Enterovirüs Kültür ve RT-qPCR Su Norovirus Oluşum EPA Method 1615 Ölçümü. Bölüm III. RT-qPCR Virüs Algılama

1National Exposure Research Laboratory, U.S. Environmental Protection Agency, 2Technical Services Center, Office of Ground Water and Drinking Water, U.S. Environmental Protection Agency
Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Kantitatif PCR (qPCR; Bu yazıda kullanılan terimlerin tanımları için tamamlayıcı malzemeler) ve transkripsiyon-qPCR (RT-qPCR) sular tespit ve çevre insan enterik virüsler miktarının ve içme değerli araçlardır ve özellikle bunu birçok virüs için ters çoğaltmak ya da hücre kültür sistemlerinde kötü çoğaltma değil. Her iki araç birçok virüs türleri dünyada 1-6 genelinde çevresel ve içme sularında mevcut olduğunu göstermiştir. Onlar içme suyunda bulunan virüs salgını hastaların 7-10 tarafından bu kulübe aynı olduğunu göstermiştir hastalık mihrak araştırmaları sırasında güçlendirilmiş genomik fragmanların sıralama ile birleştiğinde Bunların kullanımı, su bazlı virüs iletimi için kanıt sunmuştur.

QPCR ve RT-qPCR Hem kullanışlı halk sağlığı araçlarıdır. Örneğin, ABD Çevre Koruma Ajansı (EPA) tarafından yürütülen çalışmalardan elde edilen veriler güçlü bir ilişki olması gösterdiqPCR ve eğlence sularında sağlık etkileri ile ara gösterge ölçümleri. Bunun bir sonucu olarak, EPA nihai 2012 Dinlenme Su Kalitesi Kriterleri dinlenme plajları 11,12 izlenmesi için bir qPCR yöntemi içerir. RT-qPCR 1 ile ölçülen Borchardt ve arkadaşları da yeraltı suları tedavi edilmemiş yeraltı ve virüs kullanılarak toplumlarda akut gastroenterit arasında güçlü bir ilişki bulunmuştur.

Bu yazının amacı, EPA Method 1615 13,14 moleküler tahlil bileşenini tanımlamaktır. Bu deney, bir elektropozitif bir filtreden enterovirüs ve başarılı çevresel veya içme suyu orijinal hacmine dayalı olarak litre başına norovirus genomik kopyalarının (GC) nicel bir tahminde bulunmak için RT-qPCR kullanır. Moleküler prosedürün bir bakış standart eğri hazırlamak için 1. Protokol bölüm Şekil 1 ayrıntıları prosedürler gösterilir. Bu standartlar, RN içeren bir reaktif hazırlanırTüm primer / prob setleri için hedef dizinin bir kopyası. Bölüm 2 üçüncül konsantrasyon prosedürü anlatılmaktadır. Bölüm 3 konsantre su ve kontrol numunelerinin RNA çıkarmak için prosedürü vermektedir. Her bir test numunesi ile ilgili RNA ters üç kopyalı tahliller ve birinci transkripsiyon (Bölüm 4) rasgele primerler kullanılarak transkribe edilmektedir. (Şekil 2, Bölüm 5), her ters transkripsiyon reaksiyonu cDNA qPCR üç kopya halinde analiz edilir Beş ayrı virüse spesifik tahlilleri ayrılmıştır. Deney birçok enterovirüsleri ve Noroviruses RT-qPCR 15 inhibe eden test örneklerini tespit etmek hepatit G RNA ihtiva eden bir reaktif tespit etmek için tasarlanmıştır, bilimsel literatürde (Tablo 1) primerler ve problar kullanılır.

Protocol

Not: kullan veri sayfaları protokol tüm adımları takip etmek; örnek veri sayfaları ek malzemeler Tablo S2-S4 verilmiştir.

1. Standart Eğri hazırlanması

  1. (Örneğin, EP-A-Zırhlı RNA 1615) 2.5 x 10 8 parçacık / ml (2.5 x 10 8 GC / ml) TSM kullanılarak bir konsantrasyona kadar üretici tarafından sağlanan konsantrasyondan seyreltilmesi ile standart eğri reaktifi çalışma stok hazırlama III tampon. -20 ° C'de 1.5 ml mikrosantrifüj tüpleri ve mağaza kullanarak 250 ul kısma çalışma stok bölün.
    NOT: Alternatif standart eğri reaktifler olarak kullanılmak üzere hazırlanıyor çalışma virüsün hisse senetleri ve plazmidler ile ilgili talimatlar için ek malzemeler protokol Adım S1 bakın.
  2. Bir çalışma stoğu alikotları bir veya daha fazla çözülme. , 2.5 x 10 7 konsantrasyonları veren 2.5 x 10 6, 2,5 x 1,5 ml mikrosantrifüj tüpleri kullanarak beş 10-kat seri dilüsyonları hazırlayın10 5, 2.5 x 10 4, 2.5 x 10 3 GC / ml olmuştur.
    1. TSM III tampon 225 ul 2.5 x 10 8 GC / ml çalışma stokunun 25 ul ekleyerek ilk seyreltme hazırlayın. Bir vorteks mikser kullanılarak 5-15 saniye karıştırılır.
    2. TSM III tampon 225 ul Adım 1.2.1 hazırlanan seyreltme 25 ul ekleyerek sonraki seyreltme hazırlayın. Tekrar karıştırın ve önümüzdeki üç 10 kat dilüsyonları hazırlamak için benzer bir işlem devam ediyor.
  3. Standart eğri çalışma stoktan RNA ve hemen Bölüm 3'te yordamı kullanarak beş dilüsyonları ayıklayın.

2. Tersiyer Konsantrasyon

  1. Üst numune odasına 1x PBS en az 10 ml,% 0.2 sığır serum albümini (BSA) eklenmesi ile toplanarak her bir numune için bir santrifüj konsantratör (30.000 molekül ağırlıklı akış kesici) hazırlayın. Bu çözüm ince kanal konsantrasyon odasını doldurdu emin olun ve ardından 4 ° C'de O / N tutun.
  2. S, ayrı Santrifügal konsantre halinde Deneyi Örnek Hacmi eşit, her bir test örneğinden ikincil su konsantresi bir miktarını ekleyin.
    1. Denklem 1 kullanılarak S hesaplayın
      Denklem 1
      D Analiz Edilmiş Orijinal Su Numune hacmi olduğu durumlarda, TSV Toplam Örneklem Hacmi ve FCSV Final Konsantre Numune Hacmi olduğunu. S. hesaplama örneği için ek malzemeler S2 bakın
  3. Santrifüj 20, bir sallanan kepçeli rotor içinde 4 ° C'de 3.000-6.000 xg, her bir test örneği - 30 dakika. İnce kanal konsantrasyon odasında seviyesini kontrol edin.
    1. Birim 20 dakika veya daha uzun süre daha fazla 400 ul, santrifüj değilse. Th numune kadar devam santrifüjE ince kanal konsantrasyon odası az 400 ul düşürüldü. Süpernatant çıkarmayın.
  4. Virüs geri kazanımı arttırmak, steril 0.15 M sodyum fosfat 1 ml, pH 7-7,5 olan santrifüjlü konsantre kenarlarını yıkayın. Tekrar santrifüj 3.000-6.000 xg ve 4 ° C 'de Örnek az 400 ul'ye indirgendi kadar. Bu yıkama adımı ek süre tekrarlayın.
  5. Bir 100-200 ul mikropipet kullanarak dikkatlice ölçün ve 1.5 ml mikrosantrifüj tüp (yani, mikrosantrifüj tüp 200 ul transferi ve kalan sıvı tamamen çizilebilir kadar sonra mikropipet ayarlayarak kalan konsantre ölçmek için her konsantre örnek aktarmak ) pipet ucu içine. 400 ± 2 ul nihai ses seviyesini ayarlamak için, 0.15 M sodyum fosfat, pH 7-7,5 ekleyin.
  6. Hemen 3. Processe edilemez herhangi konsantre örnekleri tutun adıma geçmeden nükleik asit Özüd, hemen fazla 24 saat boyunca 4 ° C 'de.

3. Nükleik Asit İzolasyon

  1. 1,5 ml mikrosantrifüj tüpleri etiketli ayırmak için Aşama 1.3 Aşama 2.5 veya standart eğri çözücüden, her bir test örneğinden Aşama tertier konsantrenin 3.3 ve 200 ul tarif edildiği gibi hazırlanmıştır ekstraksiyon tamponu 200 ul ekle. Veya -70 ° C'nin altında üçüncül konsantreleri kalan dondurun. Aşağıdaki istisnalar dışında kan örnekleri sıkma protokolü için nükleik asit ekstraksiyon kiti, üreticinin talimatlarına uygun olarak, her numune nükleik asitlerin ekstrakte edin.
  2. Su numunelerine proteazı eklemek veya nükleik asit ekstraksiyon kiti ile birlikte verilen ekstraksiyon tamponu kullanmayın.
  3. Taşıyıcı RNA ile ekstraksiyon tamponu hazırlayın
    1. Taşıyıcı RNA 310 ug ihtiva eden bir şişeye, taşıyıcı RNA seyreltme tamponu 310 ul ekle. Çözülür ve daha sonra yaklaşık 50 ul ihtiva eden 6 kısma ayırmak için karıştırın. -20 ° C'de saklayın° C.
    2. 0,027 ug / ul bir taşıyıcı RNA konsantrasyonu elde etmek üzere, ekstraksiyon tamponunda ml'si başına çözülmüş bir taşıyıcı RNA 28 ul ekle. Ekstraksiyon kiti ile birlikte bunun yerine taşıyıcı RNA tadil ekstraksiyon tampon kullanın.
  4. Ribonükleaz ekleyerek elüsyon tamponu, bir ana solüsyonu hazırlayın (RNaz) inhibitörler ekstraksiyon kiti ile birlikte verilen elüsyon tamponuna 400 ünite / ml nihai konsantrasyona seyreltildi.
    1. Sütuna RNaz inhibitör ile elüsyon tamponu 50 ul yerleştirerek spin kolon bağlanma nükleik asitten Elute RNA. 1 dakika boyunca bekleyin ve daha sonra oda sıcaklığında 1 dakika boyunca 6000 x g'de santrifüjlenir.
    2. Tekrarlayın Adım 3.4.1 ve daha sonra çıkarın ve sütun atın.
  5. Adım 3.4.2 RNA ekstrelerinin hacimde hazırlayın. 6 standart eğri çalışma stok hacimde ve en az 15 ul her biri her bir standart eğri seyreltme hazırlayın. En az ihtiva eden diğer bütün RNA örneklerinin 4 alikotları hazırlayın22 ul, her. Bunlar, 4 saat içinde ters transkripsiyon ile işlenebilir halinde 4 ° C 'de her bir numune ve standart eğri kontrolleri bir kısım saklayın; Aksi takdirde, ya da -70 ° C altındaki tüm alikotları saklayın.

4. Ters Transkripsiyon (RT)

  1. On katına eşit (mikrolitre) bulunan oligonükleotid nanomol (nmol) sayısını bir miktar kullanılarak her bir şişeye PCR dereceli su hacmi eklenerek, Tablo 1 deki her bir oligonükleotid primer ve prob, 100 uM stok çözelti hazırlayın Flakon etiketinde veya örneğin üreticinin özellikler sayfasında (gösterildiği gibi flakon (,) 363 ul 36,3 nmol içeren bir astar tekrar süspansiyon. eritmek için karıştırın.
    1. Çözüm çalışan 10 mcM hazırlamak için PCR dereceli su ile 100 mcM çözümler 1:10 seyreltin.
  2. 2. Pipet Tablo kılavuzunu kullanarak bir temiz oda RT Maste 16.5 ul RT Master Mix 1 ve 2 hazırlayınHer PCR plakasına r Mix 1 de çok kanallı pipet kullanarak.
  3. Çözülme, donmuş ise, her alan numune ve Lab Müstahkem Numune Matrix gelen nükleik asit ekstreleri (LFSM; yani numaralı seribaşı su matris örneği).
    1. RNaz inhibitörü 400 ünite / ml içeren elüsyon tamponu içinde 5 ve 01:25: her bir alan ve LFSM örnek 1 seyreltin.
    2. Lab Reaktif Blank (LRB; yani reaktif dereceli su kullanılarak bir negatif kalite kontrol), Performans Değerlendirmesi (PE, Çözülme, donmuş, ama eğer Lab Müstahkem Blank (yani seribaşı reaktif dereceli su kullanarak olumlu bir kalite kontrol LFB) sulandırmak yok ; yani, numaralı seribaşı reaktif dereceli su numuneleri bir çalışmaya başlamadan önce laboratuvar performansını), Performans Testi (PT değerlendirmek için kullanılan; yani, çalışma sırasında laboratuvar performansını değerlendirmek için kullanılan bir analist bilinmeyen titrelerle seribaşı reaktif dereceli su numuneleri ), NA Toplu negatif çıkarma kontrolü, ya da standart eğri kümesinden çıkarılan RNA.
    3. , Ayrı PCR plaka kuyu içine her test numunesi, kontrol ve standart eğriden RNA 6.7 ul yerleştirin test örnekleri ve kontroller için üçlü kuyuların kullanma ve standart eğrileri (bir RT plaka örneğin Şekil S1 bakın) kuyu yinelenen.
      1. Hiçbir şablon kontrolleri (NTC) için ayrı PCR plaka kuyu içine elüsyon tamponu 6.7 ul yerleştirin. İlk örnek için iki ve her dördüncü ek numune için daha sonra iki tane daha kullanılarak RT plaka başına 2-8 NTC ekleyin.
      2. Plaka boyunca negatif çıkarma ve NTC kontrolleri dağıtın.
    4. Isıya dayanıklı plaka kapatıcı ile PCR plaka mühür. 5-10 saniye örnekleri karıştırın ve daha sonra ≥ 500 xg kısaca santrifüj.
    5. 99 ° C'de 4 dakika süreyle plaka inkübe ve daha sonra, bir termal döngü içinde 4 ° C'ye kadar hızlı bir şekilde soğutulur. Santrifüj tekrar ≥ 500 xg kısaca at.
    6. Dikkatle levhası contasını çıkartın ve sonra her kuyuya RT Master Mix 2 16.8 ul ekleyin. Seal karıştırılması, ardından bir ısıya dayanıklı plaka kapatıcı ile tekrar plaka ve ≥ 500 x g'de kısa bir santrifüjleme.
    7. 4 ° C tutma döngüsü daha sonra, bir termal döngü plaka koyun ve 99 ° C 'de, 42 ° C'de 60 dakika, ardından 25 ° C'de 15 dakika boyunca 5 dakika çalıştırılır ve.
    8. Proses hemen veya qPCR (Aşama 5), ​​veya mağaza örnekleri ile 8 saat içinde veya altında -70 ° C de işleme tabi kadar. 4 ° C 'de 8 saat içerisinde işlenebilir mağazası örnekleri.

    5. Gerçek zamanlı Kantitatif PCR (qPCR)

    1. Önce herhangi bir test örneklerini çalıştıran hepatit G reaktif her bir lot için ortalama hepatit G Cq değerini belirler.
      1. NTC kontroller (Aşama 4.1.1) için tarif edildiği gibi hazırlanmıştır 10 nümuneyle bir RT deneyi çalıştırın. (5.5.3 için 5.2 Adımları) aşağıda tarif edildiği gibi hepatit G qPCR tahlil çalıştırın. 10 çoğaltır ortalama Cq değerini hesaplayın.
      2. RT Master Mix 1 hepatit G reaktif miktarı (Tablo 2 ayarlayın), Gerekirse, 25 ve 32 birimleri arasında bir ortalama Cq değeri elde edilmiştir. Su hacmini değiştirerek yükseltilmiş ya da alçaltılmış miktar telafi deney başına 16.5 ul RT Master Mix 1 son hacim tutmak ekledi.
      3. Ayarlanan miktarda yansıtmak için 5.1.2'de ve değişim Tablo 2 Adımlar 5.1.1 tekrarlayarak ayarlamaları onaylayın.
    2. Enterovirüs için Tablo 3'de kılavuzları kullanarak bir temiz oda qPCR usta karışımları hazırlayın, hepatit Tablo 4 ve fare norovirusa (norovirus genogroup V) norovirus genogroup II, Tablo 7 Norovirüs genogroup I, Tablo 6 Tablo 5 ve Tablo 8 G. Mix, her ana karışımı ve daha sonra ≥ 500 xg kısaca santrifüj.
    3. Her qPCR deneyi için kuyu ve ayrı levhalar başına 14 ul kullanarak, etiketlenmiş bir optik reaksiyon plaka ihtiva eden uygun oyuklara PCR master karışımları ekleyin (bkz Şekil S2 Şekil S1 RT düzeni dayalı bir qPCR tahlil) için olası bir düzen için.
    4. Donmuş ise, oda sıcaklığında Adım 4.8 RT plakasını çözülme. Bir tabak karıştırıcı kullanılarak karıştırın ve daha sonra ≥ 500 xg kısaca santrifüj.
    5. Optik reaksiyon plakasının uygun oyuklarına uygun cDNA 6 ul koyun. ≥ 500 xg kısaca optik reaksiyon plakası ve santrifüj örnekleri karıştırın.
      1. Diğer tüm qPCR tahlilleri çalıştırmadan önce, seyreltilmemiş ve sulandırılmış alan ve LFSM örneklerinde hepatit G qPCR deneyi çalıştırın. Alanın ya da LFSM numunesi <Enterovirüs ve norovirus qPCR deneyleri için ortalama Hepatit G Cq değerinden daha büyük 1 Cq değeri düşük seyreltme kullanın.
      2. Üreticinin talimatlarına göre kantitatif PCR termal döngü yazılımını kurun. Standartlar gibi standart eğri örnekleri tespit ve her bir standart eğri seyreltme için, Tablo 9'da gösterilmiştir genomik kopya değerlerini girin.
    6. Her bir standart eğri Tablo 10'da verilen kabul edilebilir değerleri karşılayıp karşılamadığını belirlemek. Örnekler için ek malzemeler bölümüne S3 bakın.
      1. Denklem 2 kullanılarak standart eğri genel standart sapma (StandartSapma) hesaplayın,
        Denklem 2
        Cq her standart eğri çoğaltmak için bildirilen değer olduğu, Cq çoğaltır her set için ortalama değer, #Cq toplam pozitif değerler (yani belirsiz değil) sahip tüm standart kontrol çoğaltır için Cq değerlerin sayısı ve # olduğunu CYBH pozitif değerler var standart kontrollerin sayısıdır.
      2. Kantitatif PCR termal döngü yazılımı her standart eğri için eğimini hesaplar etmezse, Denklem 3 kullanılarak eğimi hesaplamak60;
        Denklem 3
        Cq kullanılan yüksek ve en düşük dilüsyonlarının ortalama değeri ve log nerede GC Tablo 9'dan kullanılan yüksek ve en düşük dilüsyonları için genomik kopya değerinin günlük olduğunu.
      3. Denklem 4 kullanılarak R2 değerini hesaplayın.
        Denklem 4
        Cq tüm Cq değerlerinin ortalaması ve Log GC her tekrar için ortalama Log GC değeridir.
      4. Denklem 5 ile% Verimliliği hesaplayın:
        Denklem 5
    7. Tablo 10'da belirtilen kriterleri ve her bir numune için ortalama GC değerlerini karşılayan standart eğrileri dayalı tüm test numuneleri için termal döngü yazılımı tarafından hesaplanan GC değerlerini kaydedin. Içinde kriterlerine uymayan, standart eğrileri ile herhangi bir örnekleri yeniden
    8. Denklem 6 kullanılarak her test numunesi için GC litre başına (GC L) belirlenmesi:
      Denklem 6
      GC Aşama 5.7 ortalama genomik kopya sayısıdır, faktör '199' tertier konsantrasyon sırasında meydana gelen hacim indirimleri için toplam seyreltme faktörü, RNA ekstraksiyonu ve RT-qPCR adım, DF inhibisyonu için telafi dilüsyon faktörü ve D litre cinsinden Analiz Edilmiş Orijinal Su Numune hacmi olduğunu. GC L hesaplama örneği için ek malzemeler bölüm S4 bakın.
    9. 199 Adım 5.5 ortalama GC değerini çarparak ve 0.3 bölerek toplam LFB ve GC ve LRB örnekleri hesaplayınız.

Representative Results

Genel virüs kurtarma eşleştirilmiş alan ve LFSM yeraltı su numuneleri kullanılarak belirlenmiştir. Yedi örnek setleri toplam üç kamu arıtma tesisleri ve özel kuyudan alınan bir numune kümesinden ayrı olayda toplanan iki set kullanılarak analiz edildi. LFSM örnekleri için Tohum seviyeleri x 10 6 kemirgen norovirusa ve MPN Sabin çocuk felci ve serotip 3 ve 5 x 10 6 PFU 3 idi. Murin norovirus nedeniyle LFSM örnekleri için yeterli olan bir virüs konsantrasyonu insan norovirus stoklar eksikliği yöntem değerlendirilmesinde bir vekil olarak kullanılmaktadır. Yeraltı suyu numuneleri için ortalama poliovirüs geri 2%, standart bir hata ile 14 ise kemirgen norovirus kazanımı% 3 (Şekil 3), standart bir hata ile,% 30 idi,% 20 idi. Her LFSM düzenli alan yeraltı suyu numunesi saptanabilir enterovirüs veya Norovirus vardı.

LFB ve LRB örnekleri tohumlanır ve giremeyen reaktif dereceli wat kullanılarak ölçülmüştürer. Tüm LRB örnekleri (veriler gösterilmemiştir) negatiftir. Fare norovirus kurtarma% 0.5 bir standart hata ile 4 ortalama% iken çocuk felci kurtarma,% 1 (Şekil 3) bir standart hata ile% 44 ortalama.

RT-qPCR Şekil 4. Yeterli standart eğri reaktiflerin kullanımını gerektirir Enterovirüs ve norovirus GII için tipik bir standart eğri gösterir. Norovirus GII eğrisi 0.9987 bir R2 değeri 0.14 genel bir standart sapma ve% 101 verimle standart eğri performans kriterleri (Tablo 10) karşılamaktadır. Norovirus GIA ve GIB eğrileri (gösterilmemiş olan) norovirus GII bu hemen hemen aynıdır. Enterovirüs eğrisi 0.9874 bir R2 değeri 0.58 genel bir standart sapma ve% 103 verimle yöntem performans kriterleri karşılayan, ancak kat daha az yaklaşık yüz hassasiyet ve dolayısıyla norovirus eğrileri daha yüksek saptama sınırı vardır.


Şekil Moleküler Usul 1. Genel Bakış. Moleküler prosedürü bulaşıcı bir virüs, nükleik asitlerin ekstre edilmesi ölçmek için yapılan ötesinde ek örnek konsantrasyonunu içeren, iki aşamalı bir transkripsiyon (RT) protokolü, ve kantitatif PCR (qPCR) ters. Başlangıç ​​hacmi (S) başlangıçtaki su numunesi için bir yöntem tanımlanmış bir kısmını temsil eder.

Şekil 2,
Şekil 2. RT-qPCR genel şematik. Her ekstre test örneği RNA ters üçlü deneyleri (RT1, RT2 ve RT3) kullanılarak transkripsiyonu. Daha sonra ayrı enterovirüs (EV PCR) kullanarak belirli virüsler için analiz edilir üçlü RT deneyleri, norovirus genogroup ben (Nov GIA PCR ve Kasım GIB PCR), norovirus genogroup II her cDNA (NOV GII PCR) ve hepatit G (HGV PCR) analizleri.

Şekil 3,
Şekil 3. Ortalama Poliovirüs ve Ground adlı Fare Norovirüs Kurtarma (%) ve Reaktif-Grade su. Ortalama yüzde kurtarma yerden polyovirüsten (için gösterilir Şekil 3-1 ; n = 7) ve reaktif sınıftan ( Şekil 3-2 ; n = 12), su ve yerden fare norovirusa için ( Şekil 3-3 ; n = 7) ve reaktif sınıftan ( Şekil 3-4 ; n = 12) su (1), burada, "n" işlenmiş ayrı su örneklerinin sayısıdır. Hata çubukları standart hatasını temsil eder.

Şekil 4, Şekil 4. Enterovirüs ve Norovirüs GII Standart Eğrisi. Enterovirüs için tipik standart eğrileri ve norovirus GII gösterilmiştir. Eğim ve R her eğri için 2 değerleri veren formüller termal döngü ile hesaplanır.

İletişim Dosya 1. Bu dosyayı indirmek için buraya tıklayınız.

Virüs Grup Primer / Prob İsim (1) Sıra (2) Referans
Enterovirüs
EntF (EV-L) 20
ENTR (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-prob) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirüs GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirüs GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirüs GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirüs GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Hepatit G
HepF (5'-NCR ileri doğru primer) CGGCCAAAAGGTGGTGGATG 19
HEPR (5'-NCR ters primer) CGACGAGCCTGACGTCGGG 19
HES (hepatit G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tablo 1. Astar ve RT-qPCR Virüs Algılama için TaqMan Problar.
(1) Yöntem 1615 primer ve prob isimleri Vadeli ters ve prob için F, R veya P birleştirilmiş virüs adının ilk üç harfi vardır. Norovirus genogroup isimlerine GI ve GII ekleyerek belirlenir. Ayrıca, birincil referanslar A ve B Primer ve prob adları kullanılarak ayırt edilir iki norovirus GI primer setleri ebeveyn verilmiştirmeye çok.
(2), primer ve prob dizilerinin oryantasyonu 'ila 3' 5'tir. Aşağıdaki dejenere baz göstergeleri kullanılmaktadır: dört tane nükleotidin tamamının N-bir karışımı; R-A + G; Y-T + ° C; W-A + T; ve I-inosin.

Bileşen Reaksiyon başına Hacmi (ul) (2) Nihai konsantrasyon Master Mix (| il) başına Hacmi (3)
RT Master Mix 1
Rastgele primer 0,8 10 ng / | il (c. 5.6 uM) 84
Hepatit G zırhlı RNA (4) 1 105
PCR sınıf su 14.7 1543,5
Karşıtal 16.5 1732,5
RT Master Mix 2
10x PCR Tampon II 4 10 mM Tris, pH 8.3, 50 mM KCI 420
25 mM MgCI2- 4.8 3 mM 504
10-mM dNTPler 3.2 0,8 mM 336
100-mM DTT 4 10 mM 420
RNaz inhibitör 0.5 0,5 birim / ul 52.5
SuperScript II RT 0.3 1.6 ünite / ul 31.5
Toplam 16.8 1764

Tablo 2. RT Master Mix 1 ve 2 (1).
(1) cl RT Usta Mixes hazırlayınyani EAN oda, moleküler ve mikrobiyolojik usuller gerçekleştirilen edilmez bir oda.
(2) Nihai RT deney hacmi 40-ul olduğunu.
(3) hacmi 105 tahlillerinde dayanmaktadır göstermektedir. İlave deneyler, kayıplar hesaba eklenen bu, 96 oyuklu bir plaka, PCR için yeterlidir. Miktar analiz edilecek örneklerin ve kontrollerin sayısına göre yukarı veya aşağı ölçeklendirilebilir olabilir.
(4) ek malzemeler Aşama S4 tarif edildiği gibi RT Master Mix 1 dahil etmek hepatit G reaktif miktarını belirler.

Bileşen Reaksiyon başına Hacmi (ul) (2) Nihai konsantrasyon Master Mix (| il) başına Hacmi (3)
2x LightCycler 480 Sondalar Master Mix 10 Tescilli 1050
ROX referansıboya (4) 0.4 0.5 mM 42
PCR sınıf su 1 105
10 uM EntF 0.6 300 nM 63
10 uM ENTR 1.8 900 nM 189
10 uM ENTP 0,2 100 nM 21
Toplam 14 1470

Tablo 3. PCR Master Mix Enterovirüs (EV) Testi için (1).
(1) bir temiz oda tüm PCR Master Mixes hazırlayın.
(2) Nihai qPCR tahlil hacmi 20 ul olduğunu.
(3) hacmi 105 tahlillerinde dayanmaktadır göstermektedir. İlave deneyler, kayıplar hesaba eklenen bu, 96 oyuklu bir plaka, PCR için yeterlidir. Miktar numune ve irade kontrollerin sayısına göre büyütülüyor veya aşağı olabiliranaliz edilebilir.
Bu reaktifin (4) Yedek PCR sınıf su it gerekmez enstrümanlar kullanarak.

Bileşen Reaksiyon başına Hacmi (ul) (2) Nihai konsantrasyon Master Mix (| il) başına Hacmi (3)
2x LightCycler 480 Sondalar Master Mix 10 Tescilli 1050
ROX referans boya (4) 0.4 0.5 mM 42
PCR sınıf su 1.4 147
10 uM NorGIAF 1 500 nM 105
10 uM NorGIAR 1 500 nM 105
10 uM NorGIAP 0,2 100 nM 21
Toplam 14 1470

Tablo 4. Norovirus GIA PCR Master Mix (Kas GIA) Deneyi (1).
Dipnotların bakınız Tablo 3 (1) - (4).

Bileşen Reaksiyon başına Hacmi (ul) (2) Nihai Konsantrasyon Master Mix (| il) başına Hacmi (3)
2x LightCycler 480 Sondalar Master Mix 10 Tescilli 1050
ROX referans boya (4) 0.4 0.5 mM 42
PCR sınıf su 0.3 31.5
10 uM NorGIBF 1 500 nM 105
10 uM NorGIBR 1.8 900 nM 189
10 uM NorGIBP 0.5 250 nM 52.5
Toplam 14 1470

Tablo 5. Norovirus GİK PCR Master Mix (Kas GIB) Deneyi (1).
Dipnotların bakınız Tablo 3 (1) - (4).

<td> 0.5 mM
Bileşen Reaksiyon başına Hacmi (ul) (2) Nihai Konsantrasyon Master Mix (| il) başına Hacmi (3)
2x LightCycler 480 Sondalar Master Mix 10 Tescilli 1050
ROX referans boya (4) 0.4 42
PCR sınıf su 0.3 31.5
10 uM NorGIIF 1 500 nM 105
10 uM NorGIIR 1.8 900 nM 189
10 uM NorGIIP 0.5 250 nM 52.5
Toplam 14 1470

Tablo 6. Norovirüs GII için PCR Master Mix (Nov GII) Deney (1).
Dipnotların bakınız Tablo 3 (1) - (4).

Bileşen Reaksiyon başına Hacmi (ul) (2) Nihai Konsantrasyon Master Mix (| il) başına Hacmi (3)
2x LightCycler 480 Sondalar Master Mix 10 Tescilli 1050
ROX referans boya (4) 0.4 0.5 mM 42
PCR sınıf su 0.3 31.5
10 uM MuNoVF1 1 500 nM 105
10 uM MuNoVR1 1.8 900 nM 189
10 uM MuNoVP1 0.5 250 nM 52.5
Toplam 14 1470

Tablo 7. PCR Master Mix Fare Norovirüs Testi için (1).
Dipnotların bakınız Tablo 3 (1) - (4).

Bileşen CiltReaksiyon başı (ul) (2) Nihai Konsantrasyon Master Mix (| il) başına Hacmi (3)
2x LightCycler 480 Sondalar Master Mix 10 Tescilli 1050
ROX referans boya (4) 0.4 0.5 mM 42
PCR sınıf su 1.4 147
10 uM HepF 1 500 nM 105
10 uM HEPR 1 500 nM 105
10 uM Hepp 0,2 100 nM 21
Toplam 14 1470

Tablo 8. Hepatit G PCR Master Mix (HGV), Analiz (1).
Görmek

Standart Eğri Konsantrasyon RT-qPCR deney başına genomik kopyalar (1, 2)
2.5 x 10 8 502.500
2.5 x 10 7 50.250
2.5 x 10 6 5025
2.5 x 10 5 502,5
2.5 x 10 4 50.25
2.5 x 10 3 5,025

Tablo 9. Standart Eğrisi Genomik kopyalar.
(1) standartları gibi standart eğri kuyu tanımak ve termo yazılımı uygun bir yere RT-qPCR tahlil değerlerinin başına genomik kopya koyun.
(2) kabul edilebilir bir standart eğri% 70 -110% bir verimlilik olacak, R 2 değeri> 0.97, ve norovirusa için genel bir standart sapma <0.5 ve Enterovirüs için <1.0.

Kriterler Kabul edilebilir değer
Norovirüs Enterovirüs
Genel Standart Sapma <0,5 <1.0
R 2 > 0.97 > 0.97
Verimlilik % 115% 70 % 115% 70

Tablo 10. Standart Eğrisi Kabul Kriterleri (1).
(1)% 70 -110,%% 'si verimliliği ile standart eğriler olarak kabul edilebilir, fakat% 90% -115 aralığında değerler idealdir. Az% 90 daha Değerler pipet veya seyreltme hatalarını gösterebilir.

QA Bileşeni Ortalama Kurtarma Aralığı (%) Değişim Katsayısı (%)
Laboratuvar Reaktif Blank; Negatif PT veya PE örnekleri 0 N / A (1)
Laboratuvar Blank Müstahkem; Lab Güçlendirilmiş Numune Matrisi 5-200 N / A
Pozitif PT ve PE örnekleri 15-175 ≤130

Tablo 11. Yöntem 1615 Performans Kriterleri.
(1) Uygulanamaz.

Basın Kompozisyon
0,15 M sodyum fosfat, pH 7.0-7.5 1 L dH bir son hacim içinde, sodyum fosfat, dibazik (Na 2 HPO 4 · 7H 2 O) 40.2 g eritilmesi ile, 0.15 M sodyum fosfat hazırlama
% 5 BSA DH 2 O. 100 ml BSA, 5 g çözülerek hazırlayın 0.2-um sterilizasyon filtresi yardımıyla geçirilmesiyle sterilize edin.
PBS,% 0.2 BSA PBS 96 ml% 5 BSA 4 ml ekleyerek hazırlanır. 0.2-um sterilizasyon filtresi yardımıyla geçirilmesiyle sterilize edin.
TSM III tampon 1.21 g Trizma baz, 5.84 g NaCl, 0,203 g MgCI2, 1 mi Prionex jelatin ve 950 ml distile su içinde 3 ml Microcide III eritin. 7.0 pH ayarlama ve daha sonra bir 0.2-um sterilizasyon filtresi yardımıyla geçirilmesiyle 1 L sterilize etmek için son hacim getir.
0.525% sodyum hipoklorit (NaClO) D ev çamaşır suyu 01:10 seyreltilmesi ile bir 0.525% NaClO çözüm hazırlayınH 2 O. RT'de kadar 1 hafta boyunca 0.525% NaClO çözümleri saklayın.
1-M sodyum tiyosülfat (Na 2 S 2 O 3) pentahidrat DH 2 O. 1 L S 2 O 3, Na 2 248,2 g eriterek bir 1 M'lik çözelti hazırlayın RT'de 6 aya kadar Store sodyum tiyosülfat.

Medya Tablo 12. Tablo.

Discussion

Kaynak ve içme sularının viral bulaşma Büyük ölçekli ulusal çalışmalar birden analitik laboratuarlar kullanılmasını gerektirir. Bu koşullar altında standart bir yöntemdir birden laboratuvarlar tarafından üretilen veriler karşılaştırılabilir olmasını sağlamak için gereklidir. Virüs tespiti için yayınlanmış birçok moleküler yöntemler, ama çok az standardize moleküler yöntemler vardır. EPA Method 1615, özellikle RT-qPCR su matrislerde Enterovirüs ve norovirusa tespiti için tasarlanmış standart bir yöntemdir. Standardize moleküler yöntemler gıdalarda virüs tespiti için mevcuttur; 16,17 (15216-2 CEN / ISO TS 15216-1 ve CEN / ISO TS 7 Nisan 2013) ve hepatit A virüsü tespit ve norovirus ilkbaharda uygulandı su 16. Tüm standart yöntemler kalite performans kontrolleri ve kriterleri arası en aza indirmek ve içi laboratuvar varyasyonu nedeniyle laboratuvar kontaminasyonu yanlış pozitif verileri içermelidir. Ayrıca, E yanlış veri azaltmak içinPensilvanya Yöntem 1615 işlemci ve tek yönlü iş akışı sırasında iş ayrılmasını öngören moleküler yöntemler üzerinde EPA'nın rehberlik, 18 izler. Bir hepatit G 1,19 iç kontrol nedeniyle RT-qPCR 15 inhibitörleri yanlış negatif sonuç en aza indirmek için prosedürleri içermektedir. Tüm alan veri alanının litre veya su örneklenmiş içme başına genomik kopya ifade edilir, böylece analiz örneklenmiş su ve suyla standardize hacimleri ile birlikte niceliksel tahlilleri kullanır. Etkin tek bir tüp (tek-aşama) RT-PCR deneyleri, ticari olarak mevcut olmakla birlikte, bu yöntem kasıtlı ayrı analizler kullanılır. Bu, her bir reaksiyonda analiz edilebilir numune miktarını minimize etme dezavantajına sahiptir, ancak birden fazla primer kümelerinin kullanımı daha fazla esneklik sağlar. Primerleri ve sondaları kullanılan ve büyük olasılıkla hiçbir astar seti bir grup dahilindeki tüm virüs türevlerini algılamak gibi RT-qPCR deneyleri ile ve sadece iyi sınırlıdır. Enterovirüs primer seti nedeniyle seçildiBu 20,21 enterovirüs serotiplerinin çeşitli algılar korunmuş 5 'kodlamayan bölgeye hedef ve bunun ile tespit virüs, işlemden geçirilmemiş yer altı 1 tüketiminden sağlık etkileri ile ilişkilidir. Iki astar set I 22,23 Noroviruses genogroup saptanması için kullanılır. İlk küçük çocuklarda sağlık etkileri arasındaki güçlü korelasyon nedeniyle seçilmiş ve virüs 1. tespit edildi. Onlar suşları 24,25 geniş çeşitliliği tespit çünkü set edilen primer ikinci genogroup ve genogroup II Noroviruses için kullanılan primer seti seçildi.

Su içinde viral RNA saptanması için qPCR RT-qPCR prosedürlerinin en önemli avantajlara rağmen, bazı sınırlamalar vardır. İlk olarak, dezenfektanlar tarafından inaktive de dahil olmak üzere, her iki bulaşıcı ve bulaşıcı olmayan virüs parçacıkları, bu işlemler ile amplifiye edilebilir. Borchardt sonuçları bu tedavi edilmemiş yeraltı f bir sorun daha az olduğunu göstermektedirtopluluklarda benzer rom akiferler dezenfekte yüzey suları 1 den okudu. Kültürlenebilir virüs için bu sorun, kültür 26,27 ile birlikte PCR kullanılarak aşılabilir. Sorun, nükleik asit çapraz bağlama maddeleri 28-30 kullanımı ile, bazı virüs ele alınmıştır. Bu yaklaşım virüs hipokloritin inaktive edilmiş ve UV ile inaktive olanlar için etkili değildir için daha etkilidir.

Bu moleküler prosedürlerin İkinci bir kısıtlama tipik olarak analiz edilebilir konsantre edildi numune hacmi kültürü prosedürler 6,31 için kullanılan daha küçük olmasıdır. Bu sorun, genellikle her iki örnek daha küçük bir hacimde yeniden asıldı ve bir üçüncül Örnek konsantrasyonu aşama 6,32,33 eklenerek sağlar Organik flokülasyon standart sekonder konsantrasyonu temin etmek üzere bir polietilen glikol tabanlı bir prosedür ile ikame tarafından işlenir . Yöntem 1615 Santrifüj kullanırugal ultrafiltrasyon tertier konsantrasyonu elde edildi. Santrifüj ultrafiltrasyon su ve test numunelerinde herhangi bir virüsün hem de konsantrasyon ve moleküler deneylerinin küçük molekül ağırlıklı inhibitörlerinin bir azalma ile elde edilen bileşenler daha az 30.000 Dalton kaldırır. Su içinde mevcut olan herhangi bir virüs için> 10 5 genel bir yoğunlaşma katsayısına bu tertier konsantrasyon adımı sonuçları, test edilen.

Üçüncü bir kısıtlama çevre numuneleri içinde molekül prosedürlerin önleyicileri varlığıdır. Inhibitörleri kaldırmak için çok sayıda yaklaşımlar geliştirilmiş olmasına rağmen, hiçbir yaklaşım temel inhibisyon seviyesini tahmin etmek için tasarlanmıştır iç kontrollerin yararlanarak, tüm su matrisler ve virüs türleri 6,34,35 için etkilidir. Bu yöntemde kullanılan hepatit G reaktifi bütün reaksiyonlar ve inhibisyon tahmin edilmesi için bir RT-qPCR deneyinde viral RNA sabit bir seviyede sağlayarak bu gereksinimi karşılamaktadır. Ne zaman t iyiO örnek konsantreleri sürece virüs konsantrasyonları konsantrasyonları 14,15 inhibitörü daha yüksek olarak seyreltilmiş olabilir, kaldırma yaklaşımları inhibisyonu kaldırmak için başarısız inhibitör.

Burada açıklanan standart eğri prosedürü avantaj ve büyük bir sınırlama hem de sahiptir. Bir avantajı, reaktif madde, tek bir kontrol Tüm deneyler için kullanılacak sağlayan tek bir reaktif içinde Sarf gerekli tüm bileşenlerin kullanılmasıdır. Bu reaktif, özellikle norovirus deneyleri için bir avantajdır. Norovirus partiküllerinin, sadece çok zor standartlar olarak kullanım için, viral parçacıklar elde etmek hale enfekte bireylerden elde edilebilir. En önemli avantaj, bir RNA, standart RNA 36 doğru ölçümü için gerekli olan gibi, tek bir reaktif içinde hedeflenen tüm RNA virüsleri için bir RNA standart sağlamasıdır. Ancak bunun yanında, virüs ölçmek için kabiliyeti matriks etkileri dikkate alınmadığı gerçeği ile sınırlıdır. Bu, genomik kopyasını demektirsayısı değerler, mutlak değerler olarak kabul edilemez ve sadece göreli olarak dikkate alınmalıdır. Bu standart eğri çalışma stok alikotları yeterli sayıda (1.2 adım) tam çalışmaları kapsayacak şekilde hazırlanmış olması tavsiye edilir. Örneğin, her 250 ul alikot 6 RT plakaları için yeterli bir reaktif sağlar. Bir çalışmada, 500 numune analiz gerektirir olacağı biliniyorsa, 12 alikotları en az (500 numune RT plaka başına / 7 numune / alikotundan başına 6 RT plakaları) ihtiyaç olacaktır.

EPA Method 1615 performansa dayalı bir yöntemdir. Birçok üretici, burada belirtilen eşdeğer reaktifler yapmak ve bu reaktifler sürece performans kriterleri karşılandığı gibi ikame edilebilir. Ayrıca pozitif bir RT-qPCR kontrol olarak hizmet vermektedir standart eğri, sorun performans sorunları değer taşımaktadır. Performans nedeniyle RNA bozulması, reaktif raf ömrü, dondurucular başarısızlığı, alet kalibrasyon ve teknik hata reddedebilirsiniz. Performans sorunları şüpheli olmalıonlar standart eğrileri için performans özelliklerini karşılamak değilse ed standart eğrileri Şekil 4'te gösterilen bu farklı ya da eğer. RT-qPCR tahlil oldukça sağlamdır; tam bir başarısızlık nedeniyle RNA veya teknik bir hata (örneğin, bir eksik reaktif) yanlış kullanım muhtemeldir. Büyük bir dikkatle çıkarma ve ribonükleazlar RNA bozulmasını azaltmak için RT adım arasında RNA örnekleri ele alınmalıdır.

Zemin ve reaktif dereceli suları ve yeraltı fare norovirus rücu Poliovirüs kazanımları EPA Method 1615 performans kabul kriterleri (Tablo 11) tanıştı ve diğerleri 33,37,38 tarafından bildirilen benzemektedir. LFB örneklerinden Murin norovirus kazanımları poliovirus oranla çok daha düşük olduğunu ve polio virüsünün özel kabul kriterleri yerine olmazdı. Reaktif dereceli sudan daha düşük fare norovirus kurtarma nedenleri bilinmemektedir. Bu tarifnamede sonuçlara benzer şekilde, Karim ve colleagues musluk suyu 39% 4 norovirus GI.1 bir iyileşme bildirmiştir. Lee et al. 37 sıçangil norovirusa ve% 18 insan norovirus GII.4 ve sırasıyla disk filtreleri kullanılarak damıtılmış su% 26 için ortalama geri kazanımını bildirilmiştir. Lee ve meslektaşları benzer şartları kullanarak, Kim ve Ko sırasıyla 38, bu virüsler için% 46 ve% 43 geri kazanımını gözlendi. Gibbons ve ark., 40, deniz suyundan, insan norovirus GII.4% 100 geri etrafında çevresel olarak elde ama Kim ve Ko 38 konsantrasyonları, benzer ya da murin virüs önemli ölçüde azaltılmış geri kazanımları deniz suyundan daha yüksek ve damıtılmış su tuz ilavesi sonuçlandığı bulunmuştur GII.4 kurtarma ile ilgili olarak iki kat azalma.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics