Enterovirus और संस्कृति और RT-qPCR द्वारा पानी में Norovirus घटना की ईपीए विधि 1615 मापन। भाग III। RT-qPCR द्वारा वायरस का पता लगाने

Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

मात्रात्मक पीसीआर (qPCR; इस पांडुलिपि में प्रयुक्त शब्दों की परिभाषा के लिए पूरक सामग्री देखें) और प्रतिलेखन qPCR (आरटी-qPCR) पानी का पता लगाने और पर्यावरण में मानव आंतों का वायरस बढ़ाता है और पीने के लिए मूल्यवान उपकरण हैं, और विशेष रूप से करते हैं कि कई वायरस के लिए रिवर्स दोहराने या सेल संस्कृति प्रणालियों में खराब नकल नहीं। दोनों उपकरण कई वायरस प्रकार दुनिया भर में 1-6 पर्यावरण और पीने के पानी में मौजूद हैं जो प्रदर्शन किया है। वे पीने के पानी में पाया वायरस फैलने रोगियों 7-10 से कि शेड के समान है पता चला है कि के रूप में रोग के प्रकोप की जांच के दौरान परिलक्षित जीनोमिक टुकड़ों का अनुक्रमण के साथ युग्मित उनके उपयोग, जलजनित वायरस संचरण के लिए सबूत प्रदान की गई है।

QPCR और RT-qPCR दोनों उपयोगी सार्वजनिक स्वास्थ्य उपकरण हैं। उदाहरण के लिए, अमेरिकी पर्यावरण संरक्षण एजेंसी (ईपीए) द्वारा किए गए अध्ययन से डेटा एक मजबूत रिश्ता होना दिखायाqPCR और मनोरंजन पानी में स्वास्थ्य के प्रभाव से बीच सूचक माप। नतीजतन, ईपीए के अंतिम 2012 मनोरंजनात्मक जल गुणवत्ता मानदंड मनोरंजन समुद्र तटों 11,12 निगरानी के लिए एक qPCR विधि भी शामिल है। RT-qPCR 1 द्वारा मापा Borchardt और सहयोगियों ने भी भूजल में इलाज भूजल और वायरस का उपयोग समुदायों में तीव्र आंत्रशोथ के बीच एक मजबूत संबंध पाया गया।

इस पत्र का उद्देश्य ईपीए विधि 1615 13,14 की आणविक परख घटक वर्णन करने के लिए है। इस परख एक विद्युत धन फिल्टर के माध्यम से Enterovirus और पारित पर्यावरण या पीने के पानी की मूल मात्रा के आधार पर प्रति लीटर नोरोवायरस जीनोमिक प्रतियां (जीसी) का एक मात्रात्मक अनुमान प्रदान करने के लिए RT-qPCR का उपयोग करता है। आणविक प्रक्रिया का एक सिंहावलोकन मानक वक्र की तैयारी के लिए 1। प्रोटोकॉल अनुभाग चित्रा में 1 विवरण प्रक्रियाओं दिखाया गया है। इन मानकों को एक आर.एन. होता है कि एक अभिकर्मक से तैयार कर रहे हैंसभी प्राइमर / जांच सेट के लिए लक्ष्य अनुक्रम की एक प्रति। धारा 2 तृतीयक एकाग्रता प्रक्रिया का वर्णन है। धारा 3 केंद्रित पानी और नियंत्रण के नमूने से शाही सेना को निकालने के लिए प्रक्रिया देता है। प्रत्येक परीक्षा नमूना से शाही सेना रिवर्स तीन प्रतियों assays और प्रधानमंत्री प्रतिलेखन (धारा 4) के लिए यादृच्छिक प्राइमरों का उपयोग लिखित है। (चित्रा 2 धारा 5) प्रत्येक रिवर्स प्रतिलेखन प्रतिक्रिया से सीडीएनए qPCR द्वारा तीन प्रतियों में विश्लेषण कर रहे हैं कि पांच अलग-अलग वायरस विशेष assays में विभाजित है। परख कई enteroviruses और noroviruses और RT-qPCR से 15 निरोधात्मक हैं कि परीक्षण के नमूने की पहचान करने के लिए हेपेटाइटिस जी आरएनए युक्त एक अभिकर्मक पता लगाने के लिए तैयार कर रहे हैं कि वैज्ञानिक साहित्य (तालिका 1) से प्राइमरों और जांच उपयोग करता है।

Protocol

नोट: उपयोग डाटा शीट प्रोटोकॉल के सभी चरणों को ट्रैक करने के लिए; उदाहरण के डाटा शीट पूरक सामग्री टेबल्स एस 2-एस 4 में दिया जाता है।

1. मानक वक्र तैयारी

  1. (जैसे, बख़्तरबंद आरएनए ईपीए-1615) 2.5 x 10 8 कणों / एमएल (2.5 x 10 8 जीसी / एमएल) टी एस एम का उपयोग करने का एक एकाग्रता के लिए निर्माता द्वारा आपूर्ति की एकाग्रता से यह गिराए द्वारा मानक वक्र अभिकर्मक के एक काम स्टॉक तैयार तृतीय बफर। -20 डिग्री सेल्सियस पर 1.5 मिलीलीटर microcentrifuge ट्यूब और दुकान का उपयोग कर 250 μl aliquots में काम कर शेयर फूट डालो।
    नोट: वैकल्पिक मानक वक्र अभिकर्मकों के रूप में उपयोग के लिए तैयारी कर काम कर रहे हैं वायरस के शेयरों और plasmids पर निर्देश के लिए पूरक सामग्री प्रोटोकॉल चरण एस 1 देखें।
  2. काम कर शेयर aliquots की एक या एक से अधिक गला लें। 2.5 10 x 7 की सांद्रता दे रही है, 2.5 x 10 6, 2.5 x 1.5 मिलीलीटर microcentrifuge ट्यूब का उपयोग कर पांच से 10 गुना धारावाहिक dilutions तैयार10 5, 2.5 10 x 4, और 2.5 x 10 3 जीसी / मिलीलीटर।
    1. टी एस एम तृतीय बफर के 225 μl के लिए 2.5 x 10 8 जीसी / मिलीलीटर काम कर रहे शेयर के 25 μl जोड़कर पहले कमजोर पड़ने को तैयार है। एक भंवर मिक्सर का उपयोग 5-15 सेकंड के लिए मिलाएं।
    2. टी एस एम तृतीय बफर के 225 μl करने के लिए कदम 1.2.1 में तैयार कमजोर पड़ने के 25 μl जोड़कर अगले कमजोर पड़ने को तैयार है। फिर मिश्रण और अगले तीन से 10 गुना dilutions तैयार करने के लिए इसी तरह की प्रक्रिया जारी है।
  3. मानक वक्र काम कर स्टॉक से शाही सेना और तुरंत धारा 3 में प्रक्रिया का उपयोग कर पांच dilutions निकालें।

2. तृतीयक एकाग्रता

  1. ऊपरी नमूना कक्ष के लिए 1x पीबीएस के कम से कम 10 मिलीलीटर, 0.2% गोजातीय सीरम albumin (बीएसए) जोड़कर एकत्र प्रत्येक नमूने के लिए एक केन्द्रापसारक concentrator (30,000 आणविक वजन कटऑफ) तैयार करें। समाधान है कि पतली चैनल एकाग्रता चैम्बर भर गया है सुनिश्चित करें, और उसके बाद 4 डिग्री सेल्सियस पर हे / एन पकड़।
  2. एस, अलग केन्द्रापसारक concentrators में परख नमूना मात्रा के बराबर प्रत्येक परीक्षा नमूना से पानी माध्यमिक ध्यान केंद्रित करने की एक राशि जोड़ें।
    1. 1 समीकरण का उपयोग करते हुए एस की गणना,
      1 समीकरण
      डी assayed मूल पानी नमूने की मात्रा कहां है, TSV कुल नमूना मात्रा है और FCSV अंतिम नमूना केंद्रित मात्रा है। एस की गणना का एक उदाहरण के लिए पूरक सामग्री S2 देखें
  3. अपकेंद्रित्र 20 के लिए एक झूलते बाल्टी रोटर में 4 डिग्री सेल्सियस पर 3,000-6,000 XG पर प्रत्येक परीक्षा नमूना - 30 मिनट। पतली चैनल एकाग्रता कक्ष में मात्रा की जाँच करें।
    1. मात्रा 20 मिनट या उससे अधिक समय के लिए फिर से एक से अधिक 400 μl, सेंट्रीफ्यूज है। वें में नमूना तक centrifuging जारीई पतली चैनल एकाग्रता चैम्बर कम से कम 400 μl को कम किया गया है। सतह पर तैरनेवाला न निकालें।
  4. वायरस वसूली बढ़ाने के लिए बाँझ 0.15 मीटर सोडियम फास्फेट के 1 मिलीलीटर, पीएच 7-7.5 साथ केन्द्रापसारक concentrator के पक्षों को धो लें। अपकेंद्रित्र फिर से 3,000-6,000 XG और 4 डिग्री सेल्सियस पर नमूना कम से कम 400 μl को कम कर दिया गया है जब तक। इस धोने कदम एक अतिरिक्त समय दोहराएँ।
  5. एक 100-200 μl micropipette का प्रयोग सावधानी से मापने के लिए और एक 1.5 मिलीलीटर microcentrifuge ट्यूब (यानी, microcentrifuge ट्यूब 200 μl हस्तांतरण और शेष तरल पदार्थ को पूरी तरह से तैयार किया जा सकता जब तक उसके micropipette का समायोजन करके शेष ध्यान केंद्रित करने के लिए उपाय करने के लिए प्रत्येक केंद्रित नमूना हस्तांतरण ) pipettor टिप में। 400 ± 2 μl अंतिम मात्रा को समायोजित करने के लिए, 0.15 मीटर सोडियम फास्फेट, पीएच 7-7.5 जोड़ें।
  6. तुरंत 3. processe नहीं किया जा सकता है कि किसी भी केंद्रित नमूने पकड़ कदम के लिए आगे बढ़ने से न्यूक्लिक एसिड निकालेंघ तुरंत कोई अधिक से अधिक 24 घंटे के लिए 4 डिग्री सेल्सियस पर।

3. न्यूक्लिक एसिड अलगाव

  1. 1.5 मिलीलीटर microcentrifuge ट्यूब लेबल अलग करने के लिए कदम 1.3 से 2.5 चरण या मानक वक्र कमजोर पड़ने से प्रत्येक परीक्षा नमूना से चरण में तृतीयक सांद्र 3.3 और 200 μl वर्णित के रूप में तैयार की निकासी बफर के 200 μl जोड़ें। पर या -70 डिग्री सेल्सियस से नीचे तृतीयक केंद्रित शेष रुक। निम्न अपवादों के साथ रक्त के नमूने लिए स्पिन प्रोटोकॉल के लिए न्यूक्लिक एसिड निकासी किट निर्माता के निर्देशों के अनुसार प्रत्येक नमूने से न्यूक्लिक एसिड निकालें।
  2. पानी के नमूने लिए प्रोटीज को जोड़ने या न्यूक्लिक एसिड निकासी किट के साथ आपूर्ति की निकासी बफर का प्रयोग न करें।
  3. वाहक शाही सेना के साथ निकासी बफर तैयार
    1. वाहक शाही सेना के 310 माइक्रोग्राम से युक्त एक शीशी वाहक आरएनए कमजोर पड़ने बफर के 310 μl जोड़ें। भंग करने और उसके बारे में 50 μl युक्त 6 aliquots में विभाजित करने के लिए मिलाएं। -20 पर स्टोरसी।
    2. 0.027 ग्राम / μl के वाहक आरएनए एकाग्रता प्राप्त करने के लिए निकासी बफर के प्रति मिलीलीटर Thawed वाहक शाही सेना के 28 μl जोड़ें। निकासी किट के साथ आपूर्ति की है कि के स्थान पर वाहक शाही सेना में संशोधन निकासी बफर का प्रयोग करें।
  4. Ribonuclease जोड़कर क्षालन बफर के एक मास्टर समाधान तैयार (RNase) अवरोध निकासी किट के साथ आपूर्ति की क्षालन बफर के लिए 400 यूनिट / मिलीलीटर की एक अंतिम एकाग्रता के लिए।
    1. स्तंभ में RNase अवरोध करनेवाला के साथ क्षालन बफर के 50 μl रखकर स्पिन स्तंभ बाध्यकारी न्यूक्लिक एसिड से Elute आरएनए। 1 मिनट के लिए प्रतीक्षा करें, और फिर आरटी पर 1 मिनट के लिए 6000 XG पर अपकेंद्रित्र।
    2. दोहराएँ चरण 3.4.1 और फिर हटाने और स्तंभ त्यागें।
  5. चरण 3.4.2 से शाही सेना के अर्क की aliquots तैयार करें। 6 मानक वक्र काम कर शेयर की aliquots और कम से कम 15 μl प्रत्येक युक्त प्रत्येक मानक वक्र कमजोर पड़ने को तैयार है। कम से कम युक्त अन्य सभी शाही सेना के नमूने के 4 aliquots तैयार22 μl प्रत्येक। वे 4 घंटा के भीतर रिवर्स प्रतिलेखन द्वारा कार्रवाई की जा सकती है, तो 4 डिग्री सेल्सियस पर प्रत्येक नमूना और मानक वक्र नियंत्रण में से एक विभाज्य दुकान; अन्यथा, पर या -70 डिग्री सेल्सियस से नीचे सभी aliquots दुकान।

4. रिवर्स प्रतिलेखन (आरटी)

  1. दस गुना के बराबर (microliters में) में मौजूद oligonucleotide के nanomoles (nmol) की संख्या एक राशि का उपयोग कर प्रत्येक शीशी पीसीआर ग्रेड पानी की मात्रा जोड़कर 1 टेबल में सूचीबद्ध प्रत्येक oligonucleotide प्राइमर और जांच की 100 माइक्रोन के शेयर समाधान तैयार शीशी लेबल पर या जैसे निर्माता के विवरण पत्र (के रूप में दिखाया शीशी (,) 363 μl में 36.3 nmol युक्त एक किताब resuspend। भंग करने के लिए मिलाएं।
    1. समाधान काम 10 माइक्रोन तैयार करने के लिए पीसीआर ग्रेड पानी के साथ 100 माइक्रोन के समाधान 01:10 पतला।
  2. 2। पिपेट तालिका में गाइड का उपयोग कर एक साफ कमरे में आर टी Maste की 16.5 μl आरटी मास्टर मिक्स 1 और 2 को तैयारप्रत्येक पीसीआर थाली करने के लिए आर मिक्स 1 अच्छी तरह से एक मल्टीचैनल पिपेट का उपयोग।
  3. पिघलना, जमे हुए हैं, तो प्रत्येक क्षेत्र नमूना और लैब दृढ़ नमूना मैट्रिक्स से न्यूक्लिक एसिड अर्क (LFSM, यानी, वरीयता प्राप्त पानी मैट्रिक्स नमूना)।
    1. RNase अवरोध की 400 इकाइयों / मिलीलीटर युक्त क्षालन बफर में 5 और 1:25: प्रत्येक क्षेत्र और LFSM नमूना 1 पतला।
    2. , प्रयोगशाला अभिकर्मक खाली (LRB, यानी, अभिकर्मक ग्रेड पानी का उपयोग कर एक नकारात्मक गुणवत्ता नियंत्रण), प्रदर्शन मूल्यांकन (पीई, पिघलना, जमे हुए हैं, लेकिन लैब गढ़वाले खाली (यानी, वरीय अभिकर्मक ग्रेड पानी का उपयोग कर एक सकारात्मक गुणवत्ता नियंत्रण LFB) को कमजोर नहीं है , यानी, वरीयता प्राप्त अभिकर्मक ग्रेड पानी के नमूने एक अध्ययन के शुरू करने से पहले प्रयोगशाला प्रदर्शन), प्रदर्शन टेस्ट (पीटी का मूल्यांकन करने के लिए प्रयोग किया जाता है, यानी, एक अध्ययन के दौरान प्रयोगशाला प्रदर्शन का मूल्यांकन करने के लिए इस्तेमाल कर रहे हैं कि एक विश्लेषक के अज्ञात titers के साथ वरीयता प्राप्त अभिकर्मक ग्रेड पानी के नमूने ), एनए बैच नकारात्मक निकासी नियंत्रण, या मानक वक्र सेट से निकाले शाही सेना।
    3. अलग पीसीआर थाली कुओं में हर परीक्षण नमूना, नियंत्रण, और मानक वक्र से शाही सेना के 6.7 μl रखें परीक्षण के नमूने और नियंत्रण के लिए तीन प्रतियों कुओं का उपयोग कर और मानक घटता (एक आर टी प्लेट उदाहरण के लिए चित्र एस 1 देखें) के लिए कुओं नकली।
      1. कोई टेम्पलेट नियंत्रण (एनटीसी) के लिए अलग से पीसीआर थाली कुओं में क्षालन बफर के 6.7 μl रखें। पहला नमूना के लिए दो और हर चौथे अतिरिक्त नमूना के लिए तो दो अधिक का उपयोग कर आरटी प्रति प्लेट 2-8 एनटीसी, शामिल हैं।
      2. थाली भर में नकारात्मक निकासी और एनटीसी नियंत्रण बांटो।
    4. एक गर्मी प्रतिरोधी प्लेट मुहर के साथ पीसीआर थाली सील। 5-10 सेकंड के लिए नमूने मिलाई और फिर ≥ 500 XG संक्षेप में अपकेंद्रित्र।
    5. 99 डिग्री सेल्सियस पर 4 मिनट के लिए थाली सेते हैं और फिर एक थर्मल cycler में 4 डिग्री सेल्सियस के लिए तेजी से शांत। अपकेंद्रित्र फिर ≥ 500 XG संक्षेप में।
    6. सावधानी प्लेट सील हटाने और फिर अच्छी तरह से प्रत्येक के लिए आर टी मास्टर मिक्स 2 की 16.8 μl जोड़ें। एसईअल मिश्रण के बाद एक गर्मी प्रतिरोधी प्लेट मुहर के साथ फिर से थाली, और ≥ 500 x जी पर एक संक्षिप्त centrifugation।
    7. एक 4 डिग्री सेल्सियस पकड़ चक्र से तो एक थर्मल cycler में थाली प्लेस और 99 डिग्री सेल्सियस पर 42 डिग्री सेल्सियस पर 60 मिनट के द्वारा पीछा 25 डिग्री सेल्सियस पर 15 मिनट के लिए 5 मिनट चलाने के लिए, और।
    8. प्रक्रिया तुरंत या qPCR (चरण 5), या दुकान के नमूने से 8 घंटे के भीतर कम से या नीचे -70 डिग्री सेल्सियस वे कार्रवाई की जा सकती है जब तक। 4 डिग्री सेल्सियस पर 8 घंटे के भीतर कार्रवाई की जा सकती है कि दुकान के नमूने हैं।

    5. वास्तविक समय मात्रात्मक पीसीआर (qPCR)

    1. पहले किसी भी नमूने परीक्षण चलाने के लिए हेपेटाइटिस जी अभिकर्मक से प्रत्येक के लिए बहुत कुछ मतलब हेपेटाइटिस जी Cq मूल्य का निर्धारण करते हैं।
      1. एनटीसी नियंत्रण (चरण 4.1.1) के लिए वर्णित के रूप में तैयार 10 प्रतिकृति का उपयोग कर एक आर टी परख चलाएँ। (5.5.3 के लिए 5.2 कदम) के रूप में नीचे वर्णित हेपेटाइटिस जी qPCR परख चलाएँ। 10 प्रतिकृति का मतलब Cq मूल्य की गणना।
      2. आर टी मास्टर मिक्स 1 में हेपेटाइटिस जी अभिकर्मक मात्रा (2 टेबल को समायोजित करें), यदि आवश्यक हो तो, 25 और 32 इकाइयों के बीच एक मतलब Cq मूल्य प्राप्त करने के लिए। पानी की मात्रा बदलकर उठाया है या कम राशि क्षतिपूर्ति परख प्रति 16.5 μl पर आरटी मास्टर मिक्स 1 अंतिम मात्रा रखने के लिए कहा।
      3. समायोजित मात्रा को प्रतिबिंबित करने के लिए 5.1.2 और परिवर्तन तालिका 2 के लिए कदम 5.1.1 दोहरा द्वारा किसी भी समायोजन की पुष्टि करें।
    2. Enterovirus के लिए 3 टेबल में गाइड का उपयोग कर एक साफ कमरे में qPCR मास्टर घोला जा सकता है तैयार, हेपेटाइटिस के लिए तालिका 4 और murine नोरोवायरस (नोरोवायरस genogroup वी) के लिए नोरोवायरस genogroup द्वितीय, टेबल 7 के लिए नोरोवायरस genogroup मैं टेबल 6 के लिए तालिका 5, और तालिका 8 जी मिक्स प्रत्येक मास्टर मिश्रण और फिर ≥ 500 XG संक्षेप में अपकेंद्रित्र।
    3. प्रत्येक qPCR परख के लिए अच्छी तरह से और अलग प्लेटों प्रति 14 μl का उपयोग कर, एक लेबल ऑप्टिकल प्रतिक्रिया प्लेट की उचित कुओं के लिए पीसीआर मास्टर घोला जा सकता जोड़ें (देखें चित्र S2 चित्रा एस 1 में आर टी लेआउट पर आधारित एक qPCR परख) के लिए एक संभव लेआउट के लिए।
    4. जमे हुए हैं, तो आरटी पर कदम 4.8 से आर टी प्लेट गला लें। एक प्लेट मिक्सर का उपयोग कर मिलाई और फिर ≥ 500 XG संक्षेप में अपकेंद्रित्र।
    5. ऑप्टिकल प्रतिक्रिया प्लेट की उचित कुओं के लिए उचित सीडीएनए के 6 μl बांटना। ≥ 500 XG संक्षेप में ऑप्टिकल प्रतिक्रिया प्लेट और सेंट्रीफ्यूज में नमूने मिलाएं।
      1. अन्य सभी qPCR assays चलाने से पहले undiluted और पतला क्षेत्र और LFSM नमूनों पर हेपेटाइटिस जी qPCR परख चलाएँ। क्षेत्र या है कि LFSM नमूना <Enterovirus और नोरोवायरस qPCR assays के लिए इसका मतलब यह हेपेटाइटिस जी Cq मूल्य से अधिक 1 Cq मूल्य के निम्नतम कमजोर पड़ने का प्रयोग करें।
      2. निर्माता के निर्देशों के अनुसार मात्रात्मक पीसीआर थर्मल cycler सॉफ्टवेयर की स्थापना की। मानकों के रूप में मानक की अवस्था के नमूनों की पहचान करने और प्रत्येक मानक वक्र कमजोर पड़ने के लिए, टेबल 9 में दिखाया गया जीनोमिक प्रतिलिपि मान दर्ज करें।
    6. प्रत्येक मानक वक्र तालिका 10 में दिए गए स्वीकार्य मूल्यों को पूरा करती है कि क्या निर्धारित है। उदाहरण के लिए पूरक सामग्री अनुभाग S3 देखें।
      1. 2 समीकरण का उपयोग कर मानक वक्र के लिए समग्र मानक विचलन (StdDev) की गणना,
        2 समीकरण
        Cq प्रत्येक मानक वक्र को दोहराने के लिए सूचना दी मूल्य है जहां, सीक्यू प्रतिकृति के प्रत्येक सेट के लिए मतलब मूल्य, #Cq कुल सकारात्मक मूल्यों (यानी, अनिर्धारित नहीं) है कि सभी मानक नियंत्रण प्रतिकृति के लिए Cq मूल्यों की संख्या, और # है एसटीडी सकारात्मक मूल्यों है कि मानक नियंत्रण की संख्या है।
      2. मात्रात्मक पीसीआर थर्मल cycler सॉफ्टवेयर प्रत्येक मानक वक्र के लिए ढाल की गणना नहीं होता है, तो 3 समीकरण का उपयोग कर ढलान की गणना60;
        3 समीकरण
        Cq इस्तेमाल किया उच्चतम और निम्नतम dilutions का मतलब मूल्य है और लॉग जहां जीसी टेबल 9 से इस्तेमाल उच्चतम और निम्नतम dilutions के लिए जीनोमिक प्रतिलिपि मूल्य का लॉग है।
      3. 4 समीकरण का उपयोग कर 2 आर मूल्य की गणना।
        4 समीकरण
        Cq सब Cq मूल्यों का मतलब है और प्रवेश जीसी प्रत्येक को दोहराने के लिए मतलब लॉग जीसी मूल्य है जहां।
      4. 5 समीकरण का उपयोग कर% दक्षता की गणना:
        5 समीकरण
    7. टेबल 10 में निर्धारित मानदंडों और प्रत्येक नमूना के लिए मतलब जीसी मूल्यों को पूरा करने वाले मानक घटता के आधार पर सभी नमूने परीक्षण के लिए थर्मल cycler सॉफ्टवेयर द्वारा गणना जीसी मूल्यों रिकॉर्ड। में मानदंडों को पूरा नहीं करते हैं कि मानक घटता के साथ किसी भी नमूने फिर से चलाएँ
    8. समीकरण 6 का उपयोग कर प्रत्येक परीक्षण के नमूने के लिए जीसी प्रति लीटर (जीसी एल) का निर्धारण करते हैं:
      समीकरण 6
      जीसी कदम 5.7 से मतलब जीनोमिक प्रतिलिपि संख्या है, जहां कारक '199' तृतीयक एकाग्रता के दौरान होने वाली मात्रा में कटौती के लिए कुल कमजोर पड़ने कारक है, आरएनए निष्कर्षण और RT-qPCR कदम, डीएफ निषेध के लिए क्षतिपूर्ति कि कमजोर पड़ने कारक है और डी लीटर में assayed मूल पानी नमूने की मात्रा है। जीसी एल की गणना का एक उदाहरण के लिए पूरक सामग्री अनुभाग एस 4 देखें।
    9. 199 से कदम 5.5 से मतलब जीसी मूल्य बढ़ रही है और 0.3 से विभाजित करके कुल LFB की जीसी और LRB नमूनों की गणना करें।

Representative Results

कुल मिलाकर वायरस वसूली बनती क्षेत्र और LFSM भू-जल के नमूने का उपयोग निर्धारित किया गया था। सात नमूना सेट की कुल तीन सार्वजनिक उपचार संयंत्र, और निजी अच्छी तरह से एकत्र एक नमूना सेट से अलग-अलग अवसरों पर एकत्र दो सेट का उपयोग कर विश्लेषण किया गया। LFSM नमूने के लिए बीज का स्तर एक्स 10 6 murine नोरोवायरस के एमपीएन साबिन के पोलियो वायरस सीरोटाइप 3 और 5 एक्स 10 6 PFU 3 थे। Murine नोरोवायरस कारण LFSM नमूने के लिए पर्याप्त एक वायरस एकाग्रता के साथ मानव नोरोवायरस शेयरों की कमी करने के लिए विधि मूल्यांकन में एक किराए के रूप में इस्तेमाल किया गया था। भूजल के नमूनों के लिए क्या मतलब पोलियो वायरस वसूली 2% की एक मानक त्रुटि के साथ 14 जबकि murine नोरोवायरस वसूली 3% (चित्रा 3) का एक मानक त्रुटि के साथ, 30% थी मतलब है, 20% थी। प्रत्येक LFSM के लिए नियमित रूप से क्षेत्र भूजल नमूना नहीं detectable Enterovirus या नोरोवायरस था।

LFB और LRB नमूने वरीयता प्राप्त और गैर वरीय अभिकर्मक ग्रेड वाट का उपयोग कर मापा गयाइंजी। सभी LRB नमूने (नहीं दिखाया डेटा) नकारात्मक रहे थे। Murine नोरोवायरस वसूली 0.5% की एक मानक त्रुटि के साथ 4% औसत है, जबकि पोलियो वायरस वसूली, 1% (चित्रा 3) का एक मानक त्रुटि के साथ 44% औसत।

RT-qPCR 4 चित्रा। पर्याप्त मानक वक्र अभिकर्मकों के उपयोग की आवश्यकता Enterovirus और नोरोवायरस जी आई आई के लिए एक विशिष्ट मानक वक्र से पता चलता है। नोरोवायरस जी आई आई वक्र 0.9987 के एक आर 2 मूल्य, 0.14 की एक समग्र मानक विचलन, और 101% दक्षता के साथ मानक वक्र प्रदर्शन मापदंड (तालिका 10) से मिलता है। नोरोवायरस जिया और GIB घटता () नहीं दिखाया नोरोवायरस जी आई आई की है कि लगभग समान हैं। Enterovirus वक्र 0.9874 के एक आर 2 मूल्य, 0.58 की एक समग्र मानक विचलन, और 103% दक्षता के साथ विधि प्रदर्शन मानदंडों को पूरा करती है, लेकिन गुना कम एक सौ के बारे में संवेदनशीलता और इस तरह नोरोवायरस घटता तुलना में एक उच्च सीमा का पता लगाने की है।


चित्रा आण्विक प्रक्रिया 1. अवलोकन। आणविक प्रक्रिया संक्रामक वायरस, न्यूक्लिक एसिड की निकासी को मापने के लिए किया जाता है कि परे अतिरिक्त नमूना एकाग्रता भी शामिल है, एक दो कदम प्रतिलेखन (आरटी) प्रोटोकॉल, और मात्रात्मक पीसीआर (qPCR) रिवर्स। शुरुआती मात्रा (एस) के मूल पानी के नमूने की एक विधि-निर्धारित अनुपात का प्रतिनिधित्व करता है।

चित्र 2
चित्रा 2. RT-qPCR सिंहावलोकन योजनाबद्ध। प्रत्येक निकाले परीक्षण नमूना शाही सेना रिवर्स तीन प्रतियों assays (RT1, RT2, और RT3) का उपयोग लिखित है। उसके बाद अलग Enterovirus (ईवी पीसीआर) का उपयोग विशिष्ट वायरस के लिए विश्लेषण किया जाता है तीन प्रतियों आरटी assays, नोरोवायरस genogroup मैं (नवंबर जीआईए पीसीआर और नवंबर GIB पीसीआर), नोरोवायरस genogroup द्वितीय में से प्रत्येक से सीडीएनए (एनov जी आई आई पीसीआर), और हेपेटाइटिस जी (HGV पीसीआर) assays।

चित्र तीन
चित्रा 3. मीन पोलियो वायरस और जमीन से Murine Norovirus रिकवरी (%) और अभिकर्मक ग्रेड पानी। मतलब प्रतिशत वसूली जमीन से पोलियो वायरस (के लिए दिखाया गया है चित्रा 3-1 ; एन = 7) और अभिकर्मक ग्रेड से ( चित्रा 3-2 ; एन = 12) पानी और जमीन से murine नोरोवायरस के लिए ( चित्रा 3-3 ; एन = 7) और अभिकर्मक ग्रेड से ( चित्रा 3-4 ; एन = 12) पानी (1), जहां "एन" संसाधित अलग पानी के नमूनों की संख्या है। त्रुटि सलाखों मानक त्रुटि प्रतिनिधित्व करते हैं।

चित्रा 4 चित्रा 4. Enterovirus और Norovirus जी आई आई स्टैंडर्ड वक्र। Enterovirus के लिए विशिष्ट मानक घटता है और नोरोवायरस जी आई आई दिखाए जाते हैं। ढलान और आर प्रत्येक अवस्था के लिए 2 मूल्यों देने के फार्मूले थर्मल cycler द्वारा गणना कर रहे हैं।

पूरक फ़ाइल 1. इस फाइल को डाउनलोड करने के लिए यहां क्लिक करें।

वायरस समूह प्राइमर / जांच नाम (1) अनुक्रम (2) संदर्भ
Enterovirus
EntF (ईवी-एल) 20
Entr (ईवी-आर) ACCGGATGGCCAATCCAA 20
ENTP (ईवी-जांच) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-Tamra 21
नोरोवायरस जीआईए
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-Tamra 22
नोरोवायरस GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-Tamra 23
नोरोवायरस जी आई आई
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-Tamra 25
नोरोवायरस जी.वी.
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 विक-TGGCCAGGGCTTCTGT-MGB 14
हेपेटाइटिस जी
HepF (5'-एनसीआर आगे प्राइमर) CGGCCAAAAGGTGGTGGATG 19
HepR (5'-एनसीआर रिवर्स प्राइमर) CGACGAGCCTGACGTCGGG 19
HEPP (हेपेटाइटिस जी TaqMan जांच 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-Tamra 1

तालिका 1 प्राइमर और RT-qPCR द्वारा वायरस का पता लगाने के लिए TaqMan जांच।
(1) विधि 1615 प्राइमर और जांच के नाम आगे, रिवर्स, और जांच के लिए एफ, आर, या पी को श्रेणीबद्ध वायरस के नाम के पहले तीन पत्र हैं। नोरोवायरस genogroup नाम करने के लिए सैनिक और जी आई आई जोड़कर नामित किया गया है। यह भी प्राथमिक संदर्भों से ए और बी प्राइमर और जांच के नाम का उपयोग प्रतिष्ठित हैं दो नोरोवायरस सैनिक प्राइमर सेट माता-पिता में दिए गए हैंheses।
(2) प्राइमर और जांच के दृश्य के उन्मुखीकरण '3' को 5 है। निम्नलिखित पतित आधार संकेतक इस्तेमाल कर रहे हैं: सभी चार न्यूक्लियोटाइड के एन एक मिश्रण; आर-ए + जी; वाई-टी + सी; डब्ल्यू ए + टी; और मैं-आइनोसीन।

घटक प्रतिक्रिया प्रति मात्रा (μl) (2) अंतिम एकाग्रता मास्टर मिक्स (μl) के अनुसार खंड (3)
आर टी मास्टर मिक्स 1
रैंडम प्राइमर 0.8 10 एनजी / μl (सी। 5.6 माइक्रोन) 84
हेपेटाइटिस जी बख़्तरबंद आरएनए (4) 1 105
पीसीआर ग्रेड पानी 14.7 1543.5
कोताल 16.5 1732.5
आर टी मास्टर मिक्स 2
10x पीसीआर बफर द्वितीय 4 10 मिमी Tris, पीएच 8.3, 50 मिमी KCl 420
25 मिमी 2 MgCl 4.8 3 मिमी 504
10 मिमी dNTPs 3.2 0.8 मिमी 336
100 मिमी डीटीटी 4 10 मिमी 420
RNase अवरोध करनेवाला 0.5 0.5 इकाइयों / μl 52.5
सुपरस्क्रिप्ट द्वितीय आरटी 0.3 1.6 इकाइयों / μl 31.5
कुल 16.8 1764

तालिका 2 आरटी मास्टर मिक्स 1 और 2 (1)।
(1) एक सीएल में आर टी मास्टर घोला जा सकता है तैयारयानी EAN कमरे, आणविक और सूक्ष्मजीवविज्ञानी प्रक्रियाओं का प्रदर्शन नहीं कर रहे हैं, जहां एक कमरे में।
(2) अंतिम आरटी परख मात्रा 40 μl है।
(3) की मात्रा 105 assays के आधार पर कर रहे हैं दिखाने के लिए। अतिरिक्त assays के नुकसान के लिए खाते में जोड़ा साथ यह एक 96 अच्छी तरह से पीसीआर थाली के लिए पर्याप्त है। राशि का विश्लेषण किया जाएगा कि नमूनों और नियंत्रण की संख्या के हिसाब से ऊपर या नीचे बढ़ाया जा सकता है।
(4) पूरक सामग्री चरण एस 4 में वर्णित के रूप में आर टी मास्टर मिक्स 1 में शामिल करने के लिए हेपेटाइटिस जी अभिकर्मक की राशि का निर्धारण।

घटक प्रतिक्रिया प्रति मात्रा (μl) (2) अंतिम एकाग्रता मास्टर मिक्स (μl) के अनुसार खंड (3)
2x LightCycler 480 जांच मास्टर मिक्स 10 मालिकाना 1050
ROX संदर्भडाई (4) 0.4 0.5 मिमी 42
पीसीआर ग्रेड पानी 1 105
10 माइक्रोन EntF 0.6 300 एनएम 63
10 माइक्रोन entr 1.8 900 एनएम 189
10 माइक्रोन ENTP 0.2 100 एनएम 21
कुल 14 1470

तालिका 3. पीसीआर मास्टर मिक्स Enterovirus (ईवी) परख के लिए (1)।
(1) एक साफ कमरे में सभी पीसीआर मास्टर मिक्स तैयार करें।
(2) अंतिम qPCR परख मात्रा 20 μl है।
(3) की मात्रा 105 assays के आधार पर कर रहे हैं दिखाने के लिए। अतिरिक्त assays के नुकसान के लिए खाते में जोड़ा साथ यह एक 96 अच्छी तरह से पीसीआर थाली के लिए पर्याप्त है। राशि के नमूने और उस होगा नियंत्रण की संख्या के हिसाब से ऊपर पहुंचा है या नीचे जा सकता हैविश्लेषण किया जा सकता है।
इस अभिकर्मक (4) स्थानापन्न पीसीआर ग्रेड पानी की आवश्यकता नहीं है कि उपकरणों का उपयोग करते हैं।

घटक प्रतिक्रिया प्रति मात्रा (μl) (2) अंतिम एकाग्रता मास्टर मिक्स (μl) के अनुसार खंड (3)
2x LightCycler 480 जांच मास्टर मिक्स 10 मालिकाना 1050
ROX संदर्भ डाई (4) 0.4 0.5 मिमी 42
पीसीआर ग्रेड पानी 1.4 147
10 माइक्रोन NorGIAF 1 500 एनएम 105
10 माइक्रोन NorGIAR 1 500 एनएम 105
10 माइक्रोन NorGIAP 0.2 100 एनएम 21
कुल 14 1470

तालिका 4. Norovirus जीआईए के लिए पीसीआर मास्टर मिक्स (नवंबर जीआईए) परख (1)।
फ़ुटनोट के लिए 3 टेबल देखें (1) - (4)।

घटक प्रतिक्रिया प्रति मात्रा (μl) (2) अंतिम एकाग्रता मास्टर मिक्स (μl) के अनुसार खंड (3)
2x LightCycler 480 जांच मास्टर मिक्स 10 मालिकाना 1050
ROX संदर्भ डाई (4) 0.4 0.5 मिमी 42
पीसीआर ग्रेड पानी 0.3 31.5
10 माइक्रोन NorGIBF 1 500 एनएम 105
10 माइक्रोन NorGIBR 1.8 900 एनएम 189
10 माइक्रोन NorGIBP 0.5 250 एनएम 52.5
कुल 14 1470

सारणी 5. Norovirus GIB के लिए पीसीआर मास्टर मिक्स (नवंबर GIB) परख (1)।
फ़ुटनोट के लिए 3 टेबल देखें (1) - (4)।

<टीडी> 0.5 मिमी
घटक प्रतिक्रिया प्रति मात्रा (μl) (2) अंतिम एकाग्रता मास्टर मिक्स (μl) के अनुसार खंड (3)
2x LightCycler 480 जांच मास्टर मिक्स 10 मालिकाना 1050
ROX संदर्भ डाई (4) 0.4 42
पीसीआर ग्रेड पानी 0.3 31.5
10 माइक्रोन NorGIIF 1 500 एनएम 105
10 माइक्रोन NorGIIR 1.8 900 एनएम 189
10 माइक्रोन NorGIIP 0.5 250 एनएम 52.5
कुल 14 1470

6 तालिका Norovirus जी आई आई के लिए पीसीआर मास्टर मिक्स (नवंबर जी आई आई) परख (1)।
फ़ुटनोट के लिए 3 टेबल देखें (1) - (4)।

घटक प्रतिक्रिया प्रति मात्रा (μl) (2) अंतिम एकाग्रता मास्टर मिक्स (μl) के अनुसार खंड (3)
2x LightCycler 480 जांच मास्टर मिक्स 10 मालिकाना 1050
ROX संदर्भ डाई (4) 0.4 0.5 मिमी 42
पीसीआर ग्रेड पानी 0.3 31.5
10 माइक्रोन MuNoVF1 1 500 एनएम 105
10 माइक्रोन MuNoVR1 1.8 900 एनएम 189
10 माइक्रोन MuNoVP1 0.5 250 एनएम 52.5
कुल 14 1470

टेबल 7. पीसीआर मास्टर मिक्स Murine Norovirus परख के लिए (1)।
फ़ुटनोट के लिए 3 टेबल देखें (1) - (4)।

घटक आयतनप्रतिक्रिया प्रति (μl) (2) अंतिम एकाग्रता मास्टर मिक्स (μl) के अनुसार खंड (3)
2x LightCycler 480 जांच मास्टर मिक्स 10 मालिकाना 1050
ROX संदर्भ डाई (4) 0.4 0.5 मिमी 42
पीसीआर ग्रेड पानी 1.4 147
10 माइक्रोन HepF 1 500 एनएम 105
10 माइक्रोन HepR 1 500 एनएम 105
10 माइक्रोन HEPP 0.2 100 एनएम 21
कुल 14 1470

8 तालिका हेपेटाइटिस जी के लिए पीसीआर मास्टर मिक्स (HGV) परख (1)।
देखना

मानक वक्र एकाग्रता आर टी-qPCR परख प्रति जीनोमिक प्रतियां (1, 2)
2.5 x 10 8 502,500
2.5 10 x 7 50,250
2.5 x 10 6 5025
2.5 x 10 5 502.5
2.5 x 10 4 50.25
2.5 x 10 3 5.025

टेबल 9. मानक वक्र जीनोमिक प्रतियां।
(1) के मानकों के रूप में मानक वक्र कुओं को पहचानें और thermocycler सॉफ्टवेयर में उचित जगह में आर टी-qPCR परख मूल्यों प्रति जीनोमिक प्रतियां जगह है।
(2) एक स्वीकार्य मानक वक्र 70% -110% की दक्षता होगा, एक आर 2 मूल्य> 0.97, और नोरोवायरस के लिए एक समग्र मानक विचलन <0.5 और Enterovirus के लिए <1.0।

मानदंड स्वीकार्य मूल्य
नोरोवायरस Enterovirus
कुल मिलाकर मानक विचलन <0.5 <1.0
आर 2 > 0.97 > 0.97
क्षमता 115% से 70% 115% से 70%

टेबल 10 मानक वक्र स्वीकृति मानदंड (1)।
(1) 70% -110% की% क्षमता के साथ मानक घटता स्वीकार्य हैं, लेकिन 90% -115% की सीमा में मूल्यों आदर्श होते हैं। कम से कम 90% से अधिक मूल्यों pipetting या कमजोर पड़ने त्रुटियों का संकेत हो सकता।

क्यूए घटक इसका मतलब यह रिकवरी रेंज (%) गुणांक का परिवर्तन (%)
प्रयोगशाला अभिकर्मक रिक्त; नकारात्मक पीटी या पीई नमूने 0 एन / ए (1)
लैब रिक्त दृढ़; लैब दृढ़ नमूना मैट्रिक्स 5-200 एन / ए
सकारात्मक पीटी और पीई के नमूने 15-175 ≤130

टेबल 11. विधि 1615 मापदंड प्रदर्शन।
(1) लागू नहीं।

मीडिया रचना
0.15 मीटर सोडियम फास्फेट, पीएच 7.0-7.5 1 एल DH का अंतिम मात्रा में सोडियम फास्फेट, द्विक्षारकीय (ना 2 4 HPO · 7H 2 ओ) की 40.2 ग्राम भंग करके 0.15 मीटर सोडियम फास्फेट तैयार
5% बीएसए DH 2 ओ की 100 मिलीलीटर में बीएसए के 5 ग्राम भंग द्वारा तैयार करें एक 0.2 माइक्रोन स्टरलाइज़ फिल्टर के माध्यम से समाधान गुजर द्वारा जीवाणुरहित।
पीबीएस, 0.2% बीएसए पीबीएस के 96 मिलीलीटर 5% BSA के 4 मिलीलीटर जोड़कर तैयार करें। एक 0.2 माइक्रोन स्टरलाइज़ फिल्टर के माध्यम से समाधान गुजर द्वारा जीवाणुरहित।
टी एस एम तृतीय बफर 1.21 छ Trisma आधार, 5.84 ग्राम सोडियम क्लोराइड, 0.203 ग्राम MgCl 2, 1 मिलीलीटर Prionex जिलेटिन, और 950 मिलीलीटर अभिकर्मक ग्रेड पानी में 3 मिलीग्राम Microcide तृतीय भंग। 7.0 पीएच को समायोजित करें और उसके बाद एक 0.2 माइक्रोन स्टरलाइज़ फिल्टर के माध्यम से समाधान से गुजर रहा एक एल बाँझ अंतिम मात्रा लाने के लिए।
0.525% सोडियम हाइपोक्लोराइट (NaClO) घ में घरेलू ब्लीच 01:10 गिराए द्वारा एक 0.525% NaClO समाधान तैयारएच 2 ओ आरटी पर अप करने के लिए एक सप्ताह के लिए 0.525% NaClO समाधान की दुकान।
1-एम सोडियम thiosulfate (ना 2 एस 23) pentahydrate DH 2 ओ के 1 एल एस ओ 2 3 ना 2 का 248.2 ग्राम भंग करके एक 1 एम समाधान तैयार आरटी पर अप करने के लिए 6 महीने के लिए स्टोर सोडियम thiosulfate।

मीडिया के पटल 12. टेबल।

Discussion

स्रोत और पीने के पानी के वायरल संदूषण का बड़े पैमाने पर राष्ट्रीय पढ़ाई के कई विश्लेषणात्मक प्रयोगशालाओं के उपयोग की आवश्यकता है। इन शर्तों के तहत एक मानक पद्धति कई प्रयोगशालाओं द्वारा उत्पन्न डेटा तुलनीय है कि यह सुनिश्चित करने की जरूरत है। वायरस का पता लगाने के लिए कई प्रकाशित आणविक विधियों, लेकिन बहुत कुछ मानकीकृत आणविक तरीके हैं। ईपीए विधि 1615 विशेष रूप से आर टी-qPCR द्वारा पानी matrices में Enterovirus और नोरोवायरस का पता लगाने के लिए बनाया गया एक मानकीकृत विधि है। मानकीकृत आणविक विधियों खाद्य पदार्थों में वायरस का पता लगाने के लिए उपलब्ध हैं, 16,17 (15216-2 केंद्र / आईएसओ टीएस 15,216-1 और केंद्र / आईएसओ टीएस 7 अप्रैल 2013) और हेपेटाइटिस का पता लगाने के एक वायरस और नोरोवायरस वसंत में करने के लिए लागू किया गया है पानी 16। सभी मानक तरीकों गुणवत्ता के प्रदर्शन के नियंत्रण और मापदंड के अंतर को कम करने के लिए और इंट्रा-प्रयोगशाला भिन्नता और कारण प्रयोगशाला संदूषण के लिए झूठी सकारात्मक डेटा को शामिल करना चाहिए। इसके अलावा, ई झूठी डेटा को कम करने के लिएपीए विधि 1615 प्रसंस्करण और एक तरह से काम के प्रवाह के दौरान काम की जुदाई के अनुबंध जो आणविक विधियों पर ईपीए के मार्गदर्शन, 18 इस प्रकार है। यह एक हेपेटाइटिस जी 1,19 आंतरिक नियंत्रण और कारण RT-qPCR 15 के अवरोधकों को झूठी नकारात्मक परिणामों को कम से कम करने के लिए प्रक्रियाओं में शामिल हैं। यह सभी क्षेत्र डेटा क्षेत्र की लीटर या पानी के सैंपल लिए पीने के प्रति जीनोमिक प्रतियों में व्यक्त किया जाता है तो यह है कि विश्लेषण किया दोनों जांचा पानी और पानी के मानकीकृत संस्करणों के साथ-साथ मात्रात्मक assays के उपयोग करता है। कुशल एकल ट्यूब (एक कदम) आरटी पीसीआर assays के व्यावसायिक रूप से उपलब्ध हैं, यद्यपि विधि जानबूझकर अलग assays के उपयोग करता है। यह प्रत्येक प्रतिक्रिया में यत्न किया जा सकता है कि नमूना की राशि को कम करने का नुकसान है, लेकिन कई प्राइमर सेट के उपयोग में अधिक से अधिक लचीलापन देता है। प्राइमरों और जांच के लिए इस्तेमाल किया है और संभावना है कोई प्राइमर सेट एक समूह के भीतर सभी वायरस वेरिएंट की पहचान करेगा के रूप में आर टी-qPCR assays के द्वारा और केवल के रूप में अच्छा सीमित हैं। Enterovirus प्राइमर सेट क्योंकि चुना गया थायह 20,21 Enterovirus सीरमप्रकारों की एक विस्तृत विविधता का पता लगाता है, संरक्षित 5'-गैर कोडिंग क्षेत्र को लक्षित करता है, और यह द्वारा पता लगाया वायरस अनुपचारित groundwaters 1 की खपत से स्वास्थ्य प्रभावों के साथ जुड़े रहे हैं। दो प्राइमर सेट मैं 22,23 noroviruses genogroup का पता लगाने के लिए किया जाता है। पहले छोटे बच्चों में स्वास्थ्य प्रभावों के बीच मजबूत संबंध के कारण चुना गया है और वायरस 1 का पता चला था। वे उपभेदों 24,25 की व्यापक विविधता का पता लगाने, क्योंकि मैं सेट प्राइमर दूसरी genogroup और genogroup द्वितीय noroviruses के लिए इस्तेमाल किया प्राइमर सेट चुने गए हैं।

पानी में वायरल आरएनए का पता लगाने के लिए qPCR और RT-qPCR प्रक्रियाओं का प्रमुख लाभ के बावजूद, कई सीमाएं हैं। सबसे पहले, कीटाणुनाशक द्वारा निष्क्रिय सहित उन दोनों संक्रामक और noninfectious वायरस कण, इन प्रक्रियाओं से परिलक्षित किया जा सकता। Borchardt के परिणाम इस अनुपचारित groundwaters च के लिए एक समस्या के कम सुझाव है किसमुदायों में उन लोगों के लिए समान ROM जलवाही स्तर कीटाणुरहित सतह के पानी के लिए 1 से अध्ययन किया। कृषि वायरस के लिए इस समस्या संस्कृति 26,27 के साथ संयोजन में पीसीआर का उपयोग कर दूर किया जा सकता है। समस्या यह भी न्यूक्लिक एसिड पार से जोड़ने एजेंट 28-30 के उपयोग के माध्यम से कुछ वायरस के लिए संबोधित किया गया है। यह बाद दृष्टिकोण वायरस हाइपोक्लोराइट द्वारा निष्क्रिय और यूवी द्वारा निष्क्रिय लोगों के लिए प्रभावी नहीं करने के लिए अधिक प्रभावी है।

इन आणविक प्रक्रियाओं का एक दूसरा सीमा आम तौर पर यत्न किया जा सकता है कि ध्यान केंद्रित नमूने की मात्रा संस्कृति प्रक्रियाओं 6,31 के लिए इस्तेमाल किया है कि तुलना में काफी छोटा है। यह समस्या अक्सर या तो नमूना एक छोटी मात्रा में resuspended, या एक तृतीयक नमूना एकाग्रता कदम 6,32,33 के अलावा द्वारा किया जा करने के लिए अनुमति देता है जो जैविक flocculation द्वारा मानक माध्यमिक एकाग्रता, के लिए एक पॉलीथीन ग्लाइकोल आधारित प्रक्रिया प्रतिस्थापन द्वारा नियंत्रित किया जाता है । विधि 1615 centrif का उपयोग करता हैugal ultrafiltration तृतीयक एकाग्रता प्रदान करते हैं। केन्द्रापसारक ultrafiltration पानी और परीक्षण के नमूने में किसी भी वायरस के दोनों एकाग्रता और आणविक assays के छोटे आणविक वजन अवरोधकों में कमी में जिसके परिणामस्वरूप घटकों कम से कम 30,000 Daltons हटा। पानी में मौजूद था कि किसी भी वायरस के लिए> 10 5 के एक समग्र एकाग्रता कारक के रूप में यह तृतीयक एकाग्रता कदम परिणामों का परीक्षण किया जा रहा है।

एक तीसरा सीमा पर्यावरण के नमूनों में आणविक प्रक्रियाओं के अवरोधकों की उपस्थिति है। अवरोधकों को दूर करने के लिए कई दृष्टिकोण विकसित किया गया है, कोई दृष्टिकोण आवश्यक निषेध के स्तर का अनुमान करने के लिए डिज़ाइन आंतरिक नियंत्रण का इस्तेमाल कर रही है, सभी पानी matrices और वायरस प्रकार 6,34,35 के लिए प्रभावी है। इस विधि में इस्तेमाल हेपेटाइटिस जी अभिकर्मक सभी प्रतिक्रियाओं और निषेध के आकलन के लिए एक आर टी-qPCR परख में वायरल शाही सेना के एक निरंतर स्तर प्रदान करके इस आवश्यकता को संतुष्ट करता है। जब टी का सबसे अच्छावह नमूना केंद्रित के रूप में लंबे समय तक वायरस सांद्रता सांद्रता 14,15 अवरोध करनेवाला तुलना में अधिक हैं के रूप में पतला किया जा सकता, हटाने दृष्टिकोण निषेध हटाने में विफल अवरोध करनेवाला।

यहाँ बताया मानक वक्र प्रक्रिया फायदे और एक प्रमुख सीमा दोनों है। एक लाभ यह अभिकर्मक एक ही नियंत्रण की सभी assays के लिए इस्तेमाल किया जा करने के लिए अनुमति देता है, एक भी अभिकर्मक में आपूर्ति सभी आवश्यक घटक है कि प्रयोग किया है। यह अभिकर्मक विशेष रूप से नोरोवायरस assays के लिए एक फायदा है। नोरोवायरस कणों केवल यह बहुत मुश्किल मानकों के रूप में उपयोग के लिए वायरल कणों को प्राप्त करने के लिए बना संक्रमित व्यक्तियों से प्राप्त किया जा सकता है। एक और अधिक महत्वपूर्ण लाभ यह एक शाही सेना मानक आरएनए 36 की सही मात्रा का ठहराव के लिए आवश्यक है होने के रूप में यह एक अभिकर्मक में सभी लक्षित आरएनए वायरस के लिए एक शाही सेना मानक प्रदान करता है। हालांकि, सही वायरस यों के लिए अपनी क्षमता मैट्रिक्स प्रभाव को ध्यान में रखा नहीं कर रहे हैं कि इस तथ्य से सीमित है। मतलब यह है कि जीनोमिक प्रतिलिपि इसका मतलबनंबर मूल्यों पूर्ण नहीं माना जा सकता और केवल सापेक्ष दृष्टि से विचार किया जाना चाहिए। यह मानक वक्र काम कर शेयर aliquots के लिए पर्याप्त संख्या (1.2 कदम) पूरा अध्ययनों से कवर करने के लिए तैयार किया जा सिफारिश की है। उदाहरण के लिए, प्रत्येक 250 μl विभाज्य 6 आर टी प्लेटों के लिए पर्याप्त अभिकर्मक प्रदान करता है। यह एक अध्ययन में 500 नमूनों के विश्लेषण की आवश्यकता होगी कि जाना जाता है, तो 12 aliquots की एक न्यूनतम (500 नमूने आरटी प्रति प्लेट / 7 नमूने / विभाज्य प्रति 6 आर टी प्लेट) की जरूरत होगी।

ईपीए विधि 1615 में एक प्रदर्शन के आधार पर विधि है। कई निर्माताओं यहाँ निर्दिष्ट उन के बराबर अभिकर्मकों बनाने के लिए और इन अभिकर्मकों के रूप में लंबे समय प्रदर्शन मानदंड से मुलाकात कर रहे हैं के रूप में प्रतिस्थापित किया जा सकता है। यह भी एक सकारात्मक RT-qPCR नियंत्रण के रूप में कार्य करता है जो मानक वक्र, समस्या निवारण प्रदर्शन के मुद्दों में मूल्य का है। प्रदर्शन की वजह से शाही सेना की गिरावट, अभिकर्मक शेल्फ जीवन, फ्रीजर की विफलता, साधन अंशांकन, और तकनीकी त्रुटि करने से मना कर सकते हैं। प्रदर्शन के मुद्दों शक किया जाना चाहिएवे मानक घटता के लिए प्रदर्शन विनिर्देश को पूरा नहीं करते हैं तो एड मानक घटता 4 चित्र में दिखाया गया है कि से अलग या यदि। आर टी-qPCR परख काफी मजबूत है; पूर्ण विफलता की वजह से शाही सेना या तकनीकी त्रुटि (जैसे, एक लापता अभिकर्मक) के अनुचित हैंडलिंग की संभावना है। महान देखभाल निकासी और ribonucleases से आरएनए गिरावट को कम करने के लिए आर टी कदम के बीच शाही सेना के नमूने से निपटने में लिया जाना चाहिए।

जमीन और अभिकर्मक ग्रेड जल और भूजल से murine नोरोवायरस वसूलियां से पोलियो वायरस वसूलियां ईपीए विधि 1615 प्रदर्शन स्वीकृति मानदंडों (तालिका 11) से मुलाकात की और दूसरों 33,37,38 द्वारा रिपोर्ट उन लोगों के लिए समान हैं। LFB नमूनों से murine नोरोवायरस वसूलियां पोलियो वायरस के उन लोगों की तुलना में काफी कम थे और पोलियो वायरस विशेष स्वीकृति मानदंडों को पूरा नहीं होगा। अभिकर्मक ग्रेड पानी से कम murine नोरोवायरस वसूली के लिए कारणों से अनजान हैं। इस के साथ साथ परिणामों के लिए इसी प्रकार, करीम और colleaGues नल का पानी 39 से 4% की नोरोवायरस GI.1 के लिए एक वसूली की सूचना दी। ली एट अल। 37 murine नोरोवायरस और 18% की मानव नोरोवायरस GII.4 और क्रमशः, डिस्क फिल्टर का उपयोग आसुत जल से 26% के लिए मतलब वसूलियां की सूचना दी। ली और उनके सहयोगियों के लिए इसी तरह की स्थिति का उपयोग करना, किम और को क्रमश: 38, इन वायरस के लिए 46% और 43% की वसूली मनाया। गिबन्स एट अल। 40 समुद्र के पानी से मानव नोरोवायरस GII.4 की 100% वसूली के आसपास प्राप्त है, लेकिन किम और को 38 सांद्रता समान या murine वायरस की काफी कम वसूलियां समुद्री जल की तुलना में अधिक है और कम से आसुत जल के लिए नमक के अलावा परिणामस्वरूप GII.4 वसूली में के बारे में एक दो गुना कमी में।

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics