Systemisk bakteriel infektion og immunforsvaret fænotyper i

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Frugten flyve Drosophila melanogaster er en af de førende modelorganismer til at studere funktionen og udviklingen af immunforsvaret. Mange aspekter af medfødte immunitet er bevaret mellem insekter og pattedyr, og da Drosophila let kan genetisk og eksperimentelt manipuleret, de er stærke for at studere immunsystemets funktion og de ​​fysiologiske konsekvenser af sygdommen. Proceduren demonstreret her tillader infektion af fluer ved indføring af bakterier direkte ind i kroppen hulrum, uden epitel barrierer og mere passive former for forsvar og lade fokus på systemisk infektion. Proceduren omfatter protokoller for de måler satser vært dødelighed, systemisk patogen belastning, og graden af ​​induktion af værtens immunsystem. Denne infektion procedure er billig, robust og kvantitativt gentagelig, og kan anvendes i undersøgelser af funktionelle genetik, evolutionære liv historie og fysiologi.

Introduction

Frugten flyve Drosophila melanogaster er en af de førende modelorganismer til at studere funktionen og udviklingen af immunforsvaret. Drosophila er billige og nemme at opdrætte, er meget modtagelige for eksperimentel manipulation, og er støttet af en omfattende videnskabelige samfund, der har udviklet en bred array af forskningsredskaber. Mange aspekter af medfødte immunitet er bevaret mellem insekter og pattedyr, herunder signaltransduktion medieret af Toll-lignende receptorer og NF-kB familien transkriptionsfaktorer, JAK / STAT signalering og JNK pathway responser. 1,2 Funktionen af disse gener og veje kan forespørges i D. melanogaster hjælp mutationer eller RNAi knockdowns at øge eller mindske pathway aktiviteter 3 -. 6 Derudover Drosophila kan bruges til at studere de fysiologiske konsekvenser af infektion og sygdom, herunder i forbindelse med evolutionære livshistorie teori 7.- 9 Alle sådanne undersøgelser har imidlertid afhænge af evnen til pålideligt inficere eksperimentelle fluer under definerede behandlingsbetingelser. Den her beskrevne fremgangsmåde udgør en metodologisk ramme for at levere robuste og reproducerbare bakterielle infektioner til Drosophila melanogaster og efterfølgende måle infektion sværhedsgrad og kvantificere værtens immunrespons.

Drosophila kan være naturligt og eksperimentelt inficeret med en lang række forskellige parasitter og patogener, herunder bakterier, svampe, vira, nematoder og parasitoid hvepse. Den nuværende protokol er fokuseret på at levere systemisk bakteriel infektion. Mange forskellige bakterier kan bruges til at inficere fluer, og forsøgslederen valg bør baseres på de præcise videnskabelige spørgsmål bliver stillet. For eksempel kan humane kliniske isolater anvendes til at studere bakterielle virulens mekanismer 10, eller økologisk relevante isolater kan være preferred for evolutionære studier. 11 Nogle bakterier er kompetente patogener af D. melanogaster, prolifererende ved infektion og forårsager host sygdom eller død. Andre bakterier effektivt forvaltes af værtens immunsystem og ryddet i løbet af få dage. I denne demonstration vil Providencia rettgeri anvendes som en proliferativ patogen, der kan forårsage vært dødelighed og vedvarer i overlevende værter. Escherichia coli vil blive anvendt som en ikke-patogen, der er godkendt af værtens immunsystem.

Infektioner bliver etableret ved indføring af bakterier direkte ind i kroppen hulrum af fluen. Denne fremgangsmåde omgår epitelbarrierer og beskyttende adfærd, så undersøgelse af systemisk infektion uanset naturlige smittemåde. Der er to primære fremgangsmåder til eksperimentelt oprettelse systemisk infektion. I den første, en nanoinjector og trukket glas kapillar nåle anvendes til at injicere et præcist antalbakterier i fluen. Denne fremgangsmåde har fordelene ved at tillade et stort dynamisk område på infektion doser og ved at være kvantitativt meget gentagelig. Den anden tilgang er at levere infektion med en septisk nålestik. Denne fremgangsmåde har fordelene ved at være hurtig og kræver ikke særligt udstyr. Når infektioner er etableret, bliver det muligt at måle systemiske patogen belastning, host dødelighed, og inducerbare immunsystem-aktivitet. Selvfølgelig kunne tænkes ikke måles række yderligere fænotyper i inficeret D. melanogaster, herunder post-infektion frugtbarhed 12, indlæringsevne 13, metabolisk status 14 eller stort set enhver anden træk, der kan forestille sig.

Protocol

1. Indsamle og Forbered Fluer

  1. Rear D. melanogaster under de ønskede forsøgsbetingelser. Pas på ikke at overcrowd fluerne under opdræt og sørg for, at larver tætheder er konsistente på tværs af behandlinger, da de miljømæssige forhold under larvestadiet dybt kan påvirke immun forsvar fænotyper løbet voksne stadium. 15
  2. Saml eksperimentelle fluer 0 - 3 dage efter eclosion fra puppe sag og overføre dem på frisk medium.
  3. Hus de indsamlede fluer på en ønsket temperatur (temperaturer mellem 22 ° C og 28 ° C er generelt egnede), indtil de er i alderen 5-7 dage efter eclosion.
    BEMÆRK: Dette giver tilstrækkelig tid til fluerne til at fuldføre metamorfose og bliver modne voksne, men er godt før ældning begynder.
  4. Sortere det ønskede antal fluer i en separat hætteglas før infektion, igen skal undgås overbelægning.
    BEMÆRK: Kun males inficeres i denne demonstration, men er ligeledes muligt at inficere hunner ved anvendelse af fremgangsmåden beskrevet.

2. Kultur og Forbered Bakterier

  1. Forbered en master plade af de valgte bakterier mindst 2 dage før infektion. Streak bakterierne fra en 15% glycerol stock opbevares på ubestemt tid ved -80 ° C. Opbevar masterpladen ved 4 ° C i op til 2 uger. Altid streak masterpladerne direkte fra frosne glycerolstamopløsning. Undgå seriel passage af bakterier fra plade til plade, som gentagne passage i kultur kan forårsage bakterier til at udvikle sig svækket virulens.
    BEMÆRK: Dette eksempel gør brug af Providencia rettgeri og Escherichia coli.
  2. Brug følgende procedure til at udarbejde en bakteriel suspension til injektion.
    1. Grow et 2 ml kultur af bakterier ved at pode sterilt medium med en enkelt koloni isoleret fra master plade. Vokse bakterierne til stationær fase (f.eks BEMÆRK: Både P. rettgeri og E. coli vokser godt i Luria Broth ved temperaturer fra 20 til 37 ° C med forsigtig rystning.
    2. Når kulturen har nået stationær fase, pellet forsigtigt celler fra ca.. 600 ul af kulturen i en bordplade centrifuge (3 min ved 5.000 xg), kasseres supernatanten, og resuspender bakterierne i ca.. 1.000 pi sterilt phosphatbufret saltvand (PBS; 137 mM NaCl, 2,7 mM KCl, 10 mM Na 2 PO 4, 1,8 mM KH 2 PO 4, pH = 7,4).
    3. Fortynd de resuspenderede celler i sterilt PBS for at opnå en optisk densitet (OD) passende for bakterien, der anvendes, måles med et spektrofotometer som absorbansen ved 600 nm. Brug denne suspension at inficere fluerne.
      BEMÆRK: En 600 = 0,1 eller 1,0 svarer henholdsvis ca. 10 8 og 10 9 Providencia rettgeri eller E. coli per ml. Fordi begge leve etnd døde bakterier bidrager til optisk densitet, er det vigtigt at høste kulturer tidligt i stationær fase før bakterielle lig ophobes og fordreje forholdet mellem optisk densitet, og antallet af levedygtige bakterier blev indført under infektion.

3. inficere Fluer

BEMÆRK: Da Drosophila immunitet påvirkes af døgnrytme, er det vigtigt at udføre infektioner på et tilsvarende tidspunkt på dagen tværs eksperimentelle replikater 16.

3.1) Anvendelse af en Nanoinjector

  1. Forberede glas nåle for infektion.
    1. Forbered et glas nål ved at trække en borsilikatglas kapillær ved hjælp af en mikropipette aftrækker.
    2. Ved hjælp af pincet, brække spidsen af ​​nålen for at skabe en åbning på ca. 50 um diameter til at tillade udstødning af væske.
  2. Saml injektoren.
    1. Placer forseglende O-ring og derefter det hvide spacer (stor fordybning vender udad) ind i metallet stemplet.
    2. Fylde glasset nål med mineralsk olie under anvendelse af en sprøjte med en 30 G nål.
    3. Sætte den fyldte glas nål gennem spændepatronen og derefter placere større O-ring omkring sin base, ca. 1 mm fra den stumpe ende af nålen.
    4. Skub nålen på metal stemplet og forsigtigt skrue på spændepatron indtil sikker.
    5. Skubbe det meste af mineralolie fra injektoren, men sikre, at der er stadig en lille mængde olie i nål til at virke som en barriere mellem injektoren og den bakterielle suspension. Sørg for, at der ikke er nogen luftbobler i mineralolie eller bakteriel suspension eller mellem de to væsker.
    6. Indstil injektoren til det ønskede volumen til injektion (mellem 9 nl og 50 nl).
  3. Generer sårede kontroller.
    1. Fyld injektoren nål med sterilt PBS ved omhyggeligt at sætte spidsen af ​​den kapillære nål i et rør af medier og pressing knappen "fylde" på injektoren.
      BEMÆRK: Steril bakteriel vækstmedier kan også anvendes en såring kontrol, hvis forsøget kræver injektion af bakterier suspenderet i deres vækstmedium. Men fordi bakterievækst medier indeholder komponenter, der kan stimulere immunsystemet eller har andre virkninger på værten, en inert bærer såsom PBS foretrækkes.
    2. Bedøve det ønskede antal fluer under en let strøm af CO 2.
    3. Injicer fluer i anterior abdomen på ventrolaterale overflade med sterilt PBS.
      BEMÆRK: Det er også muligt at injicere fluer på andre sites, såsom sternopleural plade af brystkassen, men det er vigtigt at holde injektionsstedet konsistente inden hvert forsøg 17.
    4. Placer injicerede fluer i friske hætteglas med nyt medie, om hætteglassene på deres side, indtil alle fluerne har genvundet fra anæstesien for at forhindre fluerne i at blive stukket til maden. <br /> BEMÆRK: Det anbefales at injicere PBS kontrol fluer før injektion bakterier til eksperimentelle fluer, så den samme nål kan bruges til begge behandlinger. Det vil ikke altid være muligt at anvende den samme kanyle til en hel eksperiment. I så fald kan det være ønskeligt at registrere hvilken nål blev anvendt som flyver og at medtage nål identitet som en eksperimentel faktor i statistisk analyse.
  4. Injicere bakterielt patogen.
    1. Skub den resterende sterile medier fra injektoren og fyld den samme nål med bakteriesuspensionen.
    2. Gentag ovenstående procedure (3.1.3), nu injicere fluer med bakteriesuspensionen udarbejdet i proceduren 2.2.

3.2) Med Septic Pinprick

  1. Forbered nål til at prikke.
    1. Smelt slutningen af ​​en 200 pi mikropipettespids og indsætte en 0,15 mm insekt minutien stift i den smeltede plast. Tillad plasten størkner such, at stiften holdes på plads med cirka 0,5 cm pin strækker sig fra plasten.
  2. Generer sårede kontroller.
    1. Bedøve det ønskede antal fluer under en let strøm af CO 2.
    2. Prick fluerne i sternopleural plade af thorax med nålen, undgå bindingssteder af vingerne og benene. Fjern om nødvendigt forsigtigt fluer fra minutien pin med bløde pincet.
      BEMÆRK:. Det er også muligt at punktere fluer på andre steder, såsom den forreste del af maven på den ventrolaterale overflade, men det er vigtigt at holde injektionsstedet konsistente inden hvert eksperiment 17 Prikkende gennem kutikula af underlivet tendens til at være mere vanskeligere end at stikke af brystkassen og er derfor mindre almindelige.
    3. Placer opretstående fluer i et frisk hætteglas med ny flue medium, om hætteglasset på sin side, indtil alle fluerne har genvundet fra anæstesi til at forhindre fluerne fra becoming fast til maden.
  3. Indføre den bakterielle infektion.
    1. Bedøve det ønskede antal fluer under en let strøm af CO 2.
    2. Prik hver flyve i samme sted som medierne kontroller, dyppe spidsen af ​​stiften ind bakteriesuspensionen udarbejdet i proceduren 2.2 før prikkende hver flue.
    3. Placer opretstående fluer i et frisk hætteglas med ny flue medium, om hætteglasset på sin side, indtil alle fluerne har genvundet fra anæstesien for at forhindre fluerne i at blive stukket til maden.

3.3) Vurdere infektiøs dosis Delivered

  1. Inficere en række fluer som beskrevet ovenfor i enten procedure 3.1 eller 3.2, kun stedet for at returnere fluerne til hætteglas mad til at komme sig anæstesi, sted hver flyve ind i en mikrocentrifugerør på is.
  2. Tilføj 250 pi PBS til hvert rør og homogeniseres fluerne enten ved hjælp af pistil eller en perle tæppebanker. </ Li>
  3. Plate homogenatet på en LB-agarplade, enten ved anvendelse af en spiraludplader eller en seriel fortynding.
    1. Til plade anvendes seriel fortynding, overføres hver flue homogenat til den første række på en 96-brønds plade.
    2. Fyld hver brønd af de øvrige rækker med 90 pi PBS.
    3. Ved hjælp af en multikanal pipette, tage 10 pi fra den første række, der indeholder flyve homogenat og dispensere i den anden række.
    4. Pipette op og ned mindst 10 gange for at blandes grundigt, og derefter tage 10 pi og overførsel til den tredje række. Gentag denne procedure under anvendelse af de øvrige rækker.
    5. Med udgangspunkt i den nederste række (de fleste fortyndede bakterier suspension), skal du bruge multikanalpipette til at tage 10 pi fra hver brønd og indskud på en LB plade, der tager sig at prøverne dispenseres som diskrete pletter, der ikke rører hinanden. Gentag indtil der er udtaget prøver alle brønde fra hver række, dispensering dem i rækkefølge efter faldende fortynding på LB pladen. Efterlad pladen ved stuetemperatur, indtil pletterne er helt gennemvædet i LB plade.
      BEMÆRK: Tørring af LB plade i et par dage ved stuetemperatur før anvendelse anbefales at sikre, at væsken let absorberes, hvilket minimerer risikoen for utilsigtet kontakt mellem prøve pletter.
  4. Pladerne inkuberes O / N, pas på ikke at overgrow pladerne så kolonier forblive lille og diskret.
    BEMÆRK: Afhængigt af den bakterielle vækstmedium og inkuberingstemperatur anvendes, kan kolonier afledt af flue endogene tarm mikrobiota sidst vises på pladen. Men de fleste bakterier, der anvendes til patogen infektion vokser meget hurtigere end tarmen mikrobiota på LB-agar ved 37 ° C.
  5. Fjern pladerne fra inkubatoren, når de eksperimentelle bakterier er vokset synlige kolonier (typisk 8-12 timer), men før Drosophila tarmens mikrobiota kolonier vises (ca. 36 timer). For langsomt voksende eksperimentelle bakterier, så brug en selektivantibiotikum i LB-agar for at fjerne eventuelle kolonier fra tarmen mikrobiota.
  6. Tæl antallet af kolonier for hver homogenat.
    1. For spiral plader, tælle kolonier, der vokser under anvendelse af en automatiseret koloni tæller, der kan estimere den bakterielle belastning pr ml homogenat baseret på antallet og placeringen af ​​kolonier på pladen.
      BEMÆRK: Spiral tæller er mest nøjagtig, når den bakterielle koncentration ligger i området fra 5 x OKTOBER 2-5 x 10 4 bakterier per ml.
    2. For spot plader, tæller manuelt kolonierne for hver flue uanset hvilken fortynding indeholder 30-300 kolonier og beregne antallet af bakterier pr ml oprindelige homogenat.

4. karakterisere overlevende af infektion

  1. Assay dødelighed efter injektion.
    1. Placere inficerede fluer og sårede kontroller i friske hætteglas og vedligeholde i en inkubator ved en ønsket temperatur (25 ° C med en 12:12 light: anbefales mørke cyklus). Læg ikke mere end 15 fluer i et enkelt hætteglas, som det bliver svært at tælle mere end 15 levende fluer.
    2. Tæl antallet af levende og døde fluer hver dag, eller oftere, hvis det er relevant.
    3. For at opretholde fødevarekvalitet, flip fluerne til ny mad på en regelmæssig tidsplan.
      1. Hvis hætteglasset indeholder kun hanner, overføre dem til friske hætteglas hver tredje dag. Hvis hætteglas indeholder hunner, overførsel til friske hætteglas hver to dage, fordi larver afkom vil flydende mad, hvilket øger risikoen, at voksne fluer kan sidde fast og resulterer i overvurderede dødelighed på grund af infektion.
  2. Statistisk analysere data.
    1. Plot overlevelse som et Kaplan-Meier-kurve, der angiver sandsynligheden for, at en person vil overleve til en afmålt tid-point efter injektion. 18. For overlevelseskurver der ikke krydser, udføre parvise sammenligninger ved hjælp af en Log-Rank Test (også kaldet Mantel Cox Test) eller udføre mere komplekse analyser ved hjælp af en Cox proportionel risiko Model, der kan inkorporere flere faktorer og deres samspil. For overlevelseskurver der krydser, udføre en stratificeret Cox analyse. 17

5. Assay Bakteriel Load Post-infektion

  1. Måle bakteriel belastning.
    1. På et foreskrevet tidspunkt efter injektion, gentages anvendes til at vurdere infektiøs dosis for at bestemme bakteriel belastning i løbet af infektionen procedure (se protokol 3.3).
      BEMÆRK: Hvis brug af spiraludplader, fortyndes homogenater så bakteriesuspensionen falder inden for et interval på 1.000 - 100.000 bakteriel pr ml.
  2. Analysere data.
    1. Hvis bakteriel belastning er ikke-normal, enten transformere dataene til bedre tilnærme en normalfordeling eller analysere data ved hjælp af ikke-parametrisk statistisk analyse (f.eks Mann-Whitney U test). Brug en Box-Cox-analyse til fInd den optimale transformation; naturlige log eller uædle -10 log transformationer er ofte effektive. 19
    2. Hvis dataene er tilstrækkeligt normalfordelte og der er kun to behandlinger bliver kontrast, udføre en t-test for at afgøre, om de to behandlinger resulterer i forskellige gennemsnitlige bakterielle belastninger. Hvis der er flere eksperimentelle variabler eller andre potentielt prædiktive faktorer, bruge variansanalyse (ANOVA) for at bestemme, hvilke faktorer er signifikante prædiktorer for bakteriel belastning. 19

6. Assay transkriptionsaktivering af Immunsystemet Gener

  1. Til groft visualisere immunaktivering efter infektion, inficere transgene fluer, der udtrykker grønt fluorescerende protein (GFP) under kontrol af en promotor fra et antimikrobielt peptid-gen som tidligere beskrevet. 18
  2. Se de inficerede fluer under en fluorescens-stand mikroskop; GFP induktion bør blive visible i fedt kroppen inden for det første i 6 - 10 timer efter infektion.
  3. For mere præcis kvantificering af immun aktivering, brug kvantitativ PCR på cDNA skabelon (QRT-PCR) til at måle den overflod af antimikrobielle peptid gentranskripter.
    BEMÆRK: kan måles Ekspressionen af ​​immune gener til enhver tid efter (eller før) infektion. Generelt induktion af immune genekspression begynder ca. 4 timer efter injektion, og stigninger over de næste 24 timer.
    1. Bedøver fluer bruger CO 2.
    2. Placer 15 fluer i et mikrofugerør for hver RNA-ekstraktion.
      BEMÆRK: Det anbefales at indsamle mindst tre udtages for hver behandling tilstand.
    3. Uddrag RNA fra fluer og generere første streng cDNA under anvendelse af enhver af et antal af standardprocedurer eller kommercielle kit. Store RNA ved -80 ° C. Store cDNA ved -20 ° C i perioder på nogle få uger og ved -80 ° C til langtidsopbevaring. Forud for RNA ekstraktion, opbevare fligger ved -80 ° C.
    4. Udføre kvantitativ PCR (qPCR) på målgener af interesse under anvendelse af cDNA som template. Se Tabel 1 for primersekvenser at forstærke de antibakterielle peptid generne Diptericin A, Drosomycin, defensin, Attacin A, og Metchnikowin samt husholdning kontrol gen rp49 (også kendt som rpL32).
      BEMÆRK: De gener der koder for de antimikrobielle peptider Diptericin A og Drosomycin giver meget gode udlæsninger af D. melanogaster immunaktivitet fremkaldt primært gennem IMD og Toll veje hhv. For at styre for prøve-til-prøve variation i RNA udbytte og effektiviteten af revers transkription, standardisere den indspillede ekspression af målgener mod en reference housekeeping gen, hvis ekspression forventes ikke at ændre sig med infektion, såsom rp49 (også kendt som RPL 32).
    5. Analysere data. <ol>
    6. For grov tilnærmelse af ekspressionssystemer forskelle, beregne forholdet mellem den (SQ) værdi opnået fra testgenet start mængde (f.eks Diptericin A) i forhold til SQ-værdi opnået fra reference-genet (f.eks rp49) for hver prøve (beregnet som SQ - DPTA / SQ - rp49). Skalere disse nøgletal til en baseline kontrol behandling, såsom en ikke-inficerede håndtering kontrol. Vilkårligt sætte kontrollen udtrykket lig med 1,0 og visualisere eksperimentelle behandlinger som relative fold ændringer. Estimere SQ værdi for hvert gen mod en standardkurve genereret fra en fortyndingsrække af kendt-mængde cDNA.
      BEMÆRK: Statistisk analyse af nøgletal kan være kompliceret, så denne fremgangsmåde er bedre for hurtig tilnærmelse end for grundig analyse. Hvis PCR effektivitet er lav, designe nye primere til at forbedre PCR kinetik hvis muligt. For qPCR reaktioner med næsten perfekt effektivitet (adoubling af PCR produkt hver cyklus), kan tærskelværdien cyklus (C T) erstattes SQ værdi.
    7. For simple eksperimenter med optimalt effektiv forstærkning, kan data analyseres ved hjælp af metode ΔΔC T. 19 For hver prøve, trække C T værdien af referencen genet (f.eks rp49) fra C T af testen genet (f.eks., Diptericin A) til opnåelse af en ΔC T. Derefter trække det ΔC T af den basislinje styring fra ΔC T for hver eksperimentel prøve til opnåelse af en ΔΔC T værdi for hver prøve; denne ΔΔC T indikerer relative forskelle i genekspression niveauer mellem behandlinger, hvor 2 (-ΔΔCT) tilnærmer gange ændring i ekspression.
      BEMÆRK: Denne analyse kan dårligt misestimate fold-ændring i ekspression af målgenet, hvis PCR af enten testen genet eller referencengenet har lav effektivitet.
    8. For de mest stringent analyse lade foretage variansanalyse (ANOVA) under anvendelse af anslåede ekspression af test-genet (f.eks Diptericin A) som responsvariabel og anslået ekspression af kontrol-genet (f.eks rp49) og andre eksperimentelle faktorer som forklarende variabler.
      BEMÆRK: Denne fremgangsmåde er relativt robust over for ineffektivitet i PCR-amplifikation og tillader analyse af mere komplicerede eksperimenterende design.

Representative Results

Dette afsnit illustrerer resultater, der kan opnås efter bakteriel infektion af Drosophila melanogaster. Figur 1 viser, at infektion dosis varierer med optisk tæthed på bakteriesuspensionen anvendes til injektion, og at dosis leverede kan skønnes pålideligt ved homogenisering og plettering flyver straks efter injektion . Som illustreret i figur 2, kan forskellige patogener fremkalder forskellige vært dødelighed (figur 2A) og vært dødeligheden kan være dosisafhængig (figur 2B). Vigtigere er det, denne protokol giver mulighed for forskellige typer af infektioner, der skal nås: Providencia rettgeri kan forårsage en kronisk, subletal infektion, der varer ved i 20 dage eller længere (figur 3A). Dog vil andre bakterier som Escerichia coli mest blive væk for værten flyve inden for seks timer efter infektion (figur 3B). Induktion af immun sysTEM kan anslås ved RNA-isolering og efterfølgende QRT-PCR af antibakterielle peptid transkripter (figur 4A og B). Analogt men mindre kvantitativt, fluer udtrykker GFP under kontrol af antimikrobielle peptid-gen-promotorer kan anvendes til at visualisere induktion af immunsystemet (figur 4C).

Figur 1
. Figur 1: Bestemmelse infektiøs dosis Fluer blev injiceret med 50 nl af bakteriesuspensioner dækker en række optiske densiteter (,0001-,05). Fluer var straks homogeniseret og udpladet for at bestemme antallet af bakterier indført ved injektion. Initial bakteriel belastning stærkt korrelerer med initial OD injiceret (r 2 = 0,96)

Figur 2
(A) Wild typen fluer blev injiceret med ca. 5.000 bakterier fra en af tre forskellige arter. Satsen for host dødelighed er meget afhængig af de bakterielle arter, der anvendes til infektion. (B) Vilde typen fluer blev injiceret med tre forskellige doser af Enterococcous faecalis - 50, 500 og 5.000 bakterier pr flue. Fluer dø hurtigere, når inficeret med højere infektiøse doser (C) et immunsystem-mutant og dets vildtype isogene styreledning blev injiceret med ca. 500 Burkholderia cepacia. En parvis Log-Rank sammenligning viser, at vildtype-flue overlever infektionen væsentligt bedre end mutanten (χ 2 = 59,02, df = 1, p <0,0001).


Figur 3:. Bakteriel Load Efter injektion Fluer blev injiceret med ca. (A) 5.000 P. rettgeri (B) 3.400 E. coli. Bakteriel belastning blev bestemt umiddelbart efter injektionen og ved forskellige senere tidspunkter. Hvert datapunkt repræsenterer den bakterielle belastning af en enkelt flue. E. coli hurtigt fjernet fra udfordret værter mens P. rettgeri fortsætter for resten af værtens liv ,.

Figur 4
Figur 4: Induktion af Immun genekspression efter injektion. (A) Fluer blev injiceret med 50 nl af P. rettgeri eller sterilt PBS i enten maven eller brystkassen, eller blev efterladt umanipulerede bort fra CO Diptericin A-genet blev bestemt ved anvendelse QRT-PCR. (A) Ekspressionsniveauer afbildes som forholdet mellem Diptericin En afskrift til rp49 transkript og skaleres, således at CO2 kontrol defineres som havende et ekspressionsniveau på 1. Søjlerne repræsenterer middelværdien og standardfejlen af nøgletal fra hver betingelse (n = 4). (B) Expression niveauer er afbildet som en 2 ΔΔCT med den gennemsnitlige C T værdi fra CO 2 aesthesia kontrol fluer, der anvendes som standard uinducerede tilstand. Søjlerne repræsenterer middelværdien og standardfejlen for ΔΔC T fra hver betingelse (n = 4). Mens der ikke er nogen forskel i transkript induktion grund injektionsstedet, sammenligning af panelerne A og B viser, hvordan metode ΔΔC T kan potentielt overvurdere induktion niveauer. (C) Fluer udtrykker GFP under kontrol af Diptericin En promotor blev injiceret med 50 nl af P. rettgeri (OD = 0,1) og derefter afbildes 7 dage senere. GFP panel viser ekspression af GFP i det abdominale fedt kroppen af inficerede fluer, hvilket indikerer aktivering af Diptericin En promotor i bakterielt inficerede fluer, men ikke medie-injicerede kontroller.

Gene Fremad Reverse
rp49 (også kaldet rpL32) 5'AGGCCCAAGATCGTGAAGAA 3 ' 5'GACGCACTCTGTTGTCGATACC 3 '
Diptericin A 5'GCGGCGATGGTTTTGG 3 ' 5'CGCTGGTCCACACCTTCTG 3 '
Drosomycin 5'CTGCCTGTCCGGAAGATACAA 3 ' 5'TCCCTCCTCCTTGCACACA 3 '
Defensin 5'GAGGATCATGTCCTGGTGCAT 3 ' 5'TCGCTTCTGGCGGCTATG 3 '
Attacin A 5'CGTTTGGATCTGACCAAGG 3 ' 5'AAAGTTCCGCCAGGTGTGAC 3 '
Metchnikowan 5'AACTTAATCTTGGAGCGATTTTTCTG 3 ' 5'ACGGCCTCGTATCGAAAATG 3 '

Tabel 1: Primere til QRT-PCR.

Discussion

Den her beskrevne fremgangsmåde giver streng og høj kvalitet infektion af Drosophila melanogaster. De viste eksempler primært fokuseret på infektion med Providencia rettgeri og E. coli, men protokollen er meget fleksibel og kan anvendes til infektioner med forskellige bakterier over et interval af vært opdræt og vedligeholdelse betingelser.

Detaljerne i en optimal eksperimentelle fremgangsmåde vil afhænge af den bakterie, der anvendes til infektion, genotypen af ​​værten, og de overordnede eksperimentelle betingelser. Det anbefales kraftigt at pilottest nye eksperimentelle betingelser inden initiering mere ambitiøse projekter. Et godt udgangspunkt er at teste tre infektion doser over en 100-fold rækkevidde. Stærkt virulente patogener er ofte bedst indføres ved meget lave infektiøse doser, i størrelsesordenen 10 til 100 bakterieceller pr flue. Mere moderate patogener kan injiceres ved højere doser af omkring 1.000 bakterier pr fly og ikke-patogener kan injiceres ved doser så høje som 10.000 bakterier pr flue. Det er ofte lærerigt at definere kinetikken af ​​hidtil ukendte infektioner ved at spore patogen belastning, host dødelighed, og immunsystemet aktivitet i en serie langsgående tid. Fordi målingen af ​​patogen belastning og vært genekspression er destruktive analyser, er det nødvendigt at inficere forskellige fluer ved starten af ​​forsøget for hver gang punkt, der skal måles.

Når det besluttes, om at bruge nålestik eller mikrokapillære-baserede injektion, er det vigtigt at bemærke at der er fordele og begrænsninger for hver tilgang. Kapillær injektion indfører en mængde væske i fluen, som både øger i beskedent omfang saftspændingen og indfører salte eller andre molekyler, der er suspenderet eller opløst i bæreren. Kapillær injektion kræver også adgang til en injektion facilitet eller køb af det nødvendige udstyr. Septisk nålestik kræver ikke særligt udstyr og introducererubetydelige medie i fluen, og typisk er mere effektiv for at inficere et stort antal fluer. Men nålestik infektioner ikke tillade præcis kontrol over infektion dosis, der kan opnås med kapillær injektion. Den foreliggende protokol fokuserede på et injektionsapparat, der mekanisk regulerer injektionsvolumen, men der er også indsprøjtningssystemer baseret på diskrete pulser af trykluft. 20,21 Disse er typisk dyrere end apparatet featured her og kræver kalibrering af luft impuls til hver nål for at sikre ensartede injektionsvolumener.

Der er stor debat, men meget få data om, hvordan fluerne bliver systemisk inficeret med bakterier i naturen. Nogle forskere postulere, at størstedelen af naturlige infektioner opstår, når Drosophila indtage sygdomsfremkaldende bakterier og bakterier er efterfølgende i stand til at undslippe tarmen til at etablere en systemisk infektion. Der er imidlertid meget few bakterier, der vides at være i stand til at krydse tarmen af D. melanogaster, og dem, der har denne evne er meget dødelige for fluer 22,23. En alternativ teori er, at flyver jævnligt opretholde kutikulære skader gennem flugt fra mislykkede prædation forsøg eller angreb af ektoparasitiske mider. Denne hypotese understøttes af hyppig indsamling af vilde D. melanogaster bærende melanin pletter, der er betegnende for helede sår (upublicerede observationer). Mider er blevet vist at transmittere bakterieinfektioner i Drosophila 24 og sår efterladt af mider kan sekundært inficeret af bakterier i honningbier 25. Frekvensen i naturen af mide-drevet eller på anden måde opportunistisk infektion af D. melanogaster gennem neglebånd brud er ikke kendt. Den her beskrevne protokol tillader indføring af bakterier direkte i hæmolymfe gennem kvantitative injektion, der omgår de epiteliale barrierer eller adfærdsmæssige IMMUskabet. Fremgangsmåder til tilførsel af patogene bakterier til D. melanogaster er blevet beskrevet i Vodovar et al. 22 og nehme et al. 23.

Mange entomopatogene bakterier udgør en lille eller ingen fare for menneskers sundhed, så forskerne at arbejde med dem komfortabelt. Ydermere giver meget få bakterier har evnen til at inficere Drosophila ved kontakt uden eksperimentel indgriben, så risikoen for "epidemi" spredning af bakteriel infektion gennem et laboratorium via kontaminerede overflader eller undslupne fluer er generelt meget lav. Ikke desto mindre, er det tilrådeligt at sikre, at tilstrækkelige indeslutningsforanstaltninger er på plads for at forhindre inficerede fluer i at slippe ud og for at genvinde eventuelle undslap fluer. Laboratoriet skal være udstyret med et biologisk sikkerhedsniveau i et rimeligt forhold, at af de patogener, der anvendes, og standard bedste praksis i mikrobiologi bør anvendes.

Den eksperimentelle infectiom metoden beskrevet her tillader infektioner af Drosophila melanogaster med enhver dosis af vilkårlig bakterie. Når der er etableret infektion, er det ligetil at måle kinetikken af ​​bakteriel proliferation eller clearance, til at spore vært dødelighed, og til analyse induktion af værtens immunsystem. Inficerede fluer kan let blive udsat for andre fænotypiske analyser, herunder test af fysiologiske funktioner, der kan forme eller være formet af infektionen. De beskrevne procedurer er billig, kræver relativt lidt specialudstyr, og er let læres, hvilket gør dem medgørlige til brug i forskellige projekter på tværs af en bredde af forskning og undervisning laboratorier.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics