Systemische bacteriële infectie en afweer Phenotypes in

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De fruitvlieg Drosophila melanogaster is een van de belangrijkste model organismen voor het bestuderen van de functie en de evolutie van de afweer. Vele aspecten van de aangeboren immuniteit zijn geconserveerd tussen insecten en zoogdieren, en aangezien Drosophila gemakkelijk genetische en experimenteel kunnen worden gemanipuleerd, krachtig zijn voor het bestuderen van het immuunsysteem en de fysiologische gevolgen van de ziekte. De hier gedemonstreerd maakt infectie van vliegen door het inbrengen van bacteriën direct in de lichaamsholte, omzeilen epitheliale barrières en meer passieve verdediging en waardoor de nadruk op systemische infectie. De procedure omvat protocollen voor het meten van snelheden van gastheer sterfte, systemische pathogenen, en de mate van inductie van het gastheerimmuunsysteem. Deze infectie procedure is goedkoop, robuust en kwantitatief herhaald en kan worden gebruikt in studies van functionele genetica, evolutionaire levensloop en fysiologie.

Introduction

De fruitvlieg Drosophila melanogaster is een van de belangrijkste modelorganismen voor het bestuderen van de functie en de ontwikkeling van immune afweer. Drosophila zijn goedkoop en gemakkelijk kweken, zijn zeer vatbaar voor experimentele manipulatie en worden ondersteund door een uitgebreide wetenschappelijke gemeenschap dat een breed ontwikkeld reeks van research tools. Veel aspecten van aangeboren immuniteit worden geconserveerd tussen insecten en zoogdieren, waaronder signaaltransductie gemedieerd door Toll-like receptoren en NF-kB familie transcriptiefactoren, JAK / STAT signalering en JNK pathway reacties. 1,2 De functie van deze genen en paden kan worden opgevraagd in D. melanogaster middels mutaties of RNAi knockdowns deze verhoging of verlaging pathway activiteiten 3 -. 6 Daarnaast Drosophila kan worden gebruikt om de fysiologische gevolgen van infectie en ziekte te bestuderen, zoals in de context van de evolutionaire levensloop theorie 7.- 9 Al deze studies echter afhangen van het vermogen om op betrouwbare infecteren experimentele vliegen onder gedefinieerde behandelingsomstandigheden. De hier beschreven procedure geeft een methodologisch raamwerk voor het leveren robuuste en herhaalbare bacteriële infecties Drosophila melanogaster en vervolgens meten infectie ernst en kwantificeren van de immuunrespons van de gastheer.

Drosophila kan natuurlijk en experimenteel geïnfecteerd met diverse parasieten en pathogenen, waaronder bacteriën, schimmels, virussen, nematoden en sluipwespen. Het huidige protocol is gericht op het leveren van systemische bacteriële infectie. Veel verschillende bacteriën kunnen worden gebruikt om vliegen te infecteren, en de keuze van de experimentator moet worden gebaseerd op de precieze wetenschappelijke vragen worden gesteld. Bijvoorbeeld kunnen menselijke klinische isolaten worden toegepast om bacteriële virulentie mechanismen 10 studeren of ecologisch relevante isolaten kunnen worden preferred voor evolutionair onderzoek. 11 Sommige bacteriën zijn bevoegde ziekteverwekkers van D. melanogaster, uitdijende na infectie en het veroorzaken van gastheer ziekte of dood. Andere bacteriën effectief worden beheerd door het gastheerimmuunsysteem en opgeruimd binnen enkele dagen. In deze demonstratie wordt Providencia rettgeri gebruikt als een proliferatieve ziekteverwekker die gastheer sterfte kunnen veroorzaken en blijft in overlevende gastheren. Escherichia coli wordt gebruikt als een niet-pathogeen die wordt gewist door het gastheerimmuunsysteem.

Infectie wordt vastgesteld door het inbrengen van bacteriën direct in de lichaamsholte van de vlieg. Deze aanpak omzeilt epitheliale barrières en beschermende gedrag, waardoor onderzoek naar systemische infectie, ongeacht de natuurlijke wijze van overdracht. Er zijn twee primaire werkwijzen voor experimenteel vaststelling van systemische infectie. In de eerste, een nanoinjector en getrokken glazen capillaire naalden worden gebruikt om een ​​exact aantal spuitenbacteriën in de vlieg. Deze methode heeft het voordeel van het toestaan ​​van een groot dynamisch bereik van infectie doses en kwantitatief hoge herhaalbaarheid. De tweede benadering is om infectie te leveren met een septische speldenprik. Deze aanpak heeft het voordeel dat het snel en vereist geen speciale apparatuur. Zodra de infecties zijn vastgesteld, wordt het mogelijk om systemische pathogenen talrijke mortaliteit en induceerbare immuunsysteem te meten. Natuurlijk kan elk aantal bijkomende fenotypen denkbaar gemeten in geïnfecteerde D. melanogaster, met inbegrip van post-infectie vruchtbaarheid 12, leervermogen 13, metabole status van 14, of vrijwel elke andere eigenschap die kan worden gedacht.

Protocol

1. Verzamelen en Bereid Flies

  1. Achter D. melanogaster onder de gewenste experimentele omstandigheden. Zorg ervoor dat u de vliegen overcrowd tijdens de opfok en zorg ervoor dat larvale dichtheden consistent behandelingen, omdat milieu-omstandigheden tijdens de larvale stadium diepgaand kunnen beïnvloeden afweer fenotypes tijdens volwassen stadium. 15
  2. Verzamel experimentele vliegt 0-3 dagen na Eclosion van de pupal geval en over te brengen naar vers medium.
  3. Huis verzameld vliegen op een gewenste temperatuur (temperaturen tussen 22 ° C en 28 ° C zijn in het algemeen geschikt) totdat zij de leeftijd 5 - post-verpopping 7 dagen.
    NB: Dit laat voldoende tijd voor de vliegen om metamorfose voltooien en word volwassen volwassenen, maar is goed voor veroudering begint.
  4. Sorteer de gewenste aantal vliegen in een apart flesje voorafgaand aan infectie, opnieuw zorg ervoor dat overbevolking te voorkomen.
    OPMERKING: Alleen males geïnfecteerd in deze demonstratie, maar is evenzeer mogelijk vrouwtjes gebruik van de beschreven procedure infecteren.

2. Cultuur en Bereid Bacteriën

  1. Bereid een meester plaat van de gekozen bacteriën ten minste 2 dagen voor infectie. Streak de bacteriën uit een 15% glycerol gedurende onbeperkte tijd bewaard bij -80 ° C. Bewaar de meester plaat staan ​​bij 4 ° C gedurende maximaal 2 weken. Altijd streak de meester platen direct uit de bevroren glycerol voorraad. Vermijd seriële passage van de bacteriën uit de plaat tot het bord, zoals herhaalde passage in cultuur kan veroorzaken bacteriën verzwakte virulentie evolueren.
    OPMERKING: Dit voorbeeld maakt gebruik van Providencia rettgeri en Escherichia coli.
  2. Gebruik de volgende procedure om een ​​bacteriële suspensie te bereiden voor injectie.
    1. Kweek een cultuur 2 ml van bacteriën door het enten steriel medium met een enkele kolonie geïsoleerd van de meester plaat. Groeien de bacteriën stationaire fase (bv OPMERKING: Zowel P. rettgeri en E. coli goed groeien in Luria Broth bij temperaturen 20-37 ° C onder zachtjes schudden.
    2. Nadat de kweek de stationaire fase bereikt voorzichtig pellet cellen van ca. 600 ul van de cultuur in een tafelblad centrifuge (3 min bij 5.000 xg), gooi het supernatant en resuspendeer de bacteriën in ong. 1000 uit steriel met fosfaat gebufferde zoutoplossing (PBS, 137 mM NaCl, 2,7 mM KCI, 10 mM Na 2PO 4, 1,8 mM KH 2PO 4, pH = 7,4).
    3. Verdun de cellen geresuspendeerd in steriele PBS tot een optische dichtheid (OD) geschikt zijn voor de bacterie wordt gebruikt, gemeten met een spectrofotometer als de extinctie bij 600 nm te bereiken. Gebruik deze schorsing aan de vliegen te infecteren.
      Opmerking: A 600 = 0,1 of 1,0 respectievelijk overeen met ongeveer 10 8 en 10 9 Providencia rettgeri en E. coli per ml. Omdat zowel live eennd dode bacteriën bijdragen aan optische dichtheid, is het belangrijk cultures begin van stationaire fase oogsten voor bacteriële lichamen verzamelen en vervormen het verband tussen de optische dichtheid en het aantal levensvatbare bacteriën die tijdens infectie.

3. Infect the Flies

OPMERKING: Omdat Drosophila immuniteit wordt beïnvloed door circadiane ritme, is het belangrijk om infecties te voeren op een soortgelijke tijdstip tussen experimentele replicaten 16.

3.1) Met behulp van een Nanoinjector

  1. Bereid de glazen naalden voor infectie.
    1. Bereid een glazen naald door te trekken een borosilicaatglas capillair met behulp van een micropipet trekker.
    2. Behulp van een tang, afbreken van de punt van de naald een opening van ongeveer 50 urn diameter creëren uitwerpen van vloeistof mogelijk.
  2. Monteer de injector.
    1. Plaats de afdichtende O-ring en de witte spacer (grote kuiltje naar buiten gericht) op de metalen zuiger.
    2. Vul het glas naald met minerale olie met behulp van een spuit met een 30 G naald.
    3. Plaats de gevulde glazen naald door de kraag en plaats de grotere O-ring rond de basis, ongeveer 1 mm vanaf het stompe einde van de naald.
    4. Schuif de naald op de metalen zuiger en voorzichtig schroef op de kraag tot veilig.
    5. Werp de meeste van de minerale olie uit de injector, maar zorg ervoor dat er nog een kleine hoeveelheid olie in de naald op te treden als een barrière tussen de injector en de bacteriesuspensie. Zorg ervoor dat er geen luchtbellen in de minerale olie of bacteriële suspensie, of tussen de twee vloeistoffen.
    6. Stel de injector op het gewenste volume voor injectie (tussen 9 en 50 nl nl).
  3. Genereer verwonden controles.
    1. Vul het verstuivernaald met steriele PBS door voorzichtig de tip van de capillaire naald in een buis van de media en pressing de "vullen" knop op de injector.
      OPMERKING: Steriele bacteriële groeimedia kan ook een verwonding bestrijding wanneer het experiment vereist injectie van bacteriën gesuspendeerd in het kweekmedium. Omdat bacteriële groeimedia bevat componenten die het immuunsysteem stimuleren of andere effecten op de gastheer, een inerte drager, zoals PBS voorkeur.
    2. Verdoven het gewenste aantal vliegen onder een lichte stroom van CO 2.
    3. Injecteer de vliegen in de voorste buik op het ventrolaterale oppervlak met steriele PBS.
      Opmerking: Het is ook mogelijk om vliegen op andere plaatsen, zoals de sternopleural plaat van de thorax te injecteren, maar het is belangrijk om de injectieplaats consistenter elk experiment te houden 17.
    4. Plaats geïnjecteerd ongedierte in verse flesjes nieuwe medium, legt de flesjes op hun kant tot alle vliegen hersteld zijn van de verdoving te voorkomen dat de vliegen raakt vast aan het eten. <br /> NB: Het wordt aanbevolen om de PBS controle vliegen injecteren alvorens te injecteren bacteriën om experimentele vliegen zodat dezelfde naald kan worden gebruikt voor zowel behandelingen. Het is niet altijd mogelijk om dezelfde naald te gebruiken voor een hele experiment. In dat geval kan het wenselijk zijn om registreren welke naald werd gebruikt waarmee vliegt en naald identiteit als experimentele factor statistische analyse eveneens zijn.
  4. Injecteer de bacteriële ziekteverwekker.
    1. Werp de resterende steriele media uit de injector en vul dezelfde naald met de bacteriële suspensie.
    2. Herhaal de bovenstaande procedure (3.1.3), nu het injecteren van de vliegen met de bacteriële suspensie bereid in procedure 2.2.

3.2) Met Septic Pinprick

  1. Bereid de naald voor prikken.
    1. Smelt het einde van een 200 ul micropipet tip en plaats een 0,15 mm insect minutien pen in het gesmolten plastic. Laat de plastic stollen such waar de pen wordt bevestigd met ongeveer 0,5 cm van de pen uitstrekt van de kunststof.
  2. Genereer verwonden controles.
    1. Verdoven het gewenste aantal vliegen onder een lichte stroom van CO 2.
    2. Prik de vliegen in de sternopleural plaat van de thorax met de naald, het vermijden van de aanhechtingsplaatsen van de vleugels en de benen. Indien nodig, verwijder voorzichtig vliegen uit de minutien pin met zachte tang.
      Opmerking. Het is ook mogelijk de vliegen op andere plaatsen, zoals de anterieure buik op het ventrolaterale oppervlak prikken, maar het is belangrijk om de injectieplaats consistenter elk experiment te houden 17 prikken door de cuticula van het abdomen neigt more moeilijker dan prikken van de thorax en daardoor minder vaak.
    3. Plaats de geprikt vliegen in een schoon flesje nieuwe fly medium, legt de flacon op de zijkant zodat alle vliegen hersteld zijn van de verdoving naar de vliegen uit BE voorkomingkomst vast aan het voedsel.
  3. Introduceer de bacteriële infectie.
    1. Verdoven het gewenste aantal vliegen onder een lichte stroom van CO 2.
    2. Prik elke vliegen op dezelfde locatie als de media controles, dompelen de punt van de pen in de bacteriële suspensie bereid in procedure 2.2 voordat prikt elke vliegen.
    3. Plaats de geprikt vliegen in een schoon flesje nieuwe fly medium, legt de flacon op de zijkant zodat alle vliegen hersteld zijn van de verdoving te voorkomen dat de vliegen raakt vast aan het eten.

3.3) Beoordelen van de Infectious Dose Geleverd

  1. Infect een aantal vliegen zoals hierboven in beide procedures 3.1 en 3.2, maar in plaats van terug de vliegen om voedsel flacon te herstellen van de anesthesie is zet vliegen in een microcentrifuge buis op ijs.
  2. Voeg 250 ul PBS aan elk buisje toe en homogeniseer de vliegen hetzij met behulp van een stamper of een bead beater. </ Li>
  3. Plate het homogenaat op een LB agar plaat, hetzij met behulp van een spiraal Plater of een seriële verdunning.
    1. Om plaat middels seriële verdunning breng elke vlieg homogenaat bij de eerste rij van een 96 putjesplaat.
    2. Vul elk putje van de resterende rijen 90 ui PBS.
    3. Met behulp van een multichannel pipet, nemen 10 ul van de eerste rij met vliegen homogenaat en afzien in de tweede rij.
    4. Pipet op en neer ten minste 10 keer om grondig te mengen, en neem vervolgens 10 ul en over te dragen aan de derde rij. Herhaal deze procedure met de andere rijen.
    5. Vanaf de onderste rij (de meeste verdunde bacteriën schorsing), gebruik dan de multichannel pipet tot 10 pi uit elk putje en deposito mee op een LB plaat, zorg dat de monsters worden afgeleverd als afzonderlijke plekken die elkaar niet raken. Herhaal dit totdat alle putten zijn bemonsterd uit elke rij, doseren in afnemende volgorde van verwatering op de LB plaat. Laat de plaat bij kamertemperatuur tot de plekken volledig zijn gedrenkt in de LB plaat.
      Opmerking: Het drogen van de LB plaat gedurende enkele dagen bij kamertemperatuur voorafgaand aan gebruik wordt aanbevolen dat de vloeistof wordt geabsorbeerd, het minimaliseren van de kans op onbedoeld contact tussen monster spots.
  4. Incubeer de platen O / N, het verzorgen van de platen niet te overwoekeren zo kolonies klein en discreet blijven.
    OPMERKING: Afhankelijk van de groei van bacteriën medium en incubatietemperatuur gebruikt, kan kolonies afgeleid van de vlieg endogene darmflora uiteindelijk verschijnen op het bord. Echter, de meeste bacteriën die op pathogene infectie veel sneller groeien dan de darmflora op LB-agar bij 37 ° C.
  5. Verwijder platen uit de incubator als de experimentele bacteriën zichtbare kolonies zijn gegroeid (gewoonlijk 8-12 uur), maar vóór Drosophila darmflora kolonies verschijnen (ongeveer 36 uur). Voor langzaam groeiende experimentele bacteriën, gebruik maken van een selectieveantibioticum in de LB agar elke kolonies van de darmflora te verwijderen.
  6. Tel het aantal kolonies per homogenaat.
    1. Voor spiraalvormige platen, de kolonies die groeien onder toepassing van een geautomatiseerde kolonieteller welke schatten bacteriële verontreiniging per ml homogenaat basis van het aantal en de positie van de kolonies op de plaat.
      OPMERKING: Spiraalvormige tellingen meest nauwkeurig wanneer de bacteriële concentratie in het traject van 5 x 02-05 oktober 4 x 10 bacteriën per ml.
    2. Voor spot platen, handmatig de koloniën voor elke vlieg uit welke verdunning bevat 30 tellen - 300 kolonies en het berekenen van het aantal bacteriën per ml originele homogenaat.

4. karakteriseren Survivorship van infectie

  1. Assay mortaliteit na de injectie.
    1. Plaats geïnfecteerde vliegen en gewonden controles in vers flesjes en onderhouden in een incubator bij een gewenste temperatuur (25 ° C met een 0:12 light: donker cyclus wordt aanbevolen). Plaats nooit meer dan 15 vliegen in één flesje als het moeilijk wordt om meer dan 15 levende vliegen tellen.
    2. Tel het aantal levende en dode vliegen elke dag, of vaker indien nodig.
    3. Om de kwaliteit van het voedsel te behouden, draai de vliegen om nieuwe voedsel op een regelmatig schema.
      1. Als de flacon bevat alleen mannen, overbrengen naar verse flesjes om de drie dagen. Als de flacon bevat vrouwtjes, over te dragen aan verse flesjes per twee dagen, omdat de larven nageslacht het voedsel vloeibaar te maken, waardoor het risico dat de volwassen vliegen kan vast komen te zitten en dat resulteert in overschat tarieven van de sterfte als gevolg van infectie.
  2. Statistisch analyseren van de gegevens.
    1. Plot overleven als een Kaplan-Meier curve, die de kans dat een individu zal overleven tot een gemeten tijd-punt na de injectie. 18 voor survival curves die niet kruisen, voert paarsgewijze vergelijkingen met behulp van een Log-Rank T geeftest (ook wel Mantel Cox Test) of meer complexe analyses met behulp van een Cox proportionele risico model, waarin verschillende factoren en hun interacties kunnen nemen uitvoeren. Voor overlevingscurven die elkaar kruisen, het uitvoeren van een gestratificeerd Cox analyse. 17

5. Assay Bacteriële Load Post-infectie

  1. Meet bacteriële verontreiniging.
    1. Op een voorgeschreven tijd na de injectie, herhaalt u de procedure die wordt gebruikt om infectieuze dosis te evalueren om bacteriële belasting in de loop van de infectie te bepalen (zie protocol 3.3).
      LET OP: Als u de spiraal Plater, verdunnen homogenaten zodat de bacteriële suspensie binnen een bereik van 1000 valt - 100.000 bacteriën per ml.
  2. Analyseer de gegevens.
    1. Als hoeveelheid bacteriën niet normaal, hetzij transformeren de gegevens beter benaderen normaalverdeling of data met behulp van niet-parametrische statistische analyse (bijvoorbeeld Mann-Whitney U test) geanalyseerd. Gebruik een Box-Cox analyse find de optimale transformatie; natuurlijke log of base -10 log transformaties zijn vaak effectief. 19
    2. Als de gegevens voldoende normaal verdeeld en er zijn slechts twee behandelingen worden gecontrasteerd, een t-test uitgevoerd om te bepalen of de twee behandelingen resulteren in verschillende gemiddelde bacteriële belastingen. Als er meerdere experimentele variabelen of andere potentieel voorspellende factoren Gebruik Variantie-analyse (ANOVA) om te bepalen welke factoren significante voorspellers van bacteriële verontreiniging zijn. 19

6. Assay Transcriptionele Activering van Immune System Genes

  1. Om grof visualiseren immuunactivatie na infectie, infecteren transgene vliegen die groen fluorescent proteïne (GFP) onder de controle van een promoter van een antimicrobieel peptide-gen tot expressie zoals eerder beschreven. 18
  2. Bekijk de besmette vliegen onder een fluorescentie-microscoop in staat is; GFP inductie moet visib gewordenle in het vet lichaam binnen de eerste 6 - 10 uur na infectie.
  3. Voor nauwkeurigere kwantificering van immuunactivatie gebruik van kwantitatieve PCR op cDNA template (qRT-PCR) de overvloed van antimicrobiële peptiden gentranscripten te meten.
    OPMERKING: De expressie van immune genen worden gemeten op elk tijdstip na (of vóór) infectie. In het algemeen, inductie van immune genexpressie begint ongeveer 4 uur na injectie en verhogingen in de volgende 24 uur.
    1. Verdoven vliegen met behulp van CO 2.
    2. Plaats 15 vliegt in een microfuge buis voor elke RNA-extractie.
      OPMERKING: Het wordt aanbevolen om ten minste drie identieke monsters te verzamelen voor elke behandeling conditie.
    3. Uittreksel RNA van de vliegen en het genereren van de eerste streng cDNA met behulp van elk van een aantal standaardprocedures of commerciële kits. WINKEL RNA bij -80 ° C. WINKEL cDNA bij -20 ° C voor een periode van enkele weken en bij -80 ° C voor lange termijn opslag. Voorafgaand aan de RNA-extractie, op te slaan fligt bij -80 ° C.
    4. Voer kwantitatieve PCR (qPCR) op doelgenen van belang met het cDNA als matrijs. Zie Tabel 1 voor de primersequenties voor de antibacteriële peptide genen Diptericin A, Drosomycin, defensine, Attacin A en Metchnikowin en het huishoudelijk control rp49 gen (ook bekend als rpL32) amplificeren.
      LET OP: De genen die coderen voor de antimicrobiële peptiden Diptericin A en Drosomycin zorgen voor een zeer goede uitlezingen van D. melanogaster immuunactiviteit voornamelijk veroorzaakt door de Imd en Toll paden, respectievelijk. Om te controleren voor sample-to-sample variatie in RNA opbrengst en de efficiëntie van reverse transcriptie, standaardiseren geregistreerde expressie van doelgenen tegen een referentie housekeeping gen waarvan de expressie niet verwacht veranderen infectie zoals rp49 (ook bekend als RPL 32).
    5. Analyseer de gegevens. <ol>
    6. Voor grove benadering van expressieverschillen Bereken de verhouding van de starthoeveelheid (SQ) waarde uit de tests gen (bijvoorbeeld Diptericin A) ten opzichte van de referentieoplossing gen SQ waarde (bijvoorbeeld, rp49) voor elk monster (berekend als SQ - DPTA / SQ - rp49). Schaal deze verhoudingen om een ​​baseline controle behandeling, zoals een niet-geïnfecteerde handling controle. Arbitrair de controle expressie niveau dat gelijk is aan 1,0 en visualiseren experimentele behandelingen als relatieve fold veranderingen. Schat de SQ waarde voor elk gen tegen een standaard curve gegenereerd uit een verdunningsreeks van bekende-hoeveelheid cDNA.
      OPMERKING: Statistische analyse van verhoudingen kan ingewikkeld zijn, zodat deze aanpak is beter voor snelle aanpassing dan voor een grondige analyse. Als de PCR-efficiëntie is laag, het ontwerpen van nieuwe primers PCR kinetiek te verbeteren, indien mogelijk. Voor qPCR reacties met bijna perfecte efficiency (adoubling van PCR-product elke cyclus), kan de drempel cyclus (C T) worden vervangen door de SQ waarde.
    7. Voor eenvoudige experimenten met optimaal efficiënte amplificatie, kunnen gegevens worden geanalyseerd met de ΔΔC T werkwijze. 19 Voor elk monster aftrekken van de CT-waarde van de referentie-gen (bijvoorbeeld, rp49) vanaf het C T van de proef gen (bijv., Diptericin A) een ΔC T leveren. Dan trekt u de ΔC T van de basislijn controle van de ΔC T voor elke experimentele monster naar een ΔΔC T-waarde voor elk monster opleveren; Dit ΔΔC T is een indicatie van de relatieve verschillen in genexpressie niveaus tussen de behandelingen, waarbij 2 (-ΔΔCT) benadert de vouw verandering in expressie.
      Opmerking: Deze analyse kan slecht misestimate veelvoudverandering in de expressie van het doelgen als de PCR van ofwel het testgen of de referentiegen heeft een laag rendement.
    8. Voor de meest rigoureuze analyse uitvoeren variantieanalyse (ANOVA) met de geschatte expressie van het testgen (bijv Diptericin A) als de responsvariabele en geschatte expressie van het controle gen (bijv rp49) en andere experimentele factoren als verklarende variabelen.
      OPMERKING: Deze aanpak is relatief robuust tot inefficiëntie in PCR-amplificatie en maakt analyse van meer ingewikkelde experimentele ontwerpen.

Representative Results

Deze sectie geeft resultaten die kunnen worden verkregen na bacteriële infectie van Drosophila melanogaster. Figuur 1 toont dat infectiedosis afhankelijk van de optische dichtheid van de bacteriële suspensie voor injectie, en dat de toegediende dosis betrouwbaar kan worden geschat door homogeniseren en plateren na injectie vliegt onmiddellijk . Zoals geïllustreerd in figuur 2, kunnen verschillende pathogenen maken verschillende ontvangende mortaliteit (Figuur 2A) en gastheer sterfte kan dosisafhankelijke (Figuur 2B) zijn. Belangrijk Dit protocol maakt verschillende soorten infecties te verwezenlijken: Providencia rettgeri is een chronische, subletale infectie die aanhoudt gedurende 20 dagen of langer (figuur 3A) te veroorzaken. Echter, andere bacteriën zoals Escerichia coli zal vooral worden door de gastheer vlieg binnen zes uur na infectie (Figuur 3B) gewist. Inductie van de immune systeem kan worden geschat door middel van RNA isolatie en vervolgens qRT-PCR antibacterieel peptide transcripten (figuur 4A en B). Analoog maar kwantitatief minder, vliegen die GFP onder de controle van antimicrobiële peptide-gen promoters kunnen worden gebruikt voor inductie van het immuunsysteem (figuur 4C) te visualiseren.

Figuur 1
. Figuur 1: Het bepalen van Infectieuze Dosis Vliegen werden geïnjecteerd met 50 nl van bacteriesuspensies die een reeks van optische dichtheden (,0001-,05). De vliegen werden onmiddellijk gehomogeniseerd en uitgeplaat op het aantal bacteriële ingevoerd door de injectie te bepalen. Initiële bacteriële belasting sterk correleert met de eerste OD geïnjecteerd (r 2 = 0,96)

Figuur 2
(A) wildtype vliegen werden geïnjecteerd met ongeveer 5000 bacteriën van één van drie verschillende soorten. De snelheid van de gastheer sterfte is sterk afhankelijk van de bacteriële soorten gebruikt voor infectie. (B) Wildtype vliegen werden geïnjecteerd met drie verschillende doses van Enterococcous faecalis - 50, 500, en 5000 bacteriën per vliegen. Vliegen sterven sneller wanneer besmet met hogere besmettelijke doses (C) een immuunsysteem mutant en zijn wild-type isogene controle lijn werden geïnjecteerd met ongeveer 500 Burkholderia cepacia. Een paarsgewijze Log-Rank vergelijking blijkt dat het wild-type fly overleeft de infectie significant beter dan de mutant (χ 2 = 59,02, df = 1, p <0,0001).


Figuur 3:. Van bacteriën na injectie vliegen werden geïnjecteerd met bij benadering (A) 5000 P. rettgeri (B) 3.400 E. coli. Aantal bacteriën werd bepaald onmiddellijk na injectie en op verschillende latere tijdstippen. Elk gegevenspunt vertegenwoordigt de bacteriële verontreiniging van een enkele vlieg. E. coli wordt snel geklaard uit uitgedaagd hosts terwijl P. rettgeri blijft voor de rest van het leven van de gastheer ,.

Figuur 4
Figuur 4: Inductie van Immune genexpressie na injectie. (A) vliegen werden geïnjecteerd met 50 nl van P. rettgeri of steriel PBS in hetzij de buik of de borstkas, of werden terzijde ongemanipuleerde links van CO Diptericin A gen werd bepaald met qRT-PCR. (A) Expressie niveaus grafiek weergegeven als de verhouding van Diptericin A transcript rp49 transcript en geschaald zodat de CO 2 besturing wordt gedefinieerd als een expressieniveau van 1. De staven stellen de gemiddelde en standaardfout van verhoudingen van elke omstandigheid (n = 4). (B) Expressie niveaus grafiek weergegeven als 2 ΔΔCT de gemiddelde CT-waarde van CO 2 aesthesia control vliegen gebruikt als standaard niet-geïnduceerde toestand. De staven stellen de gemiddelde en standaardfout van ΔΔC T van elke omstandigheid (n = 4). Hoewel er geen verschil in inductie transcript vanwege injectieplaats, vergeleken panelen A en B toont hoe de ΔΔC T-werkwijze mogelijk kunnen overschatten inductie levels. (C) Vliegen die GFP onder controle van de promoter Diptericin werden geïnjecteerd met 50 nl van P. rettgeri (OD = 0,1) en vervolgens afgebeeld 7 dagen later. De GFP-paneel toont de expressie van GFP in het buikvet lichaam van geïnfecteerde vliegen, met vermelding van de activering van de Diptericin A promoter in bacterieel besmette vliegen, maar niet-media geïnjecteerd controles.

Gen Vooruit Reverse
rp49 (ook wel rpL32) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin A 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensine 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin A 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

Tabel 1: Primers voor qRT-PCR.

Discussion

De hier beschreven procedure levert strenge en hoge kwaliteit infectie van Drosophila melanogaster. De weergegeven voorbeelden vooral gericht op infectie met Providencia rettgeri en E. coli, maar het protocol is zeer flexibel en kan worden toegepast voor besmetting met diverse bacteriën over een traject van gastheer wordt toegepast en onderhoudsvoorwaarden.

De data van een optimale experimentele benadering zal afhangen van de bacterie die voor infectie, het genotype van de gastheer, en de algemene experimentele omstandigheden. Het wordt sterk aanbevolen om pilot eventuele nieuwe experimentele omstandigheden voor het starten van meer ambitieuze projecten. Een goed uitgangspunt is om drie infectie doses te testen over een 100-voudig bereik. Zeer virulente pathogenen worden vaak best geïntroduceerd bij zeer lage doses besmettelijk, in de orde van 10-100 bacteriële cellen per vliegen. Gematigdere ziektekiemen worden geïnjecteerd bij hogere doses van ongeveer 1000 bacteriën per fly en niet-pathogenen worden geïnjecteerd in doses zo hoog als 10.000 bacteriën per vlieg. Vaak is het leerzaam om de kinetiek van nieuwe infecties te bepalen door het volgen pathogenen talrijke mortaliteit en activiteit van het immuunsysteem in een longitudinale tijdreeks. Door meting van pathogenen en gastheer genexpressie destructieve metingen, moet worden onderscheiden vliegen infecteren bij het begin van het experiment voor elk tijdstip dat moet worden gemeten.

Bij de beslissing om speldenprik of-microcapillaire gebaseerde injectie gebruiken, is het belangrijk om op te merken zijn er voordelen en beperkingen van elke benadering. Capillaire injectie wordt een hoeveelheid vloeistof in de vlieg, die zowel geringe verhoging turgor en introduceert zouten of andere moleculen die zijn gesuspendeerd of opgelost in de drager. Capillaire injectie vereist ook toegang tot een injectie faciliteit of de aankoop van de benodigde apparatuur. Septic speldenprik vereist geen speciale apparatuur en introduceertverwaarloosbare media in de vlieg en is meestal efficiënter te infecteren grote aantallen vliegen. Echter, pinprick infecties niet de nauwkeurige controle over infectiedosis die kan worden bereikt met capillaire injectie toe. Het onderhavige protocol gericht op een injectie-inrichting die mechanisch regelt injectievolume, maar er zijn ook injectiesystemen gebaseerd op discrete pulsen van perslucht. 20,21 Deze zijn meestal duurder dan de inrichting gekenmerkt worden gekalibreerd naar en van de luchtpuls elke naald teneinde consistente injectie volumes garanderen.

Er is veel discussie, maar zeer weinig gegevens over hoe vliegen worden systemisch besmet met bacteriën in het wild. Sommige onderzoekers stellen dat de meeste natuurlijke infecties optreden bij Drosophila inslikken pathogene bacteriën en de bacteriën vervolgens kunnen de darm ontsnappen naar een systemische infectie te vestigen. Er zijn echter zeer few bacteriën die in staat zijn om de darm van D. steken melanogaster, en degenen die hebben dit vermogen zijn zeer dodelijk voor vliegen 22,23. Een andere theorie is dat regelmatig vliegt houden cuticulair verwondingen door de ontsnapping van mislukte pogingen predatie of aanval door ectoparasitaire mijten. Deze hypothese wordt ondersteund door de frequente verzameling van wilde D. melanogaster dragende melanisatie plekken die indicatief genezen wonden (ongepubliceerde observaties) zijn. Mijten is aangetoond dat bacteriële infecties uitzenden in Drosophila 24 en wonden door mijten kan secundair geïnfecteerd met bacteriën in honingbijen 25. De frequentie aard mijt gedreven of anderszins opportunistische infectie van D. melanogaster door de cuticula inbreuken is niet bekend. De hier beschreven protocol maakt introductie van bacteriën direct in de hemolymfe door middel van kwantitatieve injectie die alle epitheliale barrières of gedragsproblemen IMMU omzeiltschap. Werkwijzen voor het toevoeren van pathogene bacteriën D. melanogaster zijn beschreven in Vodovar et al. 22 en Nehme et al. 23.

Veel entomopathogene bacteriën vormen weinig of geen gevaar voor de menselijke gezondheid, waardoor onderzoekers om comfortabel te werken met hen. Verder weinig bacteriën het vermogen om Drosophila infecteren contact zonder experimentele interventie, waardoor de kans op "epidemische" verspreiding van bacteriële infecties door een laboratorium via besmette oppervlakken of ontsnapt vliegt het algemeen zeer laag. Toch is het raadzaam om ervoor te zorgen dat er voldoende containment maatregelen zijn getroffen om te voorkomen dat besmette vliegen ontsnappen en heroveren elke ontsnapte vliegen. Het laboratorium dient te worden uitgerust met een biologische veiligheid niveau dat overeenstemt met dat van de ziekteverwekkers wordt gebruikt en standaard best practices in de microbiologie moeten worden gebruikt.

De experimentele infectiop de hier beschreven methode maakt infecties van Drosophila melanogaster met een dosis willekeurige bacterie. Nadat infectie is vastgesteld, is het eenvoudig om de kinetiek van bacteriële proliferatie of klaring meten gastheer sterfte te volgen en inductie van het gastheerimmuunsysteem testen. Geïnfecteerde vliegen kunnen gemakkelijk worden onderworpen aan andere fenotypische testen, waaronder testen van fysiologische functies die kunnen vormen of worden gevormd door de infectie. De beschreven procedures zijn goedkoop, vereisen relatief weinig gespecialiseerde apparatuur, en zijn gemakkelijk te leren, waardoor ze vatbaar zijn voor gebruik in uiteenlopende projecten over een breedte van onderzoek en onderwijs labs.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics