Infecção bacteriana sistêmica e Imune Defesa Phenotypes em

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A mosca da fruta Drosophila melanogaster é um dos organismos modelo premier para estudar a função e evolução de defesa imunológica. Muitos aspectos da imunidade inata são conservadas entre insectos e mamíferos, e uma vez que a Drosophila pode ser facilmente manipulado geneticamente e experimentalmente, que são poderosos para estudar a função do sistema imunitário e as consequências fisiológicas da doença. O processo demonstrado aqui permite a infecção de moscas através da introdução de bactérias directamente na cavidade do corpo, contornando barreiras epiteliais e formas mais passivas de defesa e permitindo que o foco sobre a infecção sistémica. O procedimento inclui protocolos para medir as taxas de mortalidade de acolhimento, carga patógeno sistémica, e grau de indução do sistema imunitário do hospedeiro. Este procedimento de infecção é barato, robusto e quantitativamente reprodutível, e pode ser utilizado em estudos de genética funcional, história de vida evolucionária, e fisiologia.

Introduction

A mosca da fruta Drosophila melanogaster é um dos organismos modelo premier para estudar a função e evolução de defesa imunológica. Drosophila são baratos e fáceis de criar, são altamente passíveis de manipulação experimental, e são apoiados por uma extensa comunidade científica que desenvolveu uma ampla conjunto de ferramentas de pesquisa. Muitos aspectos da imunidade inata são conservadas entre insectos e mamíferos, incluindo a transdução de sinal mediada por receptores Toll-like e NF-kB, factores de transcrição da família de sinalização de JAK / STAT, e as respostas das vias JNK. 1,2 A função destes genes e vias lata ser consultado em D. melanogaster usando mutações ou RNAi knockdowns que as actividades de aumento ou diminuição da via. 3 - 6 Além disso, Drosophila pode ser usado para estudar as conseqüências fisiológicas de infecções e doenças, incluindo no contexto da teoria da história de vida evolutiva 7.- 9 Todos esses estudos, no entanto, depender da capacidade de infectar de forma fiável moscas experimentais sob condições de tratamento definidos. O procedimento aqui descrito apresenta um quadro metodológico para a entrega de infecções bacterianas robustos e repetíveis para Drosophila melanogaster e, posteriormente, medindo a gravidade da infecção e quantificar a resposta imune do hospedeiro.

Drosophila pode ser natural e experimentalmente infectados por uma grande variedade de parasitas e organismos patogénicos, incluindo bactérias, fungos, vírus, nematóides e vespas parasitóides. O protocolo atual está focada no fornecimento infecção bacteriana sistêmica. Muitas bactérias diferentes podem ser usados ​​para infectar as moscas, e escolha do experimentador deve basear-se nas questões científicas precisas ser perguntado. Por exemplo, isolados clínicos humanos podem ser utilizados para estudar os mecanismos de virulência da bactéria 10, ou ecologicamente isolados relevantes podem ser preferred para o estudo evolutivo 11. Algumas bactérias são patógenos competentes do D. melanogaster, proliferando em cima de infecção e causando doença host ou morte. Outras bactérias são efectivamente controlado pelo sistema imunitário do hospedeiro e aclarado em poucos dias. Nesta demonstração, Providencia rettgeri vai ser utilizado como um agente patogénico proliferativa que pode causar mortalidade hospedeiro e persiste em sobreviventes hospedeiros. Escherichia coli vai ser utilizado como um agente patogénico que não é eliminado pelo sistema imunitário do hospedeiro.

Infecção será estabelecido pela introdução de bactérias directamente para dentro da cavidade do corpo da mosca. Esta abordagem ignora barreiras epiteliais e comportamentos de proteção, permitindo a investigação de infecção sistêmica, independentemente do modo natural de transmissão. Existem dois métodos principais para estabelecer experimentalmente infecção sistêmica. Na primeira, uma nanoinjector capilares de vidro e puxado agulhas são utilizadas para injectar um número exacto debactérias na mosca. Este método tem a vantagem de permitir uma grande gama dinâmica de doses de infecção e de ser quantitativamente altamente repetível. A segunda abordagem é a de proporcionar a infecção com uma picada de agulha séptico. Esta abordagem tem as vantagens de ser rápida e não necessitando de equipamento especial. Uma vez estabelecidas as infecções, torna-se possível medir a carga sistêmica do patógeno, a mortalidade de acolhimento, e atividade do sistema imunológico induzível. É claro, qualquer número de fenótipos adicionais podem concebivelmente ser medidos em D. infectada melanogaster, incluindo pós-infecção fecundidade 12, capacidade de aprendizagem 13, estado metabólico 14, ou virtualmente qualquer outro traço que pode ser imaginado.

Protocol

1. Recolha e Preparação Flies

  1. D. Traseira melanogaster sob as condições experimentais desejados. Tome cuidado para não sobrecarregar as moscas durante a criação e certifique-se que as densidades larvais são consistentes entre os tratamentos, uma vez que as condições ambientais durante a fase larval pode afetar profundamente fenótipos de defesa imunológica durante a fase adulta. 15
  2. Recolha moscas experimentais 0-3 dias após a eclosão do caso de pupa e transferi-los para meio fresco.
  3. Casa das moscas recolhidos a uma temperatura desejada (temperaturas entre 22 ° C e 28 ° C são geralmente adequadas) até que eles são envelhecidos 5-7 dias pós-eclosão.
    NOTA: Isto permite tempo suficiente para que as moscas para completar a metamorfose e se tornam adultos maduros, mas é bem antes de senescência começa.
  4. Organizar o número desejado de moscas em um frasco separado antes da infecção, mais uma vez tendo o cuidado de evitar a superlotação.
    NOTA: Apenas males estão infectados nesta demonstração, mas é igualmente possível infectar fêmeas usando o procedimento descrito.

2. Prepare Cultura e bactérias

  1. Prepara-se uma placa mestre das bactérias escolhidas pelo menos 2 dias antes da infecção. Streak as bactérias de um stock de glicerol a 15% armazenadas indefinidamente a -80 ° C. Armazenar a placa principal, a 4 ° C durante até 2 semanas. Sempre raia das placas principais diretamente a partir do estoque de glicerol congelado. Evite passagem em série de bactérias de placa para placa, como passagem repetida em cultura pode causar bactérias a evoluir virulência atenuada.
    NOTA: Este exemplo faz uso de Providencia rettgeri e Escherichia coli.
  2. Use o seguinte procedimento para preparar uma suspensão bacteriana para injecção.
    1. Crescer uma cultura de 2 mL das bactérias por inoculação de meio estéril com uma única colónia isolada a partir da placa mestre. Deixar crescer as bactérias a fase estacionária (por exemplo, NOTA: Tanto P. rettgeri e E. coli crescer bem no caldo de Luria, a temperaturas 20-37 ° C com agitação suave.
    2. Uma vez que a cultura atingiu a fase estacionária, suavemente sedimentar as células de aprox. 600 ul da cultura em uma centrífuga de mesa (3 min a 5000 xg), descartar o sobrenadante e ressuspender as bactérias em aprox. 1000 ul de solução salina tamponada com fosfato estéril (PBS; NaCl 137 mM, KCl 2,7 mM, 10 mM de Na 2 PO 4, 1,8 mM de KH 2 PO 4, pH = 7,4).
    3. Diluir as células ressuspensas em PBS estéril para obter uma densidade óptica (OD) adequado para a bactéria a ser utilizado, medida com um espectrofotómetro como a absorvância a 600 nm. Utilizar esta suspensão para infectar as moscas.
      NOTA: A 600 = 0,1 ou 1,0, respectivamente, corresponde a cerca de 10 8 e 10 9 Providencia rettgeri ou E. coli por ml. Porque ambos viver umaND bactérias mortas contribuir para a densidade óptica, é importante para a colheita precoce culturas em fase estacionária antes cadáveres bacterianas acumular e distorcer a relação entre a densidade óptica e o número de bactérias viáveis ​​introduzidas durante a infecção.

3. infectar as moscas

NOTA: Como a imunidade Drosophila é influenciada por ritmo circadiano, é importante realizar infecções em um momento semelhante de dia através repetições experimentais 16.

3.1) Usando um Nanoinjector

  1. Preparar as agulhas de vidro para a infecção.
    1. Prepare uma agulha de vidro, puxando um capilar de vidro de borosilicato usando um extrator micropipeta.
    2. Usando fórceps, parta a ponta da agulha para criar uma abertura de cerca de 50 um de diâmetro para permitir a ejecção de líquido.
  2. Monte o injector.
    1. Inserir o O-ring de vedação e, em seguida, o sp brancoacer (grande ondulação virado para fora) no êmbolo de metal.
    2. Encher a agulha de vidro com óleo mineral usando uma seringa com uma agulha 30 G.
    3. Coloque a agulha de vidro cheio através da pinça e, em seguida, coloque o maior anel de vedação em torno de sua base, cerca de 1 mm a partir da extremidade cega da agulha.
    4. Deslize a agulha para o êmbolo de metal e suavemente aperte a pinça até seguro.
    5. Ejectar a maior parte do óleo mineral a partir do injector, mas tornar-se que ainda existe um pequeno volume de óleo no interior da agulha para actuar como uma barreira entre o injector e a suspensão bacteriana. Certifique-se de que não existem bolhas de ar dentro do óleo mineral ou suspensão bacteriana, ou entre os dois líquidos.
    6. Definir o injector ao volume desejado para injecção (entre 9 e 50 nl nl).
  3. Gerar ferindo controles.
    1. Preencha a agulha injector com PBS estéril, inserindo cuidadosamente a ponta da agulha capilar em um tubo de mídia e pressionar o botão "preencher" no injector.
      NOTA: Estéril meio de crescimento bacteriano também pode ser utilizado um controlo ferindo se a experiência requer injecção de bactérias em suspensão no seu meio de crescimento. No entanto, porque o meio de crescimento bacteriano contém componentes que podem estimular o sistema imunitário ou têm outros efeitos sobre o hospedeiro, um transportador inerte, tal como PBS é preferível.
    2. Anestesiar o número desejado de moscas sob um fluxo de luz de CO 2.
    3. Injectar as moscas no abdome anterior na superfície ventrolateral com o PBS estéril.
      NOTA: É também possível injectar moscas em outros locais, tais como a placa sternopleural do tórax, mas é importante para manter o local da injecção consistente dentro de cada experiência 17.
    4. Coloque moscas injectadas em frascos frescos com novo meio, que estabelece os frascos do seu lado até que todas as moscas se recuperaram da anestesia para evitar as moscas de tornar-se preso ao alimento. <br /> NOTA: Recomenda-se a injetar as moscas de controle PBS antes de injetar bactérias para moscas experimentais de modo a mesma agulha podem ser usados ​​para ambos os tratamentos. Não será sempre possível usar a mesma agulha para uma experiência inteira. Nesse caso, pode ser desejável para gravar agulha que foi utilizada com que moscas e para incluir a identidade da agulha como um factor experimental em análise estatística.
  4. Injectar o patógeno bacteriano.
    1. Ejetar a mídia estéril restante do injector e volte a encher a mesma agulha com a suspensão bacteriana.
    2. Repetir o procedimento acima (3.1.3), agora injectando as moscas com a suspensão bacteriana preparada no procedimento 2.2.

3.2) Com fossa séptica Pinprick

  1. Prepare a agulha para picar.
    1. Derreter o final de uma ponta de micropipeta de 200 ul e inserir um pino de 0,15 milímetros de insectos minutien no plástico fundido. Permitir que o plástico para solidificar suCH que a cavilha é mantida no lugar com aproximadamente 0,5 cm de pinos que se estendem a partir do plástico.
  2. Gerar ferindo controles.
    1. Anestesiar o número desejado de moscas sob um fluxo de luz de CO 2.
    2. Picar as moscas na placa sternopleural do tórax com a agulha, evitando os locais de fixação das asas e as pernas. Se necessário, remover suavemente moscas do pino minutien usando uma pinça macios.
      NOTA:. 17 Pricking através da cutícula do abdómen É também possível para picar as moscas em outros locais, tais como o abdómen anterior sobre a superfície ventrolateral, mas é importante para manter o local da injecção consistente dentro de cada experiência tende a ser mais difícil do que picar do tórax e por isso é menos comum.
    3. Coloque as moscas picavam em um novo frasco com novo meio mosca, colocando o frasco de lado até que todas as moscas se recuperaram da anestesia para impedir que as moscas de bevinda preso ao alimento.
  3. Introduzir a infecção bacteriana.
    1. Anestesiar o número desejado de moscas sob um fluxo de luz de CO 2.
    2. Prick cada voar no mesmo local que os controles de mídia, mergulhando a ponta do alfinete na suspensão bacteriana preparada no procedimento 2.2 antes de picar cada mosca.
    3. Coloque as moscas picavam em um novo frasco com novo meio mosca, colocando o frasco de lado até que todas as moscas se recuperaram da anestesia para impedir que as moscas de tornar-se preso ao alimento.

3.3) Avaliar a dose infecciosa Proferido

  1. Infect um conjunto de moscas como descrito acima no procedimento ou 3.1 ou 3.2, só que em vez de retornar as moscas ao frasco comida para recuperar da anestesia, colocar cada voar para um tubo de microcentrifugadora em gelo.
  2. Adicionar 250 ul de PBS a cada tubo e homogeneizar as moscas quer utilizando um pilão ou um batedor de esferas. </ Li>
  3. Placa do homogenato numa placa de agar LB, quer utilizando uma placa em espiral ou uma diluição em série.
    1. Para placa utilizando diluição em série, transferir cada homogeneizado mosca para a primeira linha de uma placa de 96 poços.
    2. Encher cada poço das restantes linhas, com 90 ul de PBS.
    3. Usando uma pipeta multicanal, tomar 10 ml da primeira linha contendo voar homogeneizado e dispensar na segunda fila.
    4. Pipeta cima e para baixo pelo menos 10 vezes para misturar bem, e em seguida, tomar 10 ul e transferir para a terceira fila. Repita este procedimento com as restantes linhas.
    5. A partir da linha inferior (mais diluída bactérias suspensão), use a pipeta multicanal para tomar 10 ml de cada poço e depósito em uma placa de LB, tendo o cuidado de que as amostras são dispensados ​​como pontos discretos que não se tocam. Repita até que todos os poços foram amostrados de cada linha, dispensando-os em ordem decrescente de diluição na placa LB. Deixar a placa à temperatura ambiente até que as manchas têm completamente embebido na placa de LB.
      NOTA: A secagem da placa LB durante alguns dias à temperatura ambiente antes da sua utilização é recomendada para assegurar que o líquido é rapidamente absorvido, minimizando a possibilidade de contacto acidental entre pontos de amostra.
  4. Incubar as placas O / N, tomando cuidado para não cobrir as placas de modo colônias permanecem pequeno e discreto.
    NOTA: Dependendo do meio de crescimento e incubação à temperatura bacteriana utilizada, as colónias derivadas de endógeno microbiota do intestino da mosca pode eventualmente aparecer no prato. No entanto, a maioria das bactérias utilizadas para a infecção patogénica crescer muito mais rapidamente do que a microbiota intestinal em agar LB a 37 ° C.
  5. Retirar as placas da incubadora quando as bactérias experimentais cresceram colónias visíveis (normalmente 8-12 horas), mas antes de Drosophila colônias microbiota intestinal aparecer (aproximadamente 36 horas). Para crescentes bactérias experimentais lentas, utilize um selectivoantibiótico no agar LB para remover quaisquer colónias a partir da flora intestinal.
  6. Contar o número de colónias de cada homogeneizado.
    1. Para placas de espiral, conte as colônias que crescem utilizando um contador de colónias automatizado que pode-se estimar a carga bacteriana por ml de homogeneizado com base no número e posição das colônias na chapa.
      NOTA: contagens em espiral são mais precisa, quando a concentração de bactérias é, no intervalo de 5 x10 2 a 5 x 10 4 bactérias por ml.
    2. Para placas no local, contar manualmente as colônias para cada mosca a partir de qualquer diluição contém 30-300 colônias e calcular o número de bactérias por ml de homogeneizado originais.

4. Caracterizar Survivorship de Infecção

  1. Ensaio de mortalidade pós-injeção.
    1. Coloque moscas infectadas e controlos feridos em frascos frescos e manter numa incubadora a uma temperatura desejada (25 ° C, com um lig 12:12ht: Recomenda ciclo escuro). Não coloque mais de 15 moscas em um único frasco, uma vez que torna-se difícil contar mais de 15 moscas de vida.
    2. Contar o número de vivos e mortos moscas a cada dia, ou mais frequentemente, se for caso disso.
    3. A fim de manter a qualidade dos alimentos, virar as moscas ao novo alimento em uma programação regular.
      1. Se o frasco para injectáveis ​​contém apenas os machos, transferi-los para frascos frescos a cada três dias. Se o frasco para injectáveis ​​contém fêmeas, a transferência para frascos frescos a cada dois dias porque progênie larval vai liquefazer o alimento, aumentando o risco de que as moscas adultas podem ficar preso e resultando em taxas de mortalidade superestimada devido à infecção.
  2. Estatisticamente analisar os dados.
    1. Sobrevivência trama como uma curva de Kaplan-Meier, o que indica a probabilidade de que um indivíduo vai sobreviver a um ponto de tempo após a injecção medido. 18 Para as curvas de sobrevivência que não atravessam, realizar comparações de pares usando um Log-Rank Test (também chamado de Mantel Cox Test) ou realizar análises mais complexas usando um dos perigos Modelo Cox proporcional, que pode incorporar vários fatores e suas interações. Para curvas de sobrevida que atravessam, realizar uma análise de Cox estratificado 17.

5. Coloque ensaio bacteriano infecção pós-

  1. Medir a carga bacteriana.
    1. Numa altura prescrita pós-injecção, repetir o procedimento utilizado para avaliar a dose infecciosa para determinar a carga bacteriana durante o curso da infecção (ver protocolo 3.3).
      NOTA: Se utilizar a placa em espiral, dilui-se homogeneizados de modo a que a suspensão bacteriana cai dentro de uma gama de 1.000 - 100.000 bacteriana por ml.
  2. Analisar os dados.
    1. Se a carga bacteriana é não-normal, ou transformar os dados para melhor aproximar uma distribuição normal ou analisar os dados utilizando análise estatística não paramétrica (por exemplo, teste de Mann-Whitney U Test). Use uma análise Box-Cox para find a transformação ideal; log natural ou de base -10 transformações de log geralmente são eficazes 19.
    2. Se os dados são suficientemente normalmente distribuídos e há apenas dois tratamentos serem contrastados, realizar um teste t para determinar se os dois tratamentos resultar em diferentes cargas bacterianas médios. Se houver várias variáveis ​​experimentais ou outros fatores potencialmente preditivos, use análise de variância (ANOVA) para determinar quais fatores são preditores significativos de carga bacteriana 19.

6. Ensaio da transcrição activação de genes do sistema imunitário

  1. Para visualizar grosseiramente activação imune após a infecção, infectar moscas transgénicas que expressam a proteína fluorescente verde (GFP) sob o controlo de um promotor de um gene do péptido antimicrobiano, tal como descrito anteriormente. 18
  2. Ver as moscas infectadas sob um microscópio de fluorescência com capacidade; Indução GFP deve tornar-se visible no corpo de gordura no interior da primeira 6-10 horas após a infecção.
  3. Para a quantificação mais precisa da activação imunitária, utilizar PCR quantitativo em molde de ADNc (qRT-PCR) para medir a abundância de transcritos de genes de péptidos antimicrobianos.
    NOTA: A expressão dos genes do sistema imunológico pode ser medido em qualquer momento após a infecção (ou antes). De um modo geral, a indução da expressão do gene imunitário começa cerca de quatro horas após a injecção e aumenta durante as próximas 24 horas.
    1. Anestesiar moscas usando CO 2.
    2. Coloque 15 moscas em um tubo de microcentrífuga para cada extração de RNA.
      NOTA: Recomenda-se a coletar pelo menos três amostras idênticas para cada condição de tratamento.
    3. Extracto de RNA da moscas e gerar ADNc de primeira cadeia usando qualquer um de uma série de procedimentos padrão ou kits comerciais. ARN Armazenar a -80 ° C. ADNc Armazenar a -20 ° C durante períodos de algumas semanas e a -80 ° C para armazenamento a longo prazo. Antes da extração de RNA, loja de fencontra-se a -80 ° C.
    4. Executar PCR quantitativa (qPCR) em genes alvo de interesse, utilizando o ADNc como molde. Consulte a Tabela 1 para as sequências de iniciadores para amplificar os genes de péptidos antibacterianos Diptericin A, Drosomycin, defensina, atacina A, e Metchnikowin, bem como o gene de controlo rp49 arrumação (também conhecido como rpL32).
      NOTA: Os genes que codificam os péptidos antimicrobianos Diptericin A e Drosomycin fornecer muito boas leituras de D. melanogaster atividade imunológica induzida principalmente pelas vias IMD e Toll, respectivamente. A fim de controlar a variação de amostra-a-amostra com um rendimento de ARN e a eficiência da transcrição reversa, padronizar a expressão de genes alvo gravada contra um gene de referência arrumação cuja expressão não se espera que altere com a infecção, tais como rp49 (também conhecidos como RPL 32).
    5. Analisar os dados. <ol>
    6. Por aproximação grosseira de diferenças de expressão, calcula o rácio entre o valor de quantidade de partida (SQ), obtido a partir do gene de teste (por exemplo, Diptericin A) em relação ao valor SQ obtida a partir do gene de referência (por exemplo, rp49) para cada amostra (calculado como SQ - DPTA / SQ - rp49). Escalar esses rácios para um tratamento de controle de linha de base, como um controle manipulação não infectado. Arbitrariamente definir o nível de expressão de controle igual a 1,0 e visualizar tratamentos experimentais como mudanças dobra relativos. Estimar o valor para cada gene SQ contra uma curva padrão gerada a partir de uma série de diluição de quantidade conhecida de ADNc.
      NOTA: A análise estatística dos rácios pode ser complicada, pelo que esta abordagem é melhor para a aproximação rápida do que para uma análise rigorosa. Se a eficiência da PCR é baixa, projetar novos primers para melhorar a cinética de PCR se possível. Para reações de qPCR com quase perfeita eficiência (adoubling de produto de PCR a cada ciclo), o ciclo limiar (C T) pode ser substituído pelo valor SQ.
    7. Para as experiências simples com amplificação optimamente eficaz, os dados podem ser analisados ​​usando o método ΔΔC t. 19 Para cada amostra, subtrair o valor de C T o gene de referência (por exemplo, rp49) do C T do gene de teste (por exemplo., Diptericin A) para se obter um ôc T. Em seguida, subtrair o ôc T de controlo de linha de base a partir do ôc T para cada amostra experimental, para se obter um valor ΔΔC T para cada amostra; este ΔΔC T é indicativa de diferenças relativas nos níveis de expressão do gene entre os tratamentos, onde 2 (-ΔΔCT) se aproxima da mudança vezes na expressão.
      NOTA: Esta análise pode dobrar-mal desestimar mudança na expressão do gene alvo por PCR se o gene de qualquer teste ou de referência agene tem baixa eficiência.
    8. Para a análise mais rigorosa, conduzir a análise de variância (ANOVA), utilizando a expressão estimada do gene de teste (por exemplo, Diptericin A) como variável de resposta e expressão estimado do gene de controlo (por exemplo, rp49) e outros factores experimentais como variáveis ​​explanatórias.
      NOTA: Esta abordagem é relativamente robusta a ineficiência na amplificação por PCR e permite a análise de projetos experimentais mais complicadas.

Representative Results

Esta secção ilustra os resultados que podem ser obtidos após a infecção bacteriana de Drosophila melanogaster. A Figura 1 mostra que a dose de infecção varia com a densidade óptica da suspensão bacteriana utilizada para a injecção, e que a dose administrada pode ser estimado de forma fiável por homogeneização e revestimento voa imediatamente após a injecção . Tal como ilustrado na Figura 2, diferentes agentes patogénicos podem causar diferentes níveis de mortalidade de acolhimento (Figura 2A) e de mortalidade hospedeira pode ser (Figura 2B), dependente da dose. Importante, este protocolo permite que diferentes tipos de infecções a atingir: Providencia rettgeri pode causar uma infecção crónica, sub-letal que persiste durante 20 dias ou mais (Figura 3A). No entanto, outras bactérias como Escerichia coli vai ser maioritariamente apuradas pela mosca acolhimento no prazo de seis horas após a infecção (Figura 3B). A indução dos sys imunesTEM pode ser estimado através do isolamento de ARN e subsequente qRT-PCR de transcritos de péptidos antibacterianos (Figura 4A e B). De forma análoga, mas menos quantitativamente, moscas expressando GFP sob o controlo de promotores de gene de um péptido antimicrobiano pode ser utilizado para visualizar a indução do sistema imunitário (Figura 4C).

Figura 1
. Figura 1: Determinação Dose Infecciosa Moscas foram injectados com 50 nl de suspensões bacterianas que cobrem uma gama de densidades ópticas (,0001-,05). As moscas foram imediatamente homogeneizados e plaqueados para determinar o número de bactérias introduzidas por injecção. A carga bacteriana inicial se correlaciona fortemente com o OD inicial injectado (r 2 = 0,96)

Figura 2
(A), as moscas de tipo selvagem foram injetados com aproximadamente 5.000 bactérias a partir de uma das três espécies diferentes. A taxa de mortalidade do hospedeiro depende fortemente das espécies bacterianas utilizadas para a infecção. (B) Tipo Selvagem moscas foram injectados com três doses diferentes de Enterococcous faecalis - 50, 500, e 5.000 bactérias por mosca. Moscas morrem mais rapidamente quando infectados com doses superiores infecciosas (C) Um mutante sistema imunológico e sua linha de controle isogênica de tipo selvagem foram injetados com aproximadamente 500 Burkholderia cepacia. Uma comparação aos pares de Log-Rank mostra que o de tipo selvagem mosca sobrevive à infecção significativamente melhor do que o mutante (χ 2 = 59,02, df = 1, p <0,0001).


Figura 3:. A carga bacteriana após injeção moscas foram injectados com aproximadamente (a) 5000 P. rettgeri (B) 3400 E. coli. A carga bacteriana foi determinada imediatamente após a injecção e em vários pontos de tempo subsequentes. Cada ponto de dados representa a carga bacteriana de uma única mosca. E. coli é rapidamente eliminado do anfitriões desafiados enquanto P. rettgeri persistir para o resto da vida do hospedeiro ,.

Figura 4
Figura 4: Indução de Expressão Gênica imune após a injeção. (A) As moscas foram injectados com 50 nl de P. PBS rettgeri ou estéril tanto no abdómen ou tórax, ou foram deixados de lado unmanipulated de CO Diptericin Um gene foi determinada por meio de qRT-PCR. (A) Os níveis de expressão são representados graficamente como a razão entre Diptericin A transcrição de rp49 transcrição e dimensionado de tal modo que o controlo de CO 2 é definida como possuindo um nível de expressão 1. As barras representam a média e o erro padrão de rácios de cada condição (n = 4). Níveis (B) de expressão são representadas graficamente como um ΔΔCT 2 com o valor de C T média de CO 2 aesthesia moscas de controle usados ​​como a condição não induzida padrão. As barras representam o erro médio e padrão da ΔΔC T a partir de cada condição (n = 4). Embora não exista uma diferença na indução da transcrição devido ao local de injecção, a comparação dos painéis A e B mostra como o método ΔΔC T pode potencialmente sobrestimar os níveis de indução. (C) Moscas que expressa GFP sob o controle do promotor Diptericin A foram injectados com 50 nl de P. rettgeri (OD = 0,1) e em seguida trabalhada 7 dias mais tarde. O painel GFP mostra a expressão de GFP no corpo de gordura abdominal de moscas infectadas, indicando ativação do Diptericin Um promotor em moscas infectadas por bactérias, mas não controles injecção de mídia.

Gene Para a frente Reversa
rp49 (também chamado rpL32) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
A Diptericin 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensina 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
A atacina 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

Tabela 1: Iniciadores de qRT-PCR.

Discussion

O procedimento descrito aqui produz infecção rigorosa e de alta qualidade de Drosophila melanogaster. Os exemplos ilustrados focado principalmente na infecção com Providencia rettgeri e E. coli, mas o protocolo é extremamente adaptável e pode ser aplicada a diversas infecções com bactérias ao longo de um intervalo de condições de criação de acolhimento e de manutenção.

Os detalhes de uma abordagem experimental óptimo dependerá da bactéria utilizada para a infecção, o genótipo do hospedeiro e as condições experimentais gerais. É altamente recomendável para teste piloto quaisquer novas condições experimentais antes de iniciar projetos mais ambiciosos. Um bom ponto de partida é testar três doses de infecção ao longo de um intervalo de 100 vezes. Altamente patógenos virulentos são muitas vezes melhor introduzido em doses infecciosas muito baixos, na ordem de 10-100 células bacterianas por mosca. Agentes patogénicos mais moderadas podem ser injectados com doses mais elevadas de cerca de 1.000 bactérias por FLY, e não-patogénicos pode ser injectado em doses tão elevadas como 10.000 bactérias por mosca. Muitas vezes, é instrutivo para definir a cinética de infecções novas, acompanhando carga de patógenos, a mortalidade de acolhimento, e atividade do sistema imunológico através de uma série de tempo longitudinal. Como medida de carga de patógenos e de expressão génica do hospedeiro são ensaios destrutivos, é necessário infectar moscas distintas no início da experiência para cada ponto de tempo que é para ser medida.

Ao decidir se quer usar ou picada de agulha de injeção baseada microcapilar, é importante notar que há vantagens e limitações de cada abordagem. Injecção capilar apresenta um volume de líquido para dentro da mosca, que tanto aumenta modestamente a pressão de turgescência e introduz sais ou outras moléculas que estão suspensos ou dissolvidos no veículo. Injeção capilar também exige o acesso a uma instalação de injecção ou compra do equipamento necessário. Alfinetada fossa séptica não requer nenhum equipamento especial e introduzmídia negligenciáveis ​​na mosca, e é normalmente mais eficiente para infectar um grande número de moscas. No entanto, as infecções pinprick não permitem o controlo preciso sobre a dose de infecção que pode ser conseguido com injecção capilar. O presente protocolo focada em um aparelho de injecção que regula mecanicamente volume de injecção, mas também são baseados em sistemas de injecção de pulsos discretos de ar pressurizado. 20,21 Estes são tipicamente mais caro do que o aparelho apresentado aqui e requerem calibração do impulso de ar para cada agulha, a fim de assegurar o volume de injecção consistente.

Há um debate considerável, mas muito poucos dados sobre como se tornar sistemicamente moscas infectadas com a bactéria em estado selvagem. Alguns investigadores postulam que a maioria das infecções naturais ocorrem quando Drosophila ingerir bactérias patogénicas e as bactérias são capazes de escapar posteriormente do intestino para estabelecer uma infecção sistémica. No entanto, existem muito few bactérias conhecidas como sendo capazes de atravessar o intestino de D. melanogaster, e aqueles que têm essa capacidade são altamente letal para moscas 22,23. Uma teoria alternativa é que voa regularmente sustentar os ferimentos cuticulares através de fuga de tentativas fracassadas de predação ou o ataque de ácaros ectoparasitas. Esta hipótese é apoiada pela coleta frequente de D. selvagem melanogaster tendo pontos melanização que são indicativos de feridas cicatrizadas (observações não publicadas). Os ácaros foram mostrados para transmitir infecções bacterianas em Drosophila 24 e feridas deixadas por ácaros pode ser secundariamente infectadas por bactérias em abelhas de mel 25. No entanto, a freqüência na natureza da infecção do ácaro-driven ou de outra forma oportunista de D. melanogaster através de violações de cutícula não é conhecido. O protocolo descrito aqui permite introdução de bactérias diretamente na hemolinfa através de injeção quantitativo que ignora quaisquer barreiras epiteliais ou IMMU comportamentaisnidade. Métodos para a alimentação de bactérias patogénicas para D. melanogaster têm sido descritos em Vodovar et al. 22 e Nehme et ai. 23.

Muitas bactérias entomopatogênicos representam pouco ou nenhum risco a saúde humana, permitindo aos pesquisadores para trabalhar com eles confortavelmente. Além disso, muito poucas bactérias têm a capacidade de infectar de Drosophila em contacto sem intervenção experimental, de modo que o risco de "epidemia" propagação da infecção bacteriana através de um laboratório através de superfícies contaminadas ou escapou moscas é geralmente muito baixa. No entanto, é aconselhável para assegurar que as medidas de contenção adequados estão no lugar para evitar moscas infectadas de escapar e para recapturar qualquer escapou moscas. O laboratório deve ser equipado com um nível de segurança biológica comensurável com a dos agentes patogénicos que está sendo utilizado, e melhores práticas padrão em microbiologia deve ser empregue.

O infecti experimentalno método descrito aqui permite infecções de Drosophila melanogaster com qualquer dose de qualquer bactéria arbitrária. Uma vez que a infecção tenha sido estabelecido, é simples para medir a cinética de proliferação bacteriana ou recarga, para acompanhar a mortalidade hospedeiro, e a ensaio de indução do sistema imunitário do hospedeiro. Moscas infectadas podem facilmente ser submetido a outros ensaios fenotípicos, incluindo testes de funções fisiológicas que podem moldar ou ser moldados pela infecção. Os procedimentos descritos são baratos, requerem relativamente pouco equipamento especializado, e são facilmente aprendido, tornando-os propícios para o uso em diversos projetos através de uma amplitude de laboratórios de pesquisa e de ensino.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics