Systemisk bakterieinfektion och immunförsvar fenotyper i

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den bananfluga Drosophila melanogaster är en av de främsta modellorganismer för att studera funktion och utvecklingen av immunförsvaret. Många aspekter av medfödd immunitet är konserverade mellan insekter och däggdjur, och eftersom Drosophila lätt kan genetiskt och experimentellt manipulerade, de är kraftfulla för att studera immunsystemets funktion och fysiologiska konsekvenserna av sjukdomen. Förfarandet visat här tillåter infektion av flugor genom införande av bakterier direkt in i kroppen hålighet, förbi epiteliala barriärer och mer passiva former av försvar och låta fokus på systemisk infektion. Förfarandet innefattar protokoll för mätnings hastigheter av värd dödlighet, systemisk patogen belastning, och graden av induktion av värdimmunsystemet. Denna infektion förfarande är billig, robust och kvantitativt repeterbara, och kan användas i studier av funktionella genetik, evolutionär livshistoria och fysiologi.

Introduction

Den bananfluga Drosophila melanogaster är en av de främsta modellorganismer för att studera funktion och utvecklingen av immunförsvaret. Drosophila är billiga och lätta att bak, är mycket mottagliga för experimentell manipulation, och backas upp av en omfattande vetenskaplig gemenskap som har utvecklat ett brett samling av forskningsverktyg. Många aspekter av medfödd immunitet är konserverade mellan insekter och däggdjur, inklusive signaltransduktion medierad av Toll-liknande receptorer och NF-kB familj transkriptionsfaktorer, JAK / STAT-signalering, och JNK pathway svar. 1,2 Funktionen hos dessa gener och vägar kan frågas i D. melanogaster använder mutationer eller RNAi knockdowns som ökar eller minskar pathway aktiviteter 3 -. 6 Dessutom Drosophila kan användas för att studera de fysiologiska följderna av infektioner och sjukdomar, bland annat i samband med evolutionära livshistorieteori 7.- 9 Alla sådana studier dock bero på förmågan att på ett tillförlitligt sätt infektera experimentella flugor under definierade behandlingsförhållanden. Det förfarande som beskrivs här utgör en metodologisk ram för att leverera robusta och repeterbara bakterieinfektioner till Drosophila melanogaster och därefter mäta infektion svårighetsgrad och kvantifiera värdens immunsvar.

Drosophila kan vara naturligt och experimentellt smittats av ett brett utbud av parasiter och patogener, inklusive bakterier, svampar, virus, nematoder och parasitoid getingar. Den nuvarande protokollet är inriktad på att leverera system bakteriell infektion. Många olika bakterier kan användas för att infektera flugor, och försöksledaren val bör baseras på de exakta vetenskapliga frågor ställs. Exempelvis kan humana kliniska isolat användas för att studera bakteriella virulensen mekanismer 10, eller ekologiskt relevanta isolat kan vara preferred för evolutionära studier. 11 Vissa bakterier är kompetenta patogener i D. melanogaster, frodas vid infektion och orsakar värd sjukdom eller död. Andra bakterier effektivt förvaltas av värdens immunsystem och rensas inom ett par dagar. I denna demonstration kommer Providencia rettgeri användas som en proliferativ patogen som kan orsaka värd dödlighet och kvarstår i överlevande värdar. Escherichia coli kommer att användas som en icke-patogen som godkänts av värdens immunsystem.

Infektion kommer att fastställas genom införande av bakterier direkt in i kroppen hålighet av flugan. Detta tillvägagångssätt kringgår epiteliala barriärer och skydds beteenden, så att undersökning av systemisk infektion oavsett naturliga överföringsteknik. Det finns två huvudsakliga metoder för att experimentellt upprättandet systemisk infektion. I det första, en nanoinjector och dras glas kapillära nålar används för att injicera ett exakt antalbakterier i farten. Denna metod har fördelen av att tillåta ett stort dynamiskt omfång av infektionsdoser och att vara kvantitativt hög repeterbarhet. Den andra metoden är att leverera infektion med en septisk nålstick. Detta tillvägagångssätt har fördelarna av att vara snabb och kräver ingen speciell utrustning. När infektioner är etablerade, blir det möjligt att mäta system patogen belastning, värd dödlighet, och inducerbara immunsystemaktivitet. Naturligtvis kan vilket som helst antal ytterligare fenotyper tänkas mätas i infekterade D. melanogaster, inklusive efter infektion fruktsamhet 12, inlärningsförmåga 13, metabolisk status 14, eller nästan alla andra drag som kan föreställa sig.

Protocol

1. Samla och förbereda Flugor

  1. Bakre D. melanogaster under de önskade försöksförhållanden. Var noga med att inte överbefolka flugorna under uppfödning och se till att larver densiteter är konsekvent över behandlingar, eftersom miljöförhållanden under larvstadiet djupt kan påverka immunförsvars fenotyper under vuxenstadiet. 15
  2. Samla experimentella flugor 0-3 dagar efter eclosion från PUPP fallet och överföra dem till färskt medium.
  3. Hus insamlade flugor vid en önskad temperatur (temperaturer mellan 22 ° C och 28 ° C är i allmänhet lämpliga) tills de är i åldern 5-7 dagar efter eclosion.
    OBS: Detta gör att tillräckligt med tid för flugorna att slutföra metamorfos och blir mogna vuxna, men är långt före åldrande börjar.
  4. Sortera önskat antal flugor i en separat flaska före infektion, återigen noga med att undvika överbeläggning.
    OBS: Endast males infekteras i denna demonstration, men är lika möjligt att infektera kvinnor som använder det förfarande som beskrivs.

2. Kultur och förbereda Bakterier

  1. Bered en masterplatta av de valda bakterierna åtminstone 2 dagar före infektion. Serie bakterierna från en 15% glycerolstam lagrade under obegränsad tid vid -80 ° C. Förvara masterplattan vid 4 ° C i upp till 2 veckor. Alltid strimma masterplattorna direkt från den frusna glycerol lager. Undvik seriepassage av bakterier från platta till platta, som upprepade passage i kultur kan orsaka bakterier att utvecklas försvagad virulens.
    OBS: Det här exemplet använder Providencia rettgeri och Escherichia coli.
  2. Använd följande procedur för att förbereda en bakterieinjektionsvätska, suspension.
    1. Odla en 2 ml odling av bakterier genom att ympa sterilt medium med en enda koloni isolerades från masterplattan. Odla bakterier till stationär fas (t.ex. OBS: Båda P. rettgeri och E. coli växer bra i Luria-buljong vid temperaturer från 20 till 37 ° C under försiktig skakning.
    2. När kulturen har nått stationär fas, försiktigt pellets celler från ca.. 600 pl av kultur i en bordscentrifug (3 min vid 5000 xg), kassera supernatanten och suspendera bakterier i ca. 1000 il steril fosfatbuffrad saltlösning (PBS; 137 mM NaCl, 2,7 mM KCl, 10 mM Na 2 PO 4, 1,8 mM KH 2 PO 4, pH = 7,4).
    3. Späd de återsuspenderade cellerna i steril PBS för att uppnå en optisk densitet (OD) lämpligt för bakterien som används, mäts med en spektrofotometer som absorbansen vid 600 nm. Använd denna suspension till att infektera flugorna.
      OBS: En 600 = 0,1 eller 1,0 motsvarar respektive cirka 10 8 och 10 9 Providencia rettgeri eller E. coli per ml. Eftersom både leva ettnd döda bakterier bidrar till optisk densitet, är det viktigt att skörda kulturer tidigt i stationär fas innan bakterie lik ackumuleras och snedvrida förhållandet mellan optisk densitet och antalet livsdugliga bakterier som införs under infektion.

3. infektera Flugor

OBS: Eftersom Drosophila immunitet påverkas av dygnsrytmen, är det viktigt att utföra infektioner vid samma tid på dagen över experimentella replikat 16.

3.1) Med hjälp av en Nanoinjector

  1. Förbered glas nålar för infektion.
    1. Förbered en glasnål genom att dra en borosilikatglas kapillär med hjälp av en mikropipett avdragare.
    2. Använd pincett, bryta av nålspetsen för att skapa en öppning på ungefär 50 | j, m i diameter för att medge utmatning av vätska.
  2. Montera injektorn.
    1. Placera den tätande O-ringen och därefter den vita spacer (stor grop utåt) på metallkolven.
    2. Fyll glaset nålen med mineralolja under användning av en spruta med en 30 G nål.
    3. Sätt den fyllda glas nålen genom hylsan och sedan placera den större O-ringen runt sin bas, ca 1 mm från den trubbiga änden av nålen.
    4. Skjut nålen på metall kolven och försiktigt skruva på hylsan tills säkra.
    5. Mata ut det mesta av mineraloljan från injektorn, men se till att det fortfarande finns en liten volym av olja i nålen för att verka som en barriär mellan injektorn och bakteriesuspensionen. Se till att det inte finns några luftbubblor i den mineralolja eller bakteriesuspension, eller mellan de två vätskorna.
    6. Ställ injektorn till den önskade volymen för injektion (mellan 9 nl och 50 nl).
  3. Generera såra kontroller.
    1. Fyll injektorn nål med steril PBS genom att försiktigt föra spetsen av kapillär nål i ett rör av media och pressing "fylla" -knappen på injektorn.
      OBS: Steril bakterietillväxtmedier kan också användas en sårbildning kontroll om försöket kräver injektion av bakterier suspenderade i deras tillväxtmedium. Emellertid, eftersom bakterietillväxtmedier innehåller komponenter som kan stimulera immunsystemet eller har andra effekter på värden, är en inert bärare såsom PBS föredra.
    2. Söva önskat antal flugor under ett lätt flöde av CO2.
    3. Spruta flugor i främre buken på ventrolaterala yta med steril PBS.
      OBS: Det är också möjligt att injicera flugor på andra ställen, såsom sternopleural platta bröstkorgen, men det är viktigt att hålla injektionsstället konsekvent inom varje experiment 17.
    4. Placera injicerade flugor i nya flaskor med nytt medium, om flaskorna på sin sida tills alla flugorna har återhämtat sig från anestesi för att förhindra att flugor från att fastna i livsmedlet. <br /> OBS: Det rekommenderas att injicera PBS kontroll flugor innan injicera bakterier experimentella flugor så samma nål kan användas för båda behandlingarna. Det kommer inte alltid att vara möjligt att använda samma nål för en hel experiment. I så fall kan det vara önskvärt att spela in vilken nål användes med vilket flugor och att inkludera nål identitet som en experimentell faktor vid statistisk analys.
  4. Injicera bakteriell patogen.
    1. Mata ut det återstående sterila media från injektorn och fylla samma nål med bakteriesuspensionen.
    2. Upprepa proceduren ovan (3.1.3), nu injicera flugor med bakteriesuspensionen upprättats i förfarandet 2.2.

3.2) Med Septic Pinprick

  1. Förbered nålen för att sticka.
    1. Smält slutet av en 200 | j, l mikropipett spets och infoga en 0,15 mm insekt minutien stift i den smälta plasten. Låt plasten stelna sulm att stiftet hålls på plats med ca 0,5 cm av stift som sträcker sig från plasten.
  2. Generera såra kontroller.
    1. Söva önskat antal flugor under ett lätt flöde av CO2.
    2. Prick flugorna i sternopleural platta av bröstkorgen med nålen och undvika de bindningsställen av vingarna och benen. Om det behövs, försiktigt bort flugor från minutien stiftet med mjuka pincett.
      Anmärkning. Det är också möjligt att sticka flugorna vid andra platser, såsom den främre delen av magen på ventrolaterala ytan, men det är viktigt att hålla injektionsstället konsekvent inom varje experiment 17 Stickande genom nagelbanden av buken tenderar att vara mer svårare än prickning av bröstkorgen och är därför mindre vanligt.
    3. Placera spetsade flugor i en ny flaska med ny fluga medium, om flaskan på sin sida tills alla flugorna har återhämtat sig från anestesi för att förhindra flugorna från varecoming fastnat på maten.
  3. Införa den bakteriella infektionen.
    1. Söva önskat antal flugor under ett lätt flöde av CO2.
    2. Prick varje flyga på samma plats som de kontroller media, doppa spetsen på stiftet i bakteriesuspensionen upprättats i förfarandet 2.2 innan du sticker varje fluga.
    3. Placera de spetsade flugor i en färsk flaska med nytt fluga mediet, om flaskan på dess sida tills alla flugorna har återhämtat sig från bedövningen att hindra flugorna från att fastna i livsmedlet.

3.3) Bedöma Infectious dosen

  1. Infektera en uppsättning flugor såsom beskrivits ovan i endera proceduren 3,1 eller 3,2, bara i stället för att skicka tillbaka flugorna till flaskan mat att återhämta sig från anestesi, placera varje flyga in i ett mikrocentrifugrör på is.
  2. Lägg 250 pl PBS till varje rör och homogenisera flugorna antingen med användning av en mortelstöt eller en vulst visp. </ Li>
  3. Plate homogenatet på en LB-agarplatta, antingen med hjälp av en spiral plater eller en serieutspädning.
    1. För att plattan med serieutspädning, överföra varje flyga homogenatet till den första raden i en platta med 96 brunnar.
    2. Fyll varje brunn i de återstående raderna med 90 | il PBS.
    3. Med hjälp av en multikanalpipett, ta 10 ul från den första raden innehåller flyga homogenatet och fördela i den andra raden.
    4. Pipett upp och ner minst 10 gånger för att blanda, och sedan ta 10 pl och överföra till den tredje raden. Upprepa denna procedur med hjälp av de återstående raderna.
    5. Utgående från den nedersta raden (mest utspädda bakteriesuspensionen), använd flerkanalspipett att ta 10 il från varje brunn och insättning på en LB-platta, se till att proven dispens som diskreta fläckar som inte berör varandra. Upprepa tills alla brunnar har prov från varje rad, dispensering dem i fallande ordning efter utspädning på LB-platta. Låt plattan vid RT tills fläckarna har helt indränkt i LB-platta.
      OBS: Torkning av LB-platta för ett par dagar vid RT före användning rekommenderas för att säkerställa att vätskan absorberas lätt, vilket minimerar risken för oavsiktlig kontakt mellan provpunkter.
  4. Inkubera plattorna O / N, noga med att inte växa över plattorna så kolonierna förblir små och diskreta.
    OBS: Beroende på bakterietillväxtmediet och inkubationstemperatur används, kan kolonier härledda från flugans endogena tarmfloran så småningom visas på plattan. De flesta bakterier som används för patogen infektion växer mycket snabbare än tarmfloran på LB-agar vid 37 ° C.
  5. Ta plattor från inkubatorn när de experimentella bakterier har vuxit synliga kolonier (typiskt 8-12 timmar), men innan Drosophila tarmfloran kolonier visas (cirka 36 timmar). För långsamt växande experimentella bakterier, använd en selektivantibiotika i LB-agar för att avlägsna eventuella kolonier från tarmfloran.
  6. Räkna antalet kolonier för varje homogenat.
    1. För spiralplattor, räkna kolonierna som växer med användning av en automatiserad koloniräknare som kan uppskatta den bakteriella belastningen per ml homogenat baserat på antalet och positionen av kolonierna på plattan.
      OBS: Spiral räknas är mest exakt när den bakteriella koncentrationen är inom intervallet från 5 x 02-05 oktober x 10 4 bakterier per ml.
    2. För punktplattor, manuellt räkna kolonierna för varje flyga från vilken utspädning innehåller 30-300 kolonier och beräkna antalet bakterier per ml ursprungliga homogenatet.

4. Karakterisera Survivor av infektion

  1. Analys dödlighet efter injektion.
    1. Placera infekterade flugor och sårade kontroller i färska flaskor och upprätthålla i en inkubator vid en önskad temperatur (25 ° C med en 12:12 light: mörker-cykel rekommenderas). Placera inte mer än 15 flugor i en injektionsflaska som det blir svårt att räkna mer än 15 levande flugor.
    2. Räkna antalet levande och döda flugor varje dag, eller oftare om det är lämpligt.
    3. För att upprätthålla livsmedelskvalitet, flip flugor till nya livsmedel på ett regelbundet schema.
      1. Om flaskan innehåller endast män, överföra dem till nya flaskor var tredje dag. Om flaskan innehåller honor, överföra till nya flaskor varannan dag eftersom larver avkomma kommer smälta maten, vilket ökar risken att vuxna flugor kan fastna och resulterar i överskattade dödligheten på grund av infektion.
  2. Statist analysera data.
    1. Plot överlevnad som en Kaplan-Meier-kurva, som anger sannolikheten för att en individ kommer att överleva till en uppmätt tidspunkt efter injektionen. 18 För överlevnadskurvorna som inte korsar, utför parvisa jämförelser med hjälp av en log-rank-Test (även kallad Mantel Cox Test) eller utföra mer komplexa analyser med hjälp av en Cox proportional hazards modell, som kan innehålla flera faktorer och deras interaktioner. För överlevnadskurvorna som korsar, utför ett stratifierat Cox analys. 17

5. Analys bakteriehalten Post-infektion

  1. Mät bakteriehalten.
    1. Vid en föreskriven tid efter injektionen, upprepa proceduren används för att bedöma infektiös dos för att bestämma bakteriehalten under loppet av infektionen (se protokoll 3,3).
      OBS: Om man använder spiral plater, utspädda homogenaten så att den bakteriella suspensionen ligger inom ett intervall av 1000 - 100 tusen bakterie per ml.
  2. Analysera data.
    1. Om bakteriehalten är icke-normal, antingen omvandla informationen för att bättre approximera en normalfördelning eller analysera data med hjälp av icke-parametriska statistiska analyser (t.ex. Mann-Whitney U-test). Använd en Box-Cox analys till find den optimala transformationen; naturlig log eller bas -10 log transformationer är ofta effektivt. 19
    2. Om uppgifterna är tillräckligt normalfördelade och det finns bara två behandlingar som kontrast, utföra en t-test för att avgöra om de två behandlingarna resulterar i olika genomsnittliga bakterie laster. Om det finns flera experimentella variabler eller andra potentiellt prediktiva faktorer, använd variansanalys (ANOVA) för att avgöra vilka faktorer som är viktiga prediktorer för bakteriehalten. 19

6. Analys transkriptionsaktivering av Immunsystemet gener

  1. För att grovt visualisera immunaktivering efter infektion, infektera transgena flugor som uttrycker grönt fluorescerande protein (GFP) under kontroll av en promotor från en antimikrobiell peptid-gen såsom beskrivits ovan. 18
  2. Visa de infekterade flugor enligt ett fluorescens-kompatibel mikroskop; GFP induktion bör bli visible i fettet kroppen inom de första 6 - 10 timmar efter infektion.
  3. För mer exakt kvantifiering av immunaktivering, använda kvantitativ PCR på cDNA-templat (QRT-PCR) för att mäta förekomst av antimikrobiella peptid-gentranskript.
    OBS: Expressionen av immungener kan mätas när som helst efter (eller före) infektion. Generellt sett, induktion av immun genuttryck börjar cirka 4 timmar efter injektion och ökar under de närmaste 24 timmar.
    1. Söva flugor med hjälp av CO2.
    2. Placera 15 flugor i ett mikrofugrör för varje RNA-extraktion.
      OBS: Vi rekommenderar att samla in minst tre likadana prover för varje behandling tillstånd.
    3. Utdrag RNA från flugorna och generera första cDNA-strängen med användning av vilken som helst av ett antal standardförfaranden eller kommersiella kit. Butiks RNA vid -80 ° C. Butiks cDNA vid -20 ° C under perioder av några veckor och vid -80 ° C för långtidsförvaring. Före RNA-extraktion, lagra fligger vid -80 ° C.
    4. Utför kvantitativ PCR (qPCR) på målgener av intresse genom att använda cDNA som en mall. Se Tabell 1 för primersekvenser för att förstärka de antibakteriella peptid generna Diptericin A, Drosomycin, defensin, attacin A och Metchnikowin samt hushållning kontroll genen rp49 (även känd som rpL32).
      OBS: De gener som kodar för de antimikrobiella peptider Diptericin A och Drosomycin ger mycket goda avläsningar i D. melanogaster immunaktivitet induceras huvudsakligen genom IMD och Toll vägar, respektive. För att kontrollera för prov-till-prov variation i RNA-utbytet och effektiviteten av omvänd transkription, standardisera den inspelade expressionen av målgener mot en referenskeeping-gen vars uttryck inte förväntas förändras med infektion såsom rp49 (även kända som RPL 32).
    5. Analysera data. <ol>
    6. För grov approximation av expressionsskillnader, beräkna förhållandet mellan startkvantitet (SQ) värde som erhålls från testgenen (t.ex. Diptericin A) i förhållande till SQ värde som erhålls från referensgenen (t.ex. rp49) för varje prov (beräknat som SQ - DPTA / SQ - rp49). Skala dessa förhållanden till en baslinje kontrollbehandling såsom hantering en oinfekterade kontroll. Godtyckligt uttrycksnivån lika med 1,0 kontroll och visualisera experimentella behandlingar som relativa förändringar gånger. Uppskatta SQ värde för varje gen mot en standardkurva som genererats från en utspädningsserie av känd-kvantitet-cDNA.
      OBS: Statistisk analys av förhållanden kan vara komplicerat, så denna metod är bättre för snabb approximation än för noggrann analys. Om PCR-effektiviteten är låg, designa nya primers för att förbättra PCR-kinetik om det är möjligt. För qPCR reaktioner med nästan perfekt effektivitet (adoubling av PCR-produkten varje cykel) kan tröskelcykeln (Ct) substitueras för SQ värdet.
    7. För enkla experiment med optimalt effektiv förstärkning, kan data analyseras med hjälp av ΔΔC T-metoden. 19 För varje prov, subtrahera C T-värde för referens genen (t.ex. rp49) från C T test genen (t ex., Diptericin A) för att ge en AC-T. Sedan subtrahera AC T baslinjen kontroll från AC T för varje experimentellt prov för att ge en ΔΔC T-värde för varje prov; Detta ΔΔC T är ett tecken på relativa skillnader i genuttryck nivåer mellan behandlingarna, där 2 (-ΔΔCT) approximerar faldig förändring i uttryck.
      OBS: Denna analys kan dåligt misestimate fold-förändring i expression av målgenen om PCR av antingen testgenen eller referensgen har låg verkningsgrad.
    8. För den mest noggrann analys, genomföra analyser av varians (ANOVA) med användning av den uppskattade expressionen av testgen (t.ex. Diptericin A) såsom responsvariabeln och beräknad expression av styr genen (t.ex. rp49) och andra experimentella faktorer som förklarande variabler.
      OBS: Denna metod är relativt robust till ineffektivitet i PCR-förstärkning och medger analys av mer komplicerade experimentell design.

Representative Results

I det här avsnittet visar resultat som kan erhållas efter bakteriell infektion i Drosophila melanogaster. Figur 1 visar att infektion dosen varierar med optisk densitet av bakteriesuspensionen som används för injektion, och att dosen levereras tillförlitligt kan uppskattas genom homogenisering och plätering flyger omedelbart efter injektion . Såsom illustreras i fig 2, kan olika patogener orsaka olika nivåer av värd dödlighet (fig 2A) och värd dödlighet kan vara dosberoende (figur 2B). Viktigt ger detta protokoll för olika typer av infektioner som ska uppnås: Providencia rettgeri kan orsaka kronisk, under dödlig infektion som varar i 20 dagar eller längre (figur 3A). Däremot kommer andra bakterier som Escerichia coli oftast rensas av värd flyga inom sex timmar efter infektion (Figur 3B). Induktion av immun sysTEM kan uppskattas genom RNA-isolering och efterföljande QRT-PCR av antibakteriella peptidtranskript (figur 4A och B). Analogt men mindre kvantitativt, flugor som uttrycker GFP under kontroll av antimikrobiell peptid genpromotorer kan användas för att visualisera induktion av immunsystemet (se figur 4C).

Figur 1
. Figur 1: Fastställande Infectious Dose Flugor injicerades med 50 nl av bakteriesuspensioner täcker en rad av optiska densiteter (,0001-,05). Flugorna var omedelbart homogeniserad och ströks för att bestämma antalet bakterier infördes genom injektion. Initial bakteriehalten korrelerar starkt med initial OD injiceras (r 2 = 0,96)

Figur 2
(A) Vildtyp flugor injicerades med ca 5000 bakterier från av en av tre olika arter. Graden av värd dödlighet beror till stor del på de bakteriearter som används för infektion. (B) Vildtyp flugor injicerades med tre olika doser av Enterococcous faecalis - 50, 500 och 5000 bakterier per fluga. Flugor dör snabbare när infekterade med högre infektiösa doser (C) Ett immunsystemet mutant och vildtyp isogena styrledning injicerades med ungefär 500 Burkholderia cepacia. En parvis log-rank jämförelser visar att vildtyp fluga lever infektionen betydligt bättre än mutanten (χ 2 = 59,02, df = 1, p <0,0001).


Figur 3:. Bakteriehalten efter injektion Flugor injicerades med ungefär (A) 5.000 P. rettgeri (B) 3.400 E. coli. Bakteriell belastning fastställdes omedelbart efter injektion och vid olika efterföljande tidpunkter. Varje datapunkt representerar bakteriehalten på en enda fluga. E. coli rensas snabbt från utmanade värdar medan P. rettgeri kvarstår under återstoden av värdens liv ,.

Figur 4
Figur 4: Induktion av immun genuttryck efter injektion. (A) Flugor injicerades med 50 nl av P. rettgeri eller steril PBS antingen buken eller bröstkorgen, eller lämnades omanipulerat bortsett från CO Diptericin A-genen bestämdes med användning av QRT-PCR. (A) Expressionsnivåer plottas som förhållandet mellan Diptericin En avskrift av rp49 utskrift och skalas så att CO 2 kontroll definieras som att ha en uttrycksnivå 1. Staplarna representerar medelvärdet och standardfelet av nyckeltal från varje tillstånd (n = 4). (B) Expressionsnivåer plottas som en 2 ΔΔCT med genomsnittet Ct värde från CO 2 aesthesia kontroll flugor som används som standard icke inducerade tillståndet. Staplarna representerar medelvärdet och standardavvikelsen för ΔΔC T från varje tillstånd (n = 4). Även om det inte finns någon skillnad i avskrift induktion på grund av injektionsstället, visar jämförelsen av panelerna A och B hur ΔΔC T-metoden potentiellt kan överskatta induktionsnivåer. (C) Flugor uttrycker GFP under kontroll av den Diptericin En promotor injicerades med 50 nl av P. rettgeri (OD = 0,1) och sedan avbildas 7 dagar senare. GFP Panelen visar uttryck av GFP i bukfettet kroppen av infekterade flugor, vilket indikerar aktivering av Diptericin En promotor i bakteriellt infekterade flugor men inte media-injicerade kontroller.

Gene Framåt Omvänd
rp49 (även kallad rpL32) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin En 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensin 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin En 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

Tabell 1: Primrar för QRT-PCR.

Discussion

Tillvägagångssättet som beskrivs här ger rigorös och hög kvalitet infektion av Drosophila melanogaster. De illustrerade exemplen främst inriktat på infektion med Providencia rettgeri och E. coli, men protokollet är mycket anpassningsbar och kan tillämpas på infektioner med olika bakterier över ett intervall av värd uppfödning och underhållsförhållanden.

Detaljerna för en optimal experimentell strategi kommer att bero på den bakterie som användes för infektion, genotyp av värden, och de generella experimentella betingelser. Det är starkt rekommenderat att pilottest nya experimentella betingelser före initiering mer ambitiösa projekt. En bra utgångspunkt är att testa tre infektions doser under en 100-faldigt område. Mycket virulenta patogener är ofta bäst införes vid mycket låga infektiösa doser, av storleksordningen 10 till 100 bakterieceller per fluga. Mer moderata patogener kan injiceras vid högre doser av cirka 1.000 bakterier per fly, och icke-patogener kan injiceras vid doser så höga som 10.000 bakterier per fluga. Det är ofta lärorikt att definiera kinetiken av nya infektioner genom att spåra patogener belastning, värd dödlighet, och immunsystemet aktivitet under en longitudinell tidsserier. Eftersom mätningen av patogen belastning och värd genexpression är destruktiva analyser, är det nödvändigt att infektera distinkta flugor i början av experimentet för varje tidpunkt som skall mätas.

När beslut fattas om att använda nålstick eller mikrokapillär baserade injektion, är det viktigt att notera att det finns fördelar och begränsningar för varje metod. Capillary injektion införs en volym av vätska i farten, som både blygsamt ökar saftspänningen och introducerar salter eller andra molekyler som är suspenderade eller upplösta i bäraren. Kapillär injektion kräver också tillgång till en injektionsanläggningen eller köp av den nödvändiga utrustningen. Septic nålstick kräver ingen speciell utrustning och introducerarförsumbara media i farten, och är oftast mer effektivt för att infektera ett stort antal flugor. Emellertid inte NÅLSTICK infektioner inte tillåta exakt kontroll över infektions dos som kan uppnås med kapillär injektion. Det nuvarande protokollet fokuserade på en injektionsanordning som mekaniskt reglerar injektionsvolym, men det finns också insprutningssystem baserade på diskreta pulser av trycksatt luft. 20,21 Dessa är typiskt dyrare än anordningen som visas här och kräver kalibrering av luftpuls till varje nål för att säkerställa injektions konsekvent volymer.

Det finns en betydande debatt men mycket få uppgifter om hur flugor blir systemiskt infekterade med bakterier i naturen. Vissa utredare posit att majoriteten av naturliga infektioner uppstå när Drosophila ingest patogena bakterier och bakterier är därefter i stånd att undkomma tarmen att etablera en systemisk infektion. Det finns dock mycket few bakterier kända för att kunna passera tarmen hos D. melanogaster, och de som har denna förmåga är mycket dödlig för flugor 22,23. En alternativ teori är som flyger regelbundet upprätthålla cuticular skador genom flykt från misslyckade predation försök eller angrepp av ektoparasitära kvalster. Denna hypotes stöds av frekvent insamling vilda D. melanogaster lagermelanin fläckar som indikerar läkta sår (opublicerade observationer). Kvalster har visat att sända bakteriella infektioner i Drosophila 24 och sår kvar av kvalster kan sekundärt infekteras av bakterier i honungsbin 25. Frekvensen i naturen av kvalsterdrivna eller på annat opportunistisk infektion i D. melanogaster genom nagelband brott är inte känd. Protokollet som beskrivs här tillåter införsel av bakterier direkt i hemolymfa genom kvantitativ injektion som kringgår alla epiteliala barriärer eller beteende IMMUskapen. Metoder för matning av patogena bakterier till D. melanogaster har beskrivits i et al., Vodovar 22 och Nehme et al., 23.

Många entomopatogena bakterier utgör liten eller ingen risk för människors hälsa, vilket gör att forskare att arbeta med dem bekvämt. Dessutom mycket få bakterier har förmåga att infektera Drosophila vid kontakt utan experimentella ingripande, så risken för "epidemi" spridning av bakteriell infektion genom ett laboratorium via förorenade ytor eller rymt flugor är generellt mycket låg. Ändå är det lämpligt att se till att tillräckliga inneslutningsåtgärder har vidtagits för att förhindra infekterade flugor från att fly och för att återta någon rymt flugor. Laboratoriet bör utrustas med en biologisk säkerhetsnivå i proportion till det av patogener som används, och standard bästa praxis i mikrobiologi bör användas.

Den experimentella infectipå metoden som beskrivs här tillåter infektioner i Drosophila melanogaster med någon dos av godtycklig bakterie. När infektionen har fastställts, är det enkelt att mäta kinetiken av bakteriell spridning eller godkännande, för att spåra värd dödlighet, och att analysera induktion av värdens immunsystem. Infekterade flugor kan lätt utsättas för andra fenotypiska analyser, inklusive tester av fysiologiska funktioner som kan forma eller formas av infektionen. De förfaranden som beskrivs är billigt, kräver relativt lite specialutrustning, och lättlärd, vilket gör dem lämpade för användning i olika projekt över en bredd av forskning och undervisning labb.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics