्रह के द्वारा समर्थित है चंगा घावों (अप्रकाशित टिप्पणियों) का संकेत कर रहे हैं कि melanization स्पॉट असर मेलानोगास्टर। कण ड्रोसोफिला 24 में बैक्टीरिया के संक्रमण संचारित करने के लिए दिखाया गया है और कण द्वारा छोड़ा घाव गौणतः मधु मक्खियों 25 में बैक्टीरिया से संक्रमित हो सकते हैं। हालांकि, डी के संचालित घुन या अन्यथा अवसरवादी संक्रमण की प्रकृति में आवृत्ति छल्ली उल्लंघनों के माध्यम से मेलानोगास्टर ज्ञात नहीं है। यहाँ वर्णित प्रोटोकॉल सीधे किसी भी उपकला बाधाओं या व्यवहार immu नजरअंदाज जो मात्रात्मक इंजेक्शन के माध्यम से hemolymph में बैक्टीरिया की शुरूआत की अनुमति देता हैसामुदायिक। डी के लिए रोगजनक बैक्टीरिया को खिलाने के लिए तरीके मेलानोगास्टर Vodovar एट अल। 22 और Nehme एट अल। 23 में वर्णित किया गया है।

कई entomopathogenic बैक्टीरिया शोधकर्ताओं आराम से उनके साथ काम करने की इजाजत दी, कम या कोई मानव स्वास्थ्य के जोखिम मुद्रा। इसके अलावा, बहुत कुछ बैक्टीरिया प्रयोगात्मक हस्तक्षेप के बिना संपर्क पर ड्रोसोफिला को संक्रमित करने की क्षमता है, तो दूषित सतहों के माध्यम से एक प्रयोगशाला के माध्यम से जीवाणु संक्रमण के "महामारी" प्रसार का खतरा है या आम तौर पर बहुत कम है मक्खियों भाग निकले। बहरहाल, यह पर्याप्त रोकथाम के उपायों को भागने से संक्रमित मक्खियों को रोकने के लिए जगह में है और किसी भी मक्खियों से बच वापसी के लिए कर रहे हैं कि यह सुनिश्चित करने के लिए उचित है। प्रयोगशाला में इस्तेमाल किया जा रहा है रोगाणुओं की कि के अनुरूप एक जैविक सुरक्षा के स्तर पर outfitted किया जाना चाहिए, और सूक्ष्म जीव विज्ञान में मानक सर्वोत्तम प्रथाओं नियोजित किया जाना चाहिए।

प्रयोगात्मक infectiयहाँ वर्णित विधि पर किसी भी मनमाने ढंग से जीवाणु के किसी भी खुराक के साथ ड्रोसोफिला मेलानोगास्टर के संक्रमण की अनुमति देता है। संक्रमण स्थापित किया गया है एक बार, यह जीवाणु प्रसार या निकासी के कैनेटीक्स को मापने के लिए मेजबान मृत्यु दर को ट्रैक करने के लिए, और मेजबान प्रतिरक्षा प्रणाली की प्रेरण परख करने के लिए सरल है। संक्रमित मक्खियों आसानी से आकार हो सकता है या संक्रमण के आकार का हो कि शारीरिक कार्यों का परीक्षण सहित अन्य प्ररूपी assays के अधीन करने के लिए किया जा सकता है। वर्णित प्रक्रियाओं, सस्ती कर रहे हैं अपेक्षाकृत कम विशेष उपकरणों की आवश्यकता होती है, और आसानी से अनुसंधान और शिक्षण प्रयोगशालाओं में से एक कोने में विभिन्न परियोजनाओं में इस्तेमाल के लिए उन्हें उत्तरदायी बनाने, सीख रहे हैं।

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics