EPA Method 1615. Meting van Enterovirus en Norovirus Voorkomen in water per cultuur en RT-qPCR. Deel III. Virus Detectie door RT-qPCR

1National Exposure Research Laboratory, U.S. Environmental Protection Agency, 2Technical Services Center, Office of Ground Water and Drinking Water, U.S. Environmental Protection Agency
Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Kwantitatieve PCR (qPCR; zie aanvullende materialen voor de definities van de termen die in dit handschrift) en reverse transcriptie-qPCR (RT-qPCR) zijn waardevolle instrumenten voor het opsporen en kwantificeren van de menselijke enterische virussen in het milieu en het drinken van water, en vooral voor veel virussen doen niet repliceren of repliceren slecht in celkweek systemen. Beide instrumenten hebben aangetoond dat veel virustypes die aanwezig zijn in het milieu en het drinken van water in de hele wereld 1-6 zijn. Hun gebruik in combinatie met de sequentie van geamplificeerde genomische fragmenten in ziekteuitbarsting onderzoek heeft aangetoond voor watergedragen virusoverdracht voorzien, zoals zij hebben aangetoond dat het virus in het drinkwater identiek aan die loods uitbraak van patiënten 7-10.

Zowel qPCR en RT-qPCR zijn nuttige hulpmiddelen voor de volksgezondheid. Bijvoorbeeld gegevens uit studies uitgevoerd door het Amerikaanse Environmental Protection Agency (EPA) liet een sterke relatietween indicator metingen door qPCR en gezondheidseffecten in recreatieve wateren. Als gevolg hiervan, EPA's laatste 2012 Recreational Water Quality Criteria bevat een qPCR methode voor het bewaken van recreatieve stranden 11,12. Borchardt en collega's vonden ook een sterke relatie tussen acute gastro-enteritis bij gemeenschappen door onbehandeld grondwater en virus in grondwater zoals gemeten met RT-qPCR 1.

Het doel van dit document is de moleculaire testcomponent EPA Method 1615 13,14 beschrijven. Deze test maakt gebruik van RT-qPCR om een ​​kwantitatieve schatting van enterovirus en norovirus genoom kopieën (GC) per liter gebaseerd op het oorspronkelijke volume van het milieu of het drinken van water gepasseerd te bieden via een elektropositieve filter. Een overzicht van de moleculaire procedure is weergegeven in figuur 1 punt. Protocol 1 geeft de procedures voor het bereiden van de standaardcurve. Deze standaarden worden bereid uit een reagens dat een RN bevatEen kopie van de doelsequentie van de primer / probe sets. Hoofdstuk 2 beschrijft de tertiaire concentratie procedure. Sectie 3 geeft de procedure voor het extraheren van RNA van de geconcentreerde water- en controlemonsters. Het RNA uit elk monster wordt reverse getranscribeerd met behulp drievoud assays en willekeurige primers om prime de transcriptie (hoofdstuk 4). Het cDNA uit elke reverse transcriptie reactie in vijf afzonderlijke virus-specifieke testen die in drievoud geanalyseerd door qPCR (afdeling 5 Figuur 2). De assay maakt gebruik van primers en probes uit de wetenschappelijke literatuur (tabel 1) die zijn ontworpen om vele enterovirussen en noroviruses en een reagens dat hepatitis G RNA monsters die remmend RT-qPCR 15 identificeren detecteren.

Protocol

Opmerking: Gebruik datasheets om alle stappen van het protocol te volgen; bijvoorbeeld informatiebladen worden gegeven in de aanvullende materialen Tables S2-S4.

1. Standard Curve Voorbereiding

  1. Bereid een werkvoorraad van de standaardcurve reagens (bijv gepantserde RNA EPA-1615) door verdunnen van de door de fabrikant aan een concentratie van 2,5 x 10 8 deeltjes / ml (2,5 x 10 8 GC / ml) met behulp TSM concentratie III buffer. Verdeel de werkvoorraad in 250 ul fracties met 1,5 ml microcentrifugebuizen en bewaar bij -20 ° C.
    OPMERKING: Zie aanvullende materialen protocol Stap S1 voor instructies over het voorbereiden van werkvoorraden van virus en plasmiden voor het gebruik als alternatieve standaard curve reagentia.
  2. Ontdooien van één of meer van de werkvoorraad porties. Bereid vijf 10-voudige seriële verdunningen gebruikt 1,5 ml microcentrifuge buizen, waardoor concentraties van 2,5 x 10 7, 2,5 x 10 6, 2,5 x10 5, 2,5 x 10 4 en 2,5 x 10 3 GC / ml.
    1. Maak de eerste verdunning door toevoeging van 25 ul van de 2,5 x 10 8 GC / ml werkvoorraad tot 225 ul van TSM III buffer. Mix voor 5-15 sec met behulp van een vortex mixer.
    2. Bereid de volgende verdunning door toevoeging van 25 ul van de bereide in stap 1.2.1 tot 225 gl TSM III buffer verdunnen. Meng opnieuw en verder een soortgelijk proces om de volgende drie 10-voudige verdunningen te bereiden.
  3. Pak het RNA uit de standaard curve werkvoorraad en de vijf verdunningen onmiddellijk volgens de procedure in paragraaf 3.

2. Tertiaire Concentratie

  1. Bereid een centrifugale concentrator (30.000 moleculair gewicht cut-off) voor elk door toevoegen van ten minste 10 ml 1 x PBS, 0,2% runderserumalbumine (BSA) aan de bovenste monsterkamer verzamelde monster. Zorg ervoor dat oplossing heeft de dunne kanaal concentratie kamer gevuld, en houd dan O / N bij 4 ° C.
  2. Voeg een hoeveelheid secundaire water concentraat uit elk monster gelijk is aan S, de Assay Sample Volume in afzonderlijke centrifugale concentrators.
    1. Bereken S met behulp van Vergelijking 1,
      Vergelijking 1
      Waarbij D de jaargang van Original Water monster geanalyseerd, TSV is de totale steekproef Volume en FCSV is de Final Geconcentreerde Sample Volume. Zie aanvullend materiaal S2 voor een voorbeeld van de berekening van S.
  3. Centrifuge Elk monster bij 3.000-6.000 xg bij 4 ° C in een swinging bucket rotor gedurende 20 - 30 min. Controleer het volume in de dunne kanaal concentratie kamer.
    1. Indien het volume groter is dan 400 pl, opnieuw centrifugeer gedurende 20 minuten of langer. Doorgaan centrifugeren totdat het monster in the dunne kanaal concentratiekamer is teruggebracht tot minder dan 400 pl. Gebruik de bovenstaande niet verwijderen.
  4. Was de zijkanten van de centrifugale concentrator met 1 ml steriele 0,15 M natriumfosfaat, pH 7-7,5 virus, te verhogen. Centrifugeer opnieuw bij 3.000-6.000 xg en 4 ° C totdat het monster is teruggebracht tot minder dan 400 pl. Herhaal deze wasstap een extra tijd.
  5. Met een 100-200 pi micropipet nauwkeurig meten en breng elke geconcentreerd monster op een 1,5 ml microcentrifugebuis (dwz overdracht 200 ul aan de microcentrifugebuis en meet de resterende concentraat door aanpassing van de micropipet totdat de resterende vloeistof volledig kan worden opgemaakt in de pipet tip). Voeg 0,15 M natriumfosfaat, pH 7-7,5, om het uiteindelijke volume op 400 ± 2 ul passen.
  6. Extract nucleïnezuur direct door te gaan naar stap 3. Houd elke geconcentreerde monsters die niet kunnen worden processed onmiddellijk bij 4 ° C voor niet meer dan 24 uur.

3. Nucleïnezuurisolatie

  1. Voeg 200 gl extractiebuffer bereid zoals beschreven in stap 3,3 en 200 ul van de tertiaire concentraat uit elk monster van stap 2,5 of standaardcurve verdunning van Stap 1,3 tot scheiden gelabelde 1,5 ml microcentrifuge buisjes. Freeze overgebleven tertiaire concentraten bij of beneden -70 ° C. Extraheer de nucleïnezuren uit elk monster zoals door de nucleïnezuurextractie fabrikant kit voor de rotatie protocol voor bloedmonsters met de volgende uitzonderingen.
  2. Heeft protease niet toe te voegen aan de watermonsters of gebruik het met het nucleïnezuur extractie kit geleverd extractiebuffer.
  3. Bereid extractiebuffer met carrier RNA
    1. Voeg 310 ul van carrier RNA verdunningsbuffer een flesje dat 310 ug carrier RNA. Mengen op te lossen en vervolgens verdelen in 6 porties met ongeveer 50 pl. Bewaren bij -20° C.
    2. Voeg 28 ul van ontdooide carrier RNA per ml van de extractiebuffer een carrier RNA-concentratie van 0,027 pg / pl te verkrijgen. Gebruik de drager-RNA gewijzigd extractiebuffer in de plaats van die met de winning kit geleverd.
  4. Bereid een stamoplossing elutiebuffer door het toevoegen ribonuclease (RNase) Inhibitor tot een uiteindelijke concentratie van 400 eenheden / ml aan de met de extractie kit elutiebuffer.
    1. Elueer RNA van het nucleïnezuur bindende spinkolom door het plaatsen van 50 ui elutiebuffer met RNase inhibitor in de kolom. Wacht 1 minuut en centrifugeer bij 6000 xg gedurende 1 min bij kamertemperatuur.
    2. Herhaal stap 3.4.1 en vervolgens te verwijderen en gooi de kolom.
  5. Bereid hoeveelheden van de RNA-extracten uit stap 3.4.2. Bereid 6 monsters van de standaard curve werkvoorraad en elke standaard curve verdunning die ten minste 15 ul elk. Bereid 4 aliquots van alle RNA-monsters met ten minste22 pl elk. Sla een aliquot van elk monster en de standaard curve controles bij 4 ° C of ze kunnen worden verwerkt door reverse transcriptie binnen 4 uur; Anders manier alle monsters bij of beneden -70 ° C.

4. Reverse transcriptie (RT)

  1. Bereid 100 uM voorraadoplossing van elke oligonucleotide primer en probe in tabel 1 opgesomd door toevoeging van een volume van PCR-grade water aan elk flesje via een hoeveelheid (in microliter) gelijk aan tien keer het aantal nanomolen (nmol) van het oligonucleotide in de flesje (zoals aangegeven op de flacon etiket of in de productbeschrijving van de fabrikant (bv, resuspendeer een primer met 36,3 nmol in 363 pi). Meng op te lossen.
    1. Verdun de 100 uM oplossingen 1:10 met PCR-kwaliteit water tot 10 uM werkende oplossingen voor te bereiden.
  2. Bereid RT Master Mix 1 en 2 in een schone kamer met behulp van de gids in tabel 2. Pipetteer 16,5 ul van RT Master Mix 1 voor elke PCR-plaat en met behulp van een multichannel pipet.
  3. Dooi, als bevroren, de nucleïnezuur fragmenten van elk veld monster en Lab Versterkte Sample Matrix (LFSM, dat wil zeggen, gezaaid water matrix monster).
    1. Verdun elk veld en LFSM sample 1: 5 en 1:25 in elutiebuffer die 400 eenheden / ml RNase inhibitor.
    2. Dooi, als bevroren, maar niet verdunnen Lab Versterkte Blank (LFB, dat wil zeggen, een positieve kwaliteitscontrole met zaadjes reagenskwaliteit water), Lab blanco (LRB, dwz een negatieve kwaliteitscontrole met behulp van reagenskwaliteit water), Performance Evaluation (PE , dat wil zeggen, gezaaid reagenskwaliteit watermonsters gebruikt om laboratorium prestaties voorafgaand aan de start van een studie), de Test van prestaties (PT evalueren; dat wil zeggen, gezaaid reagenskwaliteit watermonsters met titers onbekende een analist die worden gebruikt om de laboratoria te evalueren tijdens een studie ), NA Batch negatieve extractie controle, of gewonnen RNA uit de standaard curve set.
    3. Plaats 6,7 ul van het RNA uit elk monster, controle en standaard curve in afzonderlijke PCR putjes, met drievoudige putjes voor monsters en controles en dubbele putten voor standaard curves (zie figuur S1 voor een RT plaat voorbeeld).
      1. Plaats 6,7 ul van elutiebuffer in afzonderlijke PCR putjes voor geen template controle (NTC). Omvatten 2-8 NTC per RT plaat, met behulp van twee voor het eerste monster en vervolgens twee meer voor elke vierde extra monster.
      2. Verdeel de negatieve extractie en NTC controles in de hele plaat.
    4. Verzegeling van de PCR-plaat met een hittebestendige plaat sealer. Meng de monsters voor 5-10 seconden en centrifugeer bij ≥ 500 xg kort.
    5. Incubeer de plaat gedurende 4 min bij 99 ° C en koel daarna snel tot 4 ° C in een thermische cycler. Weer centrifuge bij ≥ 500 xg kort.
    6. Verwijder voorzichtig de plaat afdichting en voeg dan 16,8 ul van RT Master Mix 2 aan elk putje. Seal de plaat opnieuw met een hittebestendige plaat sealer, gevolgd door mengen en kort centrifugeren bij ≥ 500 x g.
    7. Plaats de plaat in een thermocycler en looptijd van 15 minuten bij 25 ° C, gevolgd door 60 min bij 42 ° C, 5 min bij 99 ° C, en vervolgens door een 4 ° C hold cyclus.
    8. Werkwijze onmiddellijk of binnen 8 uur door qPCR (stap 5) en bewaar monsters bij of beneden -70 ° C totdat ze kunnen worden verwerkt. WINKEL monsters die kunnen worden verwerkt binnen 8 uur bij 4 ° C.

    5. real-time kwantitatieve PCR (qPCR)

    1. Bepaal de gemiddelde hepatitis G Cq waarde voor elke partij van hepatitis G reagens voorafgaand aan het uitvoeren van elke proefmonsters.
      1. Uitvoeren van een RT-bepaling via 10 duplo bereid zoals beschreven voor NTC controles (stap 4.1.1). Voer het hepatitis G qPCR assay zoals hieronder beschreven (Stappen 5.2 tot 5.5.3). Bereken de gemiddelde waarde van de Cq 10 duplo's.
      2. Pas het hepatitis G reagens hoeveelheid RT Master Mix 1 (tabel 2), Indien nodig, tot een gemiddelde Cq waarde tussen 25 en 32 eenheden ontvangen. Compenseren verhoogd of verlaagd door het volume van het water veranderen hoeveelheid toegevoegd aan de RT Master Mix 1 uiteindelijke volume op 16,5 ul per test te houden.
      3. Bevestig eventuele aanpassingen door te herhalen stappen 5.1.1 tot 5.1.2 en verandering tabel 2 van de aangepaste hoeveelheden weerspiegelen.
    2. Voorbereiden qPCR mastermengsels in een schone kamer met behulp van de geleiders in Tabel 3 voor enterovirus, Tabel 4 en Tabel 5 voor norovirus genogroup I, tabel 6 voor norovirus genogroup II, tabel 7 voor muizen norovirus (norovirus genogroup V), en Tabel 8 voor hepatitis G. Mix elke master mix en centrifugeer bij ≥ 500 xg kort.
    3. Voeg de PCR mastermengsels aan de juiste putjes van een label optische reactie plaat, met behulp van 14 pi per putje en afzonderlijke platen voor elke qPCR assay (zie Figuur S2 figuur S1).
    4. Ontdooi de RT plaat van stap 4.8 bij RT, als bevroren. Meng met behulp van een plaat mixer en centrifugeer bij ≥ 500 xg kort.
    5. Verdeel 6 pl van de geschikte cDNA aan de juiste putjes van de optische reactieplaat. Meng de monsters in de optische reactie plaat en centrifugeer bij ≥ 500 xg kort.
      1. Voer het hepatitis G qPCR test op het onverdunde en verdunde veld en LFSM monsters voordat u alle andere qPCR assays. Gebruik de laagste verdunning van het veld of LFSM steekproef die is <1 Cq waarde groter dan de gemiddelde hepatitis G Cq waarde voor het enterovirus en norovirus qPCR assays.
      2. Stel de kwantitatieve PCR thermocycler software volgens de instructies van de fabrikant. Identificeren van de standaard curve monsters als normen en voor elk standaard curve verdunning, voert de genomische kopie waarden aangegeven in tabel 9.
    6. Bepalen of elke standaard curve aan de acceptabele waarden in tabel 10. Zie aanvullende materialen sectie S3 voor voorbeelden.
      1. Bereken de totale standaarddeviatie (StdDev) voor de standaard curve met behulp van Vergelijking 2,
        Vergelijking 2
        waarbij Cq is de waarde gerapporteerd voor elke standaardcurve repliceren, Cq is de gemiddelde waarde voor elke set van herhalingen, #Cq is het totale aantal Cq waarden voor alle standaard controle herhalingen die positieve waarden (dat wil zeggen, niet onbepaald) hebben, en # Stds is het aantal standaard controles die positieve waarden hebben.
      2. Als de kwantitatieve PCR thermische cycler software niet berekenen de helling voor elke standaard curve, het berekenen van de helling met behulp van Vergelijking 3,60;
        Vergelijking 3
        waarbij Cq is het gemiddelde van de hoogste en laagste gebruikte verdunningen en log GC is de log van de genomische kopie waarde van de hoogste en laagste verdunningen gebruikt in tabel 9.
      3. Bereken de R2 waarde met Vergelijking 4.
        Vergelijking 4
        waarbij Cq is het gemiddelde van alle waarden en Cq Log GC de gemiddelde Log GC voor elke herhaling.
      4. Bereken het% Efficiency met Vergelijking 5:
        Vergelijking 5
    7. Noteer de GC-waarden berekend door de thermische cycler software voor alle monsters op basis van standaard curven die aan de in tabel 10 criteria en de gemiddelde GC waarden voor elk monster. Herhaald elke monsters met standaard bochten die niet voldoen aan de criteria van
    8. Bepaal de GC per liter (GC L) voor elk monster met behulp van Vergelijking 6:
      Vergelijking 6
      waarbij GC is het gemiddelde genomische kopij van stap 5,7, de factor "199" is de totale verdunningsfactor voor volumereducties die tijdens de tertiaire concentratie RNA-extractie en RT-qPCR stappen DF = verdunningsfactor die compenseert voor remming en D is het volume van Original Water Sample getest in liters. Zie supplementaire materialen sectie S4 voor een voorbeeld van de berekening van GC L.
    9. Bereken de totale GC van LFB en LRB monsters door GC gemiddelde waarde uit stap 5.5 vermenigvuldigen met 199 en te delen door 0,3.

Representative Results

Totale virus herstel werd bepaald met behulp van gepaarde veld en LFSM grondwater monsters. Een totaal van zeven sample sets werden geanalyseerd met behulp van twee sets verzameld bij verschillende gelegenheden van drie openbare zuiveringsinstallaties, en een sample set verzameld uit de eigen bron. Zaad niveaus voor de LFSM monsters waren 3 x 10 6 MPN van Sabin poliovirus serotype 3 en 5 x 10 6 PFU van muizen norovirus. Murine norovirus werd gebruikt als een surrogaat in de evaluatiemethode vanwege een gebrek aan menselijke norovirus aandelen met een virusconcentratie voldoende LFSM monsters. Grondwater monsters bedroeg het gemiddelde poliovirus herstel 20%, met een standaard afwijking van 2%, 14 terwijl de gemiddelde murine norovirus herstel was 30%, met een standaard afwijking van 3% (figuur 3). De reguliere veld grondwater monster per LFSM had geen detecteerbaar enterovirus of norovirus.

LFB en LRB monsters werden gemeten met behulp van zaadjes en unseeded reagentia pa watER. LRB Alle monsters waren negatief (gegevens niet getoond). Poliovirus recovery gemiddeld 44% met een standaardafwijking van 1% (Figuur 3), terwijl muizen recovery norovirus gemiddeld 4% met een standaardafwijking van 0,5%.

RT-qPCR vereist het gebruik van geschikte standaardcurve reagentia. Figuur 4 toont een typische standaardcurve voor enterovirus en norovirus GII. Het norovirus GII curve voldoet aan de standaard curve prestatiecriteria (tabel 10) met een R2 waarde van 0,9987, een totale standaarddeviatie van 0,14 en 101% rendement. Norovirus GIA en GIB bochten (niet getoond) zijn bijna identiek aan die van norovirus GII. Het enterovirus curve voldoet aan de methode prestatiecriteria met een R2 waarde van 0,9874, een totale standaarddeviatie van 0,58 en 103% rendement, maar heeft ongeveer honderd maal minder gevoeligheid en dus een hogere detectiegrens dan het norovirus bochten.


Figuur 1. Overzicht van de Molecular procedure. De moleculaire procedure bevat extra monsterconcentratie dan die uitgevoerd voor het meten van infectieus virus, extractie van nucleïnezuren, een tweestaps reverse transcriptie (RT) protocol, en kwantitatieve PCR (qPCR). Het beginvolume (S) een methode bepaald gedeelte van de oorspronkelijke watermonster.

Figuur 2
Figuur 2. RT-qPCR overzicht schema. Elk gewonnen monster RNA wordt reverse getranscribeerd met drievoud assays (RT1, RT2 en RT3). Het cDNA uit elk van de drievoudige RT assays vervolgens geanalyseerd op bepaalde virussen via afzonderlijke enterovirus (EV PCR), norovirus genogroup I (november GIA PCR en NoV GIB PCR), norovirus genogroup II (NoV GII PCR), en hepatitis G (HGV PCR) testen.

Figuur 3
Figuur 3. Mean Poliovirus en Murine Norovirus Recovery (%) van de grond en de reagens-Grade Water. Het gemiddelde percentage herstel wordt getoond voor poliovirus vanaf de grond ( Afbeelding 3-1 ; n = 7) en van reagenskwaliteit ( Afbeelding 3-2 ; n = 12) water en muizen norovirus vanaf de grond ( Afbeelding 3-3 ; n = 7) en van reagenskwaliteit ( Afbeelding 3-4 ; n = 12) water (1), waarbij "n" het aantal afzonderlijke watermonsters verwerkt. Fout balken geven standaard fout.

Figuur 4 Figuur 4. Enterovirus en Norovirus GII Standard Curve. Typische standaard curves voor enterovirus en norovirus GII worden getoond. De formules die helling en R2-waarden voor elke curve worden berekend door de thermische cycler.

Aanvullende Bestand 1. Klik hier om dit bestand te downloaden.

Virus Group Primer / Probe Benaming (1) Sequence (2) Referentie
Enterovirus
EntF (EV-L) 20
Entr (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-sonde) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Hepatitis G
HepF (5'-NCR voorwaartse primer) CGGCCAAAAGGTGGTGGATG 19
HepR (5'-NCR reverse primer) CGACGAGCCTGACGTCGGG 19
Hepp (hepatitis G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tabel 1. primers en TaqMan Probes voor Virus Detectie door RT-qPCR.
(1) Methode 1615 primer en probe namen zijn de eerste drie letters van de naam van het virus samengevoegd tot F, R, of P voor vooruit, achteruit, en de sonde. Het norovirus genogroup wordt door het toevoegen van GI en GII de namen aangewezen. De twee norovirus GI primersets ook onderscheiden met behulp van A en B. Primer en sonde namen uit de primaire nummer in ouderheses.
(2) De oriëntatie van primer en probe sequenties 5 'tot 3'. De volgende gedegenereerde base indicatoren gebruikt: N-mengsel van alle vier nucleotiden; R-A + G; Y-T + C; W-A + T; en I-inosine.

Bestanddeel Volume per reactie (ui) (2) Eindconcentratie Volume per Master Mix (pl) (3)
RT Master Mix 1
Random primer 0.8 10 ng / pl (c. 5,6 uM) 84
Hepatitis G Armored RNA (4) 1 105
PCR kwaliteit water 14.7 1543,5
NaarTal 16,5 1732,5
RT Master Mix 2
10x PCR Buffer II 4 10 mM tris, pH 8,3, 50 mM KCl 420
25-mM MgCl2 4.8 3 mM 504
10-mM dNTPs 3.2 0,8 mM 336
100-mM DTT 4 10 mM 420
RNase Inhibitor 0.5 0,5 eenheden / gl 52.5
SuperScript II RT 0.3 1,6 eenheden / gl 31.5
Totaal 16.8 1764

Tabel 2. RT Master Mix 1 en 2 (1).
(1) Bereid RT Master Mixes in een clean kamer, dat wil zeggen, een ruimte waar moleculaire en microbiologische procedures niet worden uitgevoerd.
(2) De definitieve RT assay volume 40-il.
(3) De volumes vertonen op basis van 105 assays. Dit is voldoende voor een 96-wells PCR-plaat met de extra toegevoegde assays om rekening te verliezen. De hoeveelheid kan worden vergroot of verkleind afhankelijk van het aantal monsters en controles zullen worden geanalyseerd.
(4) Bepaal het hepatitis G reagens in de RT Master Mix 1 op te nemen zoals beschreven in supplementaire materialen stap S4.

Bestanddeel Volume per reactie (ui) (2) Eindconcentratie Volume per Master Mix (pl) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX referentiekleurstof (4) 0.4 0,5 mM 42
PCR kwaliteit water 1 105
10 uM EntF 0.6 300 nM 63
10 uM Entr 1.8 900 nM 189
10 uM ENTP 0.2 100 nM 21
Totaal 14 1470

Tabel 3. PCR Master Mix Enterovirus (EV) Assay (1).
(1) Bereid alle PCR Master Mixes in een schone kamer.
(2) De definitieve qPCR assay volume 20 pi.
(3) De volumes vertonen op basis van 105 assays. Dit is voldoende voor een 96-wells PCR-plaat met de extra toegevoegde assays om rekening te verliezen. Het bedrag kan worden opgeschaald of naar gelang van het aantal monsters en controles die zalgeanalyseerd.
(4) Plaatsvervanger PCR kwaliteit water voor deze reagens bij het gebruik van instrumenten die niet nodig hebben.

Bestanddeel Volume per reactie (ui) (2) Eindconcentratie Volume per Master Mix (pl) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX referentie kleurstof (4) 0.4 0,5 mM 42
PCR kwaliteit water 1.4 147
10 uM NorGIAF 1 500 nM 105
10 uM NorGIAR 1 500 nM 105
10 uM NorGIAP 0.2 100 nM 21
Totaal 14 1470

Tabel 4. PCR Master Mix voor Norovirus GIA (nov GIA) Assay (1).
Zie Tabel 3 voor voetnoten (1) - (4).

Bestanddeel Volume per Reactie (pl) (2) Eindconcentratie Volume per Master Mix (pl) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX referentie kleurstof (4) 0.4 0,5 mM 42
PCR kwaliteit water 0.3 31.5
10 uM NorGIBF 1 500 nM 105
10 uM NorGIBR 1.8 900 nM 189
10 uM NorGIBP 0.5 250 nm 52.5
Totaal 14 1470

Tabel 5. PCR Master Mix voor Norovirus GIB (nov GIB) Assay (1).
Zie Tabel 3 voor voetnoten (1) - (4).

<td> 0,5 mmol
Bestanddeel Volume per Reactie (pl) (2) Eindconcentratie Volume per Master Mix (pl) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX referentie kleurstof (4) 0.4 42
PCR kwaliteit water 0.3 31.5
10 uM NorGIIF 1 500 nM 105
10 uM NorGIIR 1.8 900 nM 189
10 uM NorGIIP 0.5 250 nm 52.5
Totaal 14 1470

Tabel 6. PCR Master Mix voor Norovirus GII (nov GII) Assay (1).
Zie Tabel 3 voor voetnoten (1) - (4).

Bestanddeel Volume per Reactie (pl) (2) Eindconcentratie Volume per Master Mix (pl) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX referentie kleurstof (4) 0.4 0,5 mM 42
PCR kwaliteit water 0.3 31.5
10 uM MuNoVF1 1 500 nM 105
10 uM MuNoVR1 1.8 900 nM 189
10 uM MuNoVP1 0.5 250 nm 52.5
Totaal 14 1470

Tabel 7. PCR Master Mix Murine Norovirus Assay (1).
Zie Tabel 3 voor voetnoten (1) - (4).

Bestanddeel Volumeper Reactie (pl) (2) Eindconcentratie Volume per Master Mix (pl) (3)
2x LightCycler 480 Probes Master Mix 10 Proprietary 1050
ROX referentie kleurstof (4) 0.4 0,5 mM 42
PCR kwaliteit water 1.4 147
10 uM HepF 1 500 nM 105
10 uM HepR 1 500 nM 105
10 uM HEPP 0.2 100 nM 21
Totaal 14 1470

Tabel 8. PCR Master Mix Hepatitis G (HGV) Assay (1).
Bekijken

Standard Curve Concentratie Genomische kopieën per RT-qPCR Assay (1, 2)
2,5 x 10 8 502500
2,5 x 10 7 50250
2,5 x 10 6 5025
2,5 x 10 5 502,5
2,5 x 10 4 50,25
2,5 x 10 3 5,025

Tabel 9. Standard Curve Genomic exemplaren.
(1) Bepaal de standaard curve putten als normen en plaats de genomische kopieën per RT-qPCR assay waarden in de juiste plaats in de thermocycler software.
(2) Een acceptabele standaard curve zal een rendement van 70% -110% hebben, Een R2 waarde> 0,97, en een algemene standaard deviatie van <0,5 voor norovirus en <1.0 voor enterovirus.

Criteria Aanvaardbare Waarde
Norovirus Enterovirus
Totale standaarddeviatie <0,5 <1,0
R 2 > 0,97 > 0,97
Rendement 70% tot 115% 70% tot 115%

Tabel 10. Standard Curve acceptatiecriteria (1).
(1) Standaard bochten met% Rendementen van 70% -110% zijn acceptabel, maar waarden in de 90% -115% bereik zijn ideaal. Waarden lager dan 90% kunnen pipetteren of verdunning fouten aangeven.

QA Component Bedoel Recovery Range (%) Variatiecoëfficiënt (%)
Lab reagensblanco; negatieve PT of PE monsters 0 N / A (1)
Lab Versterkte Blanco; Lab Versterkte monstermatrix 5-200 N / A
Positieve PT en PE stalen 15-175 ≤130

Tabel 11. Methode 1615 prestatiecriteria.
(1) Niet van toepassing.

Media Samenstelling
0,15 M natriumfosfaat, pH 7,0-7,5 Bereid 0,15 M natriumfosfaat door het oplossen van 40,2 g natriumfosfaat, dibasisch (Na 2 HPO 4 · 7H 2 O) in een eindvolume van 1 L dH
5% BSA Bereid door het oplossen van 5 g BSA in 100 ml dH 2 O. Steriliseren door de oplossing door een 0,2-um steriliseren filter.
PBS, 0,2% BSA Bereid door toevoeging van 4 ml 5% BSA aan 96 ml PBS. Steriliseren door de oplossing door een 0,2-um steriliseren filter.
TSM III buffer Ontbinden 1,21 g Trisma base, 5,84 g NaCl, 0,203 g MgCl2, 1 ml Prionex gelatine, en 3 ml Mikrozid III in 950 ml reagens kwaliteit water. Stel de pH op 7,0 te brengen en vervolgens het uiteindelijke volume op 1 L. Steriliseren door de oplossing door een 0,2-um filter steriliseren.
0,525% natriumhypochloriet (NaClO) Bereid een 0,525% NaClO oplossing door verdunnen huishoudbleekmiddel 01:10 in dH 2 O. WINKEL 0,525% NaClO oplossingen tot 1 week bij kamertemperatuur.
1-M natriumthiosulfaat (Na 2 S 2 O 3) pentahydraat Bereid een 1 M oplossing door het oplossen van 248,2 g Na 2 S 2 O 3 in 1 L van dH 2 O. WINKEL natriumthiosulfaat tot 6 maanden bij kamertemperatuur.

Tabel 12. Tabel van de Media.

Discussion

Grootschalige nationale studies van virale besmetting van de bron en het drinken van water vereisen het gebruik van meerdere analytische laboratoria. Onder deze omstandigheden een standaardmethode is nodig om te verzekeren dat de gegevens die door de verschillende laboratoria vergelijkbaar. Er zijn vele gepubliceerde moleculaire methoden voor virusdetectie, maar heel weinig gestandaardiseerde moleculaire methoden. EPA Method 1615 is een gestandaardiseerde methode speciaal ontwikkeld voor de detectie van enterovirus en norovirus in water matrices door RT-qPCR. Gestandaardiseerde moleculaire methoden zijn beschikbaar voor virusdetectie in voedingsmiddelen (CEN / ISO TS 15216-1 en CEN / ISO TS 15216-2, 7 april 2013) 16,17 en zijn toegepast op de detectie van hepatitis A-virus en norovirus in het voorjaar water 16. Alle standaard methoden moeten kwaliteit prestaties controles en criteria voor de inter- minimaliseren en intra-laboratorium variatie en vals positieve gegevens als gevolg van laboratorium verontreiniging bevatten. Om verder te verminderen valse gegevens, EPA Methode 1615 volgt begeleiding EPA's op moleculaire methoden, 18, ​​die de scheiding van het werk bepaalt tijdens de verwerking en een manier work flow. Het omvat een hepatitis G 1,19 interne controle en procedures om vals-negatieve resultaten te wijten aan remmers van RT-qPCR 15 minimaliseren. Het maakt gebruik van kwantitatieve bepalingen met gestandaardiseerde hoeveelheden van zowel water bemonsterd en geanalyseerd water zodat alle gegevensveld uitgedrukt in genome kopieën per liter van het veld of drinkwater bemonsterd. Hoewel efficiënte enkele buis (eenstaps) RT-PCR testen zijn in de handel verkrijgbaar, de werkwijze met opzet heeft gescheiden assays. Dit heeft het nadeel van het minimaliseren van de hoeveelheid monster die onderzocht kunnen worden in elke reactie, maar geeft meer flexibiliteit bij het gebruik van meerdere primer sets. RT-qPCR testen worden beperkt door en alleen zo goed als de primers en probes gebruikt en waarschijnlijk geen primer set zal alle virusvarianten binnen een groep op te sporen. Het enterovirus primer set werd gekozen omdathet richt de geconserveerde 5'-niet-coderende gebied, 20,21 detecteert diverse enterovirus serotypen en virussen gedetecteerd door te worden geassocieerd met gezondheidseffecten van gebruik van onbehandeld grondwater 1. Twee primer sets worden gebruikt voor de detectie van genogroup ik Norovirussen 22,23. De eerste werd gekozen vanwege de sterke correlatie tussen gezondheidseffecten bij jonge kinderen en gedetecteerd virus 1. De tweede genogroup ik primer ingesteld en de primer die wordt gebruikt voor genogroup II noroviruses werden gekozen omdat ze op te sporen de meest uiteenlopende stammen 24,25.

Ondanks de grote voordelen van qPCR en RT-qPCR procedures om viraal RNA in water, zijn er verschillende beperkingen. Ten eerste, zowel infectieuze en niet-infectieuze virusdeeltjes, waaronder die geïnactiveerd door ontsmettingsmiddelen, kan worden versterkt door deze procedures. De resultaten van Borchardt suggereren dat dit minder een probleem voor onbehandeld grondwater from aquifers vergelijkbaar met die in de gemeenschappen onderzochte dan ontsmette oppervlaktewater 1. Voor virussen die gekweekt Dit probleem kan worden overwonnen met behulp van PCR in combinatie met kweek 26,27. Het probleem is ook gericht bepaalde virussen door het gebruik van nucleïnezuur verknopingsmiddelen 28-30. Deze laatste benadering is effectief voor virussen geïnactiveerd door hypochloriet en niet effectief voor mensen geïnactiveerd door UV.

Een tweede beperking van deze moleculaire procedures is dat het volume van geconcentreerde monster die typisch kunnen worden getest veel kleiner zijn dan voor procedures cultuur 6,31. Dit probleem wordt vaak door substitueren ofwel een polyethyleen-glycol gebaseerde procedure voor de standaard secundaire concentratie organische uitvlokken, waardoor het monster kan worden geresuspendeerd in een kleiner volume, of door toevoeging van een tertiair monster concentratiestap 6,32,33 . Methode 1615 gebruikt CENTRIFUGAL ultrafiltratie tertiaire concentratie bieden. Centrifugale ultrafiltratie verwijdert water en componenten minder dan 30.000 Dalton waardoor zowel de concentratie van virussen in testmonsters en een verlaging laag molecuulgewicht remmers van moleculaire assays. Deze tertiaire concentratiestap resulteert in een algehele concentratiefactor van> 10 5 voor elk virus dat aanwezig is in het water werd getest.

Een derde beperking is de aanwezigheid van inhibitoren van moleculaire procedures milieumonsters. Hoewel tal van benaderingen van remmers te verwijderen zijn ontwikkeld, geen aanpak is effectief voor alle water matrices en virustypes 6,34,35, waardoor het gebruik van interne controles ontwikkeld om het niveau van de remming van essentieel belang te schatten. Het hepatitis G reagens dat in deze werkwijze voldoet aan deze eis door een constant niveau van viraal RNA in alle reacties en een RT-qPCR assay voor remming schatten. Wanneer de beste van de tHij remmer verwijdering benaderingen niet aan remming verwijderen, monster concentraten kan zolang virus concentraties hoger dan inhibitor concentraties 14,15 worden verdund.

De hierin beschreven standaardkromme procedure voor- en een belangrijke beperking. Een voordeel is dat het gebruikte reagens levert alle noodzakelijke componenten in één reagens, waardoor een regeling te gebruiken voor alle assays. Dit reagens is vooral een voordeel voor norovirus assays. Norovirus deeltjes kan alleen worden verkregen van geïnfecteerde individuen waardoor het erg moeilijk om virale deeltjes te verkrijgen voor gebruik als standaarden. Een belangrijk voordeel is dat het een RNA-standaard voor gerichte RNA-virussen in een reagens, zoals met een RNA standaard essentieel voor kwantificatie van RNA 36. Toch is het vermogen om virus nauwkeurig te kwantificeren beperkt doordat matrix die niet in aanmerking worden genomen. Dit betekent dat de genomische kopieaantal waarden kan niet absoluut worden beschouwd en moet alleen worden overwogen in relatieve termen. Het wordt aanbevolen dat een voldoende aantal standaard curve werkvoorraad porties (stap 1.2) bereid zijn om volledige studies. Bijvoorbeeld, elk 250 pi aliquot voldoende reagens voor 6 RT platen. Indien bekend is dat een studie analyse van 500 monsters vereisen, zou een minimum van 12 monsters vereist (500 samples / 7 monsters per plaat RT / 6 RT platen per portie).

EPA Method 1615 is een op prestaties gebaseerde methode. Veel fabrikanten gelijkwaardige reagentia hierin vermeld en deze reagentia kunnen zolang de prestatiecriteria voldaan worden vervangen. De standaardkromme, die ook als RT-qPCR positieve controle is waardevol bij de prestaties oplossen problemen. Prestaties kunnen afnemen als gevolg van de afbraak van RNA, reagens houdbaarheid, het falen van diepvriezers, kalibratie en technische fout. Prestaties kwesties moeten verdachteed als standaard curves verschillen van die getoond in figuur 4 of als ze niet voldoen aan de prestatie-eisen voor standaard curves. De RT-qPCR test is zeer robuust; complete mislukking is waarschijnlijk het gevolg van onjuiste behandeling van RNA of een technische fout (bijvoorbeeld een vermist reagens). Grote zorg moet worden genomen bij de behandeling van RNA-monsters tussen extractie en de RT stap om RNA degradatie te verminderen van ribonucleasen.

Poliovirus terugvorderingen van grond en reagenskwaliteit wateren en muizen norovirus terugvorderingen uit grondwater ontmoette de EPA Method 1615 prestaties acceptatiecriteria (tabel 11) en zijn vergelijkbaar met die gerapporteerd door anderen 33,37,38. Muizen norovirus terugvorderingen van LFB monsters waren veel lager dan die van poliovirus en zou niet het poliovirus-specifieke acceptatiecriteria hebben ontmoet. De redenen voor de lagere muizen norovirus herstel van reagenskwaliteit water zijn onbekend. Vergelijkbaar met de resultaten hierin Karim en Colleagues meldde een herstel voor norovirus GI.1 van 4% ten opzichte van leidingwater 39. Lee et al. 37 gerapporteerde gemiddelde terugvorderingen voor muizen norovirus en menselijke norovirus GII.4 van 18% en 26% ten opzichte van gedestilleerd water met behulp van disc filters, respectievelijk. Met vergelijkbare voorwaarden Lee en collega's, Kim en Ko waargenomen terugvorderingen van 46% en 43% voor deze virussen, respectievelijk 38. Gibbons et al. 40 verkregen ongeveer 100% terugwinning van menselijke norovirus GII.4 uit zeewater, maar Kim Ko 38 gevonden dat de toevoeging van zout aan gedestilleerd water bij concentraties gelijk aan of hoger dan zeewater aanzienlijk verminderde terugwinning van de murine virus resulteerde in ongeveer een tweevoudige reductie GII.4 herstel.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics