EPA Method 1615. Måling av Enterovirus og Norovirus Forekomst i Water av Kultur- og RT-qPCR. Del III. Virus Detection ved RT-qPCR

Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Kvantitativ PCR (qPCR, se supplerende materialer for definisjoner av begrepene som brukes i dette manuskriptet) og revers transkripsjon-qPCR (RT-qPCR) er verdifulle verktøy for å oppdage og kvantifisere menneske enteriske virus i miljø- og drikker vann, og spesielt for mange virus som gjør ikke replikere eller replikere dårlig i cellekultursystemer. Begge verktøyene har vist at mange virustyper er til stede i miljøet og drikke vannet over hele verden 1-6. Deres bruk sammen med sekvensering av amplifiserte genomiske fragmenter i løpet av sykdomsutbrudd undersøkelser har gitt bevis for vannbårne virusoverføring, ettersom de har vist at viruset funnet i drikkevann er identisk med den som kaster av utbrudds pasienter 7-10.

Både qPCR og RT-qPCR er nyttige folkehelse verktøy. For eksempel er data fra studier utført av US Environmental Protection Agency (EPA) viste en sterk sammenheng værelom indikatormålinger av qPCR og helseeffekter i fritids farvann. Som et resultat av EPA endelige 2012 Rekreasjons Vann kvalitetskriteriene omfatter en qPCR fremgangsmåte for å overvåke badeplasser 11,12. Borchardt og kolleger fant også en sterk sammenheng mellom akutt gastroenteritt i lokalsamfunn som bruker ubehandlet grunnvann og virus i grunnvann som målt ved RT-qPCR en.

Hensikten med denne artikkelen er å beskrive den molekylære analysedelen av EPA Method 1615 13,14. Denne analysen anvender RT-qPCR for å gi et kvantitativt estimat av enterovirus og norovirus genomiske kopier (GC) per liter, basert på det opprinnelige volumet av miljømessige eller drikkevann ført gjennom en elektropositiv filter. En oversikt over den molekylære prosedyren er vist i figur 1. Protocol seksjon 1 detaljer av prosedyrer for fremstilling av standardkurven. Disse standardene er fremstilt av et reagens som inneholder en RNEn kopi av target-sekvensen for alle primer / probesett. Avsnitt 2 beskriver tertiære konsentrasjonen prosedyren. Seksjon 3 gir fremgangsmåten for å ekstrahere RNA fra den konsentrerte vann og kontrollprøver. RNA fra hver testprøve revers transkribert ved hjelp tredoble analyser og tilfeldige primere til prime transkripsjon (§ 4). CDNA fra hver revers transkripsjonsreaksjon er delt i fem separate virus-spesifikke analyser som er analysert i triplikat ved qPCR (avsnitt 5, figur 2). Analysen bruker primere og prober fra vitenskapelig litteratur (tabell 1) som er utviklet for å oppdage mange enterovirus og noroviruses og et reagens som inneholder hepatitt G RNA til å identifisere testprøver som er hemmende for RT-qPCR 15.

Protocol

Merk: Bruk datablader for å spore alle trinnene i protokollen; eksempel datablad er gitt i supplerende materiale Tabeller S2-S4.

1. Standard Curve Forberedelse

  1. Forbered en fungerende lager av standardkurven reagens (f.eks, pansrede RNA EPA-1 615) ved å fortynne det fra konsentrasjonen levert av produsenten til en konsentrasjon på 2,5 x 10 8 partikler / ml (2,5 x 10 8 GC / ml) ved hjelp av TSM III buffer. Dele arbeids aksjen i 250 ul porsjoner bruker 1,5 ml Mikrosentrifugerør og oppbevares ved -20 ° C.
    MERK: Se supplerende materialer protokollen Step S1 for instruksjoner om de forbereder arbeids bestander av virus og plasmider for bruk som alternative standardkurve reagenser.
  2. Tine ett eller flere av arbeidslager alikvoter. Forbered fem 10-fold seriefortynninger bruker 1,5 ml mikrosentrifugerør, gi konsentrasjoner på 2,5 x 10 7, 2,5 x 10 6, 2,5 x10 5, 2,5 x 10 til 4, og 2,5 x 10 3 GC / ml.
    1. Klargjør første fortynning ved å tilsette 25 mL av 2,5 x 10 8 GC / ml arbeider aksjen til 225 mL av TSM III buffer. Bland i 5 til 15 sekunder ved anvendelse av en virvelblander.
    2. Forberede neste utvanning ved å tilsette 25 ul av fortynningen fremstilt i trinn 1.2.1 til 225 mL av TSM III buffer. Bland igjen og fortsette en tilsvarende prosess for å fremstille de neste tre 10-gangers fortynninger.
  3. Pakk ut RNA fra standardkurven arbeider lager og de fem fortynninger umiddelbart ved hjelp av fremgangsmåten i punkt 3.

2. Tertiær Konsentrasjon

  1. Tilbered en sentrifugal konsentrator (30 000 molekylvekt cutoff) for hver prøve samlet opp ved tilsetning av minst 10 ml av 1 x PBS, 0,2% bovint serumalbumin (BSA) til det øvre prøvekammeret. Sikre at løsningen har fylt den tynne kanalen konsentrasjon kammer, og deretter holde O / N ved 4 ° C.
  2. Legg en mengde sekundær vann konsentrat fra hver prøven lik S, analysePrøveVolum i separate sentrifugale konsentratorer.
    1. Beregn S bruke ligning 1,
      Ligning 1
      Der D er volumet av Original Water Sample analysert, er TSV Total Prøvevolum og FCSV er Final Konsentrert Prøvevolum. Se supplerende materiale S2 for et eksempel på beregning av S.
  3. Sentrifuger hver testprøve på 3,000-6,000 xg ved 4 ° C i en svingende spannrotor for 20 - 30 min. Sjekk volumet i den tynne kanalen konsentrasjon kammeret.
    1. Hvis volumet er større enn 400 ul, sentrifuger på nytt i 20 minutter eller lenger. Fortsett sentrifugering før prøven i the tynn kanal konsentrasjon kammeret har blitt redusert til mindre enn 400 pl. Ikke fjern supernatanten.
  4. Vask sidene av sentrifugal-konsentrator med 1 ml sterilt 0.15 M natriumfosfat, pH 7 til 7,5 for å øke utvinningen virus. Sentrifuger på nytt på 3,000-6,000 xg og 4 ° C inntil prøven er redusert til mindre enn 400 pl. Gjenta dette vasketrinn én ekstra gang.
  5. Ved hjelp av en mikropipette 100-200 ul, forsiktig måle og overføre hver prøve konsentreres til et 1,5 ml mikrosentrifugerør (dvs. overføre 200 ul til mikrosentrifugerør og deretter måle den gjenværende konsentrat ved å justere mikropipette til den gjenværende væske kan være helt utarbeides inn i pipetten tips). Legg 0,15 M natriumfosfat, pH 7 til 7,5, for å justere det endelige volum til 400 ± 2 ul.
  6. Pakk nukleinsyre umiddelbart ved å gå frem til trinn 3. Hold eventuelle konsentrerte prøvene som ikke kan processed umiddelbart ved 4 ° C i ikke mer enn 24 timer.

3. nukleinsyreisolering

  1. Tilsett 200 ul av ekstraksjon buffer fremstilt som beskrevet i trinn 3.3, og 200 ul av den tertiære konsentrat fra hver testprøve fra trinn 2,5 eller standardkurve fortynning fra trinn 1,3 til separere merket 1,5 ml mikrosentrifugerør. Fryse rester tertiære konsentrater ved eller under -70 ° C. Pakk de nukleinsyrer fra hver prøve i henhold til nukleinsyre utvinning kit produsentens instruksjoner for spin-protokollen for blodprøver med følgende unntak.
  2. Tilsett ikke protease til de vannprøver eller bruk ekstraksjon buffer som fulgte med nukleinsyre ekstraksjon kit.
  3. Forbered utvinning buffer med carrier RNA
    1. Legg 310 mL av carrier RNA fortynningsbuffer til et hetteglass med 310 mikrogram av carrier RNA. Bland å løse opp og deretter dele inn i 6 porsjoner inneholder ca 50 ul. Oppbevar ved -20° C.
    2. Legg 28 ul opptint bære RNA pr ml utvinning buffer for å oppnå en bærer RNA-konsentrasjon på 0,027 ug / ul. Bruk carrier RNA-endret utvinning buffer i stedet for den som følger med utvinning kit.
  4. Tilbered en foroppløsning av elueringsbuffer ved tilsetning av ribonuklease (RNase) Inhibitor til en endelig konsentrasjon på 400 enheter / ml av elueringsbufferen som følger med utvinning kit.
    1. Elute RNA fra nukleinsyrebindende spinnkolonne ved å plassere 50 ul elueringsbuffer med RNase inhibitor inn i kolonnen. Vent i 1 minutt, og deretter sentrifuger ved 6000 xg i 1 min ved RT.
    2. Gjenta trinn 3.4.1 og fjern og kast kolonnen.
  5. Forberede prøver av RNA-ekstrakter fra trinn 3.4.2. Forbered 6 porsjoner av standardkurven jobbe lager og hver standardkurve fortynning inneholder minst 15 ul hver. Forbered 4 porsjoner av alle andre RNA prøver inneholdende minst22 mikroliter hver. Lagre en porsjon av hver prøve og standard kurve kontroller ved 4 ° C hvis de kan bli behandlet ved revers transkripsjon i løpet av 4 timer; ellers, lagre alle delmengder ved eller under -70 ° C.

4. Reverse Transcription (RT)

  1. Forbered 100 uM stamløsninger av hver oligonukleotid-primer og probe som er oppført i Tabell 1 ved å tilsette et volum av PCR-grad vann til hver ampulle ved hjelp av en mengde (i mikroliter) lik ti ganger antall nanomol (nmol) av oligonukleotid er til stede i hetteglass (som vist på flaskeetiketten eller i produsentens spesifikasjonsarket (f.eks suspendere en primer som inneholder 36,3 nmol i 363 mL). Bland å oppløse.
    1. Fortynn de 100 uM oppløsninger 1:10 med PCR-grad vann for å fremstille 10 uM arbeidsløsninger.
  2. Forbered RT Master Mix 1 og 2 i et rent rom med guide i tabell 2. Pipetter 16,5 mL av RT Master Mix ett til hver PCR plate brønn med multikanalspipette.
  3. Thaw, hvis frosset, nukleinsyresekvensene utdrag fra hvert felt prøve og Lab Befestet Sample Matrix (LFSM, altså sådd vann matrise prøve).
    1. Fortynne hvert felt og LFSM utvalg 1: 5 og 1:25 i elueringsbuffer inneholder 400 enheter / ml RNase inhibitor.
    2. Thaw, hvis frosset, men ikke utvanne Lab Fortified Blank (LFB, altså en positiv kvalitetskontroll ved hjelp seeded reagenskvalitet vann), Lab Reagens Blank (LRB, altså en negativ kvalitetskontroll ved hjelp reagenskvalitet vann), Performance Evaluation (PE , dvs. podet reagenskvalitet vannprøvene som brukes til å evaluere laboratorieytelse før starten av studien), Ytelsestest (PT, dvs. podet reagenskvalitet vannprøver med titere ukjente for en analytiker som brukes til å evaluere laboratorie ytelse under en undersøkelse ), NA Batch negativ kontroll ekstraksjon, eller RNA ekstrahert fra standardkurven settet.
    3. Plasser 6,7 pl av RNA fra hver forsøksprøve, kontroll, og standardkurven i separate PCR-platebrønner, ved hjelp av triplikatbrønner for testprøver og kontroller og duplikatbrønner for standardkurver (se fig S1 for et RT plate eksempel).
      1. Plasser 6,7 mL av elueringsbuffer i separate PCR-plate brønner for templat-kontroller (NTC). 2-8 omfatter NTC per RT plate, ved hjelp av to for den første prøve, og deretter to mer for hvert fjerde ytterligere prøve.
      2. Fordel negative ekstraksjon og NTC-kontroller over hele platen.
    4. Tett PCR plate med en varmebestandig plate sealer. Bland prøvene for 5-10 sek og deretter sentrifuger ved ≥ 500 xg kort.
    5. Inkuber platen i 4 min ved 99 ° C og deretter avkjøles hurtig til 4 ° C i en termosykler. Sentrifuger igjen ved ≥ 500 xg kort.
    6. Fjern forsiktig plate tetningen og deretter legge til 16,8 mL av RT Master Mix to til hver brønn. Seal platen igjen med en varmebestandig plate forsegler, etterfulgt av blanding og en kort sentrifugering ved 500 x g ≥.
    7. Sett platen i en termosykler og kjørt i 15 minutter ved 25 ° C, etterfulgt av 60 min ved 42 ° C, 5 minutter ved 99 ° C, og deretter med en 4 ° C hold syklus.
    8. Prosessen umiddelbart eller i løpet av 8 timer ved qPCR (trinn 5), eller lagre prøver ved eller under -70 ° C inntil de kan bli behandlet. Oppbevar prøver som kan behandles innen åtte timer ved 4 ° C.

    5. Real-time kvantitativ PCR (qPCR)

    1. Bestem middelverdien hepatitt G Cq verdi for hvert parti av hepatitt G reagent før du kjører noen prøver.
      1. Kjør en RT-analyse ved hjelp av 10 replikater fremstilt som beskrevet for NTC kontroller (Trinn 4.1.1). Kjør hepatitt G qPCR-analyse som beskrevet nedenfor (trinn 5.2 til 5.5.3). Beregn middelverdien Cq verdi av 10 replikater.
      2. Juster hepatitt G reagent kvantitet i RT Master Mix 1 (tabell 2), Om nødvendig, for å oppnå en midlere Cq verdi mellom 25 og 32 enheter. Kompenser mengden økes eller reduseres ved å endre volumet av vann tilsatt for å holde RT Master Mix 1 sluttvolum på 16,5 ul per test.
      3. Bekreft eventuelle justeringer ved å gjenta trinn 5.1.1 til 5.1.2 og endring tabell 2 for å reflektere de justerte mengder.
    2. Forbered qPCR Master Mix i et rent rom med guidene i tabell 3 for enterovirus, tabell 4 og tabell 5 for norovirus genogroup I, tabell 6 for norovirus genogroup II, Tabell 7 for murine norovirus (norovirus genogroup V), og Tabell 8 for hepatitt G. Mix hver master mix og deretter sentrifuger ved ≥ 500 xg kort.
    3. Tilsett PCR Master Mix til passende brønner av en merket reaksjons optisk plate, ved hjelp av 14 ul per brønn og separate plater for hver qPCR-analyse (se Figur S2 figur S1).
    4. Tine RT plate fra trinn 4,8 på RT, hvis frosset. Bland med en plate mikser og deretter sentrifuger ved ≥ 500 xg kort.
    5. Dispensere 6 ul av det aktuelle cDNA til de passende brønner av den optiske reaksjonsplaten. Bland prøvene i den optiske reaksjonsplaten og sentrifuger ved 500 xg ≥ kort.
      1. Kjør hepatitt G qPCR analyse på ufortynnet og fortynnet feltet og LFSM prøver før du kjører alle andre qPCR analyser. Bruk lavest fortynning av felt eller LFSM prøve som er <1 Cq verdi som er større enn det bety hepatitt G Cq verdi for enterovirus og norovirus qPCR analyser.
      2. Sett opp kvantitativ PCR termosykleren programvaren i henhold til produsentens instruksjoner. Identifisere standardkurven prøvene som standarder og for hver standardkurve fortynning inn genomisk kopi verdiene vist i tabell 9.
    6. Fastslå om hver standardkurve oppfyller de akseptable verdiene gitt i tabell 10. Se avsnitt supplerende materiale S3 for eksempler.
      1. Beregn den totale standardavvik (stdDev) for standardkurve ved bruk av ligning 2,
        Ligning 2
        hvor Cq er den verdi som er rapportert for hver standardkurve gjengivelse, er Cq middelverdien for hvert sett av replikater, er #Cq det totale antall CQ verdier for alle standard kontrollreplika som har positive verdier (dvs. ikke ubestemt), og # kjønnssykdommer er det antall standard-kontroller som har positive verdier.
      2. Dersom den kvantitative PCR thermal cycler programvare ikke beregner helningen for hver standardkurve beregnes skråningen ved hjelp av ligning 3,60;
        Ligning 3
        hvor Cq er middelverdien av de høyeste og laveste fortynninger som brukes og logge GC er logaritmen av den genomiske kopi verdi for den høyeste og laveste fortynninger brukes fra tabell 9.
      3. Beregn R2 verdi ved bruk av ligning 4.
        Ligning 4
        hvor Cq er gjennomsnittet av alle CQ verdier og Log GC er den logaritmiske GC verdi for hvert replikat.
      4. Beregn% effektivitet ved hjelp av ligning 5:
        Ligning 5
    7. Spill GC beregnede verdiene termosykleren programvare for alle testprøver basert på standardkurver som oppfyller kriteriene fastsatt i tabell 10 og gjennomsnitts GC verdiene for hver prøve. Kjør noen prøver med standardkurver som ikke oppfyller kriteriene i
    8. Bestem GC per liter (GC L) for hver testprøve ved bruk av ligning 6:
      Ligning 6
      hvor GC er det midlere genomisk kopiantallet fra trinn 5.7, den faktor "199" er den totale fortynningsfaktor for volumreduksjon som oppstår under den tertiære konsentrasjon, RNA ekstraksjon og RT-qPCR trinn, er DF fortynningsfaktoren som kompenserer for inhibering og D er volumet av Original Water Sample analysert i liter. Se supplerende materialer, seksjon S4 for et eksempel på beregning av GC L.
    9. Beregn den totale GC av LFB og LRB prøver ved å multiplisere den midlere GC verdien fra trinn 5,5 ved 199 og dividere med 0,3.

Representative Results

Samlet virus utvinning ble bestemt ved bruk sammen felt og LFSM grunnvann prøver. I alt syv prøvesettene ble analysert ved hjelp av to sett samlet på forskjellige anledninger fra tre offentlige renseanlegg, og ett prøvesett hentet fra privat brønn. Frø nivåer for LFSM prøvene var 3 x 10 6 MPN av Sabin poliovirus serotype 3 og 5 x 10 6 PFU av muse norovirus. Murine norovirus ble anvendt som et surrogat i metoden evaluering på grunn av en mangel på menneskelige norovirus bestander med et virus konsentrasjon som er tilstrekkelig for LFSM prøver. For grunnvann prøver middelverdien poliovirus-gjenvinning var 20%, med en standard feil på 2%, mens 14 betyr murine norovirus gjenvinning var 30%, med en standardfeil på 3% (figur 3). Det vanlige feltet grunnvannsprøven for hver LFSM hadde ingen påviselig enterovirus eller norovirus.

LFB og LRB prøvene ble målt ved hjelp av seeded og uanriket reagens-grade wateh. Alle LRB prøvene var negative (data ikke vist). Poliovirus utvinning gjennomsnitt på 44% med et standardavvik på 1% (figur 3), mens murin norovirus utvinning gjennomsnitt på 4% med et standardavvik på 0,5%.

RT-qPCR krever bruk av egnede standardkurve reagenser. Figur 4 viser en typisk standardkurve for enterovirus og norovirus GII. Den norovirus GII kurve oppfyller standardkurve ytelseskriteriene (tabell 10) med en R 2 verdi på 0,9987, en samlet standardavvik på 0,14, og 101% effektivitet. Norovirus GIA og GIB kurver (ikke vist) er nesten identisk med norovirus GII. Den enterovirus kurve oppfyller metode ytelseskriteriene med en R2 verdi på 0,9874, en samlet standardavvik på 0,58, og 103% effektivitet, men har omtrent hundre ganger mindre følsomhet og dermed en høyere deteksjonsgrense enn Norovirus kurver.


Figur 1. Oversikt over Molecular Procedure. Molekylfremgangsmåten omfatter ytterligere prøvekonsentrasjon utover det som er utført for å måle infeksjonsdyktige virus, ekstrahering av nukleinsyrer, en to-trinns revers transkripsjon (RT) protokoll, og kvantitativ PCR (qPCR). Utgangs-volum (S) representerer en metode definert andel av det opprinnelige vannprøven.

Figur 2
Figur 2. RT-qPCR oversikt skjematisk. Hver ekstraheres prøven RNA revers transkribert ved hjelp tredoble analyser (RT1, RT2, og RT3). CDNA fra hver av de tre eksemplarer RT analysene deretter analyseres for spesifikke virus ved hjelp av separat enterovirus (EV PCR), norovirus genogroup jeg (nov GIA PCR og NOV GIB PCR), norovirus genogroup II (Navvik GII PCR), og hepatitt G (HGV PCR) analyser.

Figur 3
Figur 3. Mean poliovirus og Murint Norovirus Recovery (%) fra Ground og Reagens-Grade Water. Den gjennomsnittlige prosentvise oppgangen er vist for poliovirus fra bakken ( Figur 3-1 ; n = 7) og fra reagenskvalitet ( Figur 3-2 ; n = 12) for vann og murine norovirus fra bakken ( Figur 3-3 ; n = 7) og fra reagenskvalitet ( Figur 3-4 ; n = 12) vann (1), hvor "n" er antall separate vannprøver behandlet. Feilstolpene representerer standardfeil.

Figur 4 Figur 4. Enterovirus og Norovirus GII standardkurve. Typiske standardkurver for enterovirus og norovirus GII vises. Formlene som gir helling og R 2 verdier for hver kurve er beregnet av den termosykler.

File Opplysning 1. Klikk her for å laste ned denne filen.

Virus Gruppe Primer / Probe Navn (1) Sekvens (2) Referanse
Enterovirus
EntF (EV-L) 20
ENTR (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-probe) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Hepatitt G
HEPF (5'-NCR fremover primer) CGGCCAAAAGGTGGTGGATG 19
HepR (5'-NCR revers primer) CGACGAGCCTGACGTCGGG 19
Hepp (hepatitt G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tabell 1. Grunning og TaqMan prober for Virus Detection ved RT-qPCR.
(1) Metode 1615 primer og sonde navnene er de tre første bokstavene i virusnavnet sammensatt til F, R eller P for forover, bakover, og sonde. Den norovirus genogroup er utpekt ved å legge GI og GII til navnene. De to Norovirus GI primersettene også utmerker seg ved hjelp av A og B. Primer og sonde navn fra primær referanser er gitt i overordneteser.
(2) orienteringen av primer og probe-sekvenser som er 5 'til 3'. De følgende degenererte basis indikatorer brukes: N-en blanding av alle fire nukleotider; R-A + G; Y-T + C; W-A + T; og I-inosin.

Ingrediens Volum pr reaksjon (gl) (2) Endelig konsentrasjon Volum per Master Mix (ul) (3)
RT Master Mix 1
Tilfeldig primer 0.8 10 ng / mL (c. 5,6 mm) 84
Hepatitt G Armored RNA (4) 1 105
PCR grade vann 14.7 1543,5
Tiltal 16.5 1732,5
RT Master Mix 2
10x PCR Buffer II 4 10 mM tris, pH 8,3, 50 mM KCl 420
25 mM MgCl2 4.8 3 mm 504
10-MM dNTPs 3.2 0,8 mm 336
100-mM DTT 4 10 mm 420
RNase Inhibitor 0.5 0,5 enheter / ul 52.5
Super II RT 0.3 1,6 enheter / ul 31.5
Total 16.8 1 764

Tabell 2. RT Master Mix 1 og 2 (1).
(1) Forbered RT Master Mixes i en clean rom, det vil si, et rom der molekylære og mikrobiologiske prosedyrer ikke er utført.
(2) Den endelige RT analysevolum er 40 pl.
(3) Volumene viser er basert på 105 analyser. Dette er tilstrekkelig for en 96-brønners PCR-plate med de ekstra analyser tilsettes for å ta hensyn til tap. Mengden kan skaleres opp eller ned i henhold til antall prøver og kontrollprøver som skal analyseres.
(4) Bestem mengden av hepatitt G reagent inkludere i RT Master Mix 1 som beskrevet i supplerende materiale Step S4.

Ingrediens Volum pr reaksjon (gl) (2) Endelig konsentrasjon Volum per Master Mix (ul) (3)
2x LightCycler 480 prober Master Mix 10 Proprietær 1050
ROX henvisningfargestoff (4) 0.4 0,5 mm 42
PCR grade vann 1 105
10 mm EntF 0.6 300 nM 63
10 mm Entr 1.8 900 nM 189
10 mm ENTP 0.2 100 nM 21
Total 14 1 470

Tabell 3. PCR masterblanding for Enterovirus (EV) Assay (1).
(1) Forbered alle PCR Master Mixes i et rent rom.
(2) Den endelige qPCR analysen volum er 20 pl.
(3) Volumene viser er basert på 105 analyser. Dette er tilstrekkelig for en 96-brønners PCR-plate med de ekstra analyser tilsettes for å ta hensyn til tap. Beløpet kan skaleres opp eller ned i henhold til antall prøver og kontroller som skalbli analysert.
(4) Innbytter PCR grade vann for dette reagenset ved bruk av instrumenter som ikke krever det.

Ingrediens Volum pr reaksjon (gl) (2) Endelig konsentrasjon Volum per Master Mix (ul) (3)
2x LightCycler 480 prober Master Mix 10 Proprietær 1050
ROX henvisning fargestoff (4) 0.4 0,5 mm 42
PCR grade vann 1.4 147
10 mm NorGIAF 1 500 nM 105
10 mm NorGIAR 1 500 nM 105
10 mm NorGIAP 0.2 100 nM 21
Total 14 1 470

Tabell 4. PCR Master Mix for Norovirus GIA (NOV GIA) analyse (1).
Se tabell 3 for fotnoter (1) - (4).

Ingrediens Volum pr Reaksjon (ul) (2) Endelig Konsentrasjon Volum per Master Mix (ul) (3)
2x LightCycler 480 prober Master Mix 10 Proprietær 1050
ROX henvisning fargestoff (4) 0.4 0,5 mm 42
PCR grade vann 0.3 31.5
10 mm NorGIBF 1 500 nM 105
10 mm NorGIBR 1.8 900 nM 189
10 mm NorGIBP 0.5 250 nM 52.5
Total 14 1 470

Tabell 5. PCR Master Mix for Norovirus GIB (NOV GIB) analyse (1).
Se tabell 3 for fotnoter (1) - (4).

<td> 0,5 mm
Ingrediens Volum pr Reaksjon (ul) (2) Endelig Konsentrasjon Volum per Master Mix (ul) (3)
2x LightCycler 480 prober Master Mix 10 Proprietær 1050
ROX henvisning fargestoff (4) 0.4 42
PCR grade vann 0.3 31.5
10 mm NorGIIF 1 500 nM 105
10 mm NorGIIR 1.8 900 nM 189
10 mm NorGIIP 0.5 250 nM 52.5
Total 14 1 470

Tabell 6. PCR Master Mix for Norovirus GII (NOV GII) analyse (1).
Se tabell 3 for fotnoter (1) - (4).

Ingrediens Volum pr Reaksjon (ul) (2) Endelig Konsentrasjon Volum per Master Mix (ul) (3)
2x LightCycler 480 prober Master Mix 10 Proprietær 1050
ROX henvisning fargestoff (4) 0.4 0,5 mm 42
PCR grade vann 0.3 31.5
10 mikrometer MuNoVF1 1 500 nM 105
10 mm MuNoVR1 1.8 900 nM 189
10 mikrometer MuNoVP1 0.5 250 nM 52.5
Total 14 1 470

Tabell 7. PCR Master Mix for Murint Norovirus analyse (1).
Se tabell 3 for fotnoter (1) - (4).

Ingrediens Volumpr Reaksjon (ul) (2) Endelig Konsentrasjon Volum per Master Mix (ul) (3)
2x LightCycler 480 prober Master Mix 10 Proprietær 1050
ROX henvisning fargestoff (4) 0.4 0,5 mm 42
PCR grade vann 1.4 147
10 mm HEPF 1 500 nM 105
10 mm HepR 1 500 nM 105
10 mm Hepp 0.2 100 nM 21
Total 14 1 470

Tabell 8. PCR Master Mix for Hepatitt G (HGV) analyse (1).
Se

Standard Curve Konsentrasjon Genomiske eksemplarer per RT-qPCR analyse (1, 2)
2,5 x 10 8 502500
2,5 x 10 7 50250
2,5 x 10 6 5025
2,5 x 10 5 502,5
2,5 x 10 4 50.25
2,5 x 10 3 5,025

Tabell 9. Standard Curve Genomiske eksemplarer.
(1) Identifiser standardkurven brønner som standarder og plassere de genomiske kopier per RT-qPCR analyseverdier på riktig sted i termo programvare.
(2) En akseptabel standardkurve vil ha en virkningsgrad på 70% -110%, En R2-verdi> 0,97, og en generell standardavvik på <0,5 for norovirus og <1,0 for enterovirus.

Kriterier Akseptabelt Verdi
Norovirus Enterovirus
Samlet Standardavvik <0.5 <1,0
R2 > 0,97 > 0,97
Effektivitet 70% til 115% 70% til 115%

Tabell 10. Standard Curve Akseptkriterier (1).
(1) Standardkurver med% effektivitet på 70% -110% er akseptabelt, men verdiene i 90% -115% rekkevidde er ideelle. Verdier mindre enn 90% kan tyde pipettering eller fortynning feil.

QA Component Mener Recovery Range (%) Variasjonskoeffisient (%)
Lab Reagens Blank; negative PT eller PE prøver 0 N / A (1)
Lab Befestet Blank; Lab Befestet Sample Matrix 5-200 N / A
Positive PT og PE prøver 15-175 ≤130

Tabell 11. Metode 1615 ytelseskriterier.
(1) Ikke relevant.

Media Sammensetning
0,15 M natriumfosfat, pH 7,0-7,5 Forbered 0,15 M natriumfosfat ved oppløsning av 40,2 g natriumfosfat, dibasisk (Na2 HPO 4 · 7H 2 O) i et sluttvolum på 1 liter dH
5% BSA Forbered ved å oppløse 5 g av BSA i 100 ml dH 2 O. Steriliser ved å føre løsningen gjennom et 0,2 um steriliserende filter.
PBS, 0,2% BSA Forbered ved å tilsette 4 ml av 5% BSA i 96 ml PBS. Steriliser ved å føre løsningen gjennom et 0,2 um steriliserende filter.
TSM III buffer Oppløs 1,21 g Trisma-base, 5,84 g NaCl, 0,203 g MgCl2, 1 ml Prionex gelatin, og 3 ml Microcide III i 950 ml reagenskvalitet vann. Juster pH-verdien til 7,0, og deretter bringe det endelige volum til 1 L. Steriliser ved å føre løsningen gjennom et 0,2 um steriliserende filter.
0,525% natriumhypokloritt (NaCIO) Forbered en 0,525% NaCIO løsning ved å fortynne klorin 1:10 i dH 2 O. Lagre 0,525% NaCIO løsninger for opptil en uke på RT.
1-M natriumtiosulfat (Na 2 S 2 O 3) pentahydrat Tilbered en 1 M løsning ved å oppløse 248,2 g Na 2 S 2 O 3 i 1 liter dH 2 O. Butikken natriumtiosulfat for inntil 6 måneder ved RT.

Tabell 12. Tabell med Media.

Discussion

Store nasjonale studier av viral forurensning av kilde- og drikke farvann krever bruk av flere analytiske laboratorier. Under disse betingelser er en standard metode for å sikre at data genereres av flere laboratorier er sammenlignbare. Det finnes mange publiserte molekylære metoder for viruskontroll, men svært få standardiserte molekylære metoder. EPA Method 1615 er en standardisert metode spesielt utviklet for påvisning av enterovirus og norovirus i vann matriser av RT-qPCR. Standardiserte molekylære metoder er tilgjengelige for virus blir oppdaget i matvarer (CEN / ISO TS 15216-1 og CEN / ISO TS 15216-2, 7 april 2013) 16,17 og har blitt brukt til påvisning av hepatitt A virus og norovirus våren vann 16. Alle standard metoder må inneholde kvalitet Ytelse og kriterier for å minimere inter- og intra-laboratoriet variasjon og falske positive data på grunn av laboratorie forurensning. For ytterligere å redusere falske data, EPA Method 1615 følger EPAs veiledning på molekylære metoder, 18 som fastsetter separasjon av arbeid under bearbeiding og én måte arbeidsflyt. Det inkluderer en hepatitt G 1,19 internkontroll og rutiner for å minimere falske negative resultater på grunn av hemmere av RT-qPCR 15. Den bruker kvantitative analyser sammen med standardiserte mengder av både vann samplet og vann analyseres, slik at alle feltdata er uttrykt i genomiske kopier pr liter av feltet eller drikkevann samplet. Selv om effektiv enkelt rør (ett trinn) RT-PCR-analyser er tilgjengelige i handelen, med hensikt bruker metoden separate analyser. Dette har den ulempe av å minimere mengden av prøve som kan analyseres i hver reaksjon, men gir større fleksibilitet i bruken av flere primersettene. RT-qPCR analysene er begrenset av og bare så god som primere og prober som brukes og sannsynligvis ingen primer sett vil oppdage alle virusvarianter innenfor en gruppe. Den enterovirus primersett ble valgt fordiDet er rettet mot konserverte 5'-ikke-kodende region, 20,21 påviser et bredt utvalg av enterovirus-serotyper, og virus påvist av den er forbundet med helseeffekter av forbruk av ubehandlede grunnvann 1. To primersettene brukes til deteksjon av genogroup jeg noroviruses 22,23. Den første ble valgt på grunn av den sterke korrelasjonen mellom helseeffekter hos små barn og detektert virus 1. Den andre genogroup jeg primer satt og primer settet som brukes for genogroup II noroviruses ble valgt fordi de oppdager det bredeste utvalg av stammer 24,25.

På tross av de store fordelene med qPCR og RT-qPCR fremgangsmåter for påvisning av virus-RNA i vann, er det flere begrensninger. Først, både infeksiøse og ikke-infeksiøs viruspartikler, inkludert de som inaktiveres av desinfeksjonsmidler, kan forsterkes ved disse fremgangsmåter. Resultatene av Borchardt tyder på at dette er et mindre problem for ubehandlet grunnvann fROM akviferer ligner på dem i de samfunnene studert enn for desinfiserte overflatevann 1. For dyrkbare virus dette problemet kan overvinnes ved hjelp av PCR i kombinasjon med kultur 26,27. Problemet har også vært adressert for noen virus ved anvendelse av nukleinsyre-tverrbindingsmidler 28-30. Denne siste metoden er mer effektiv for virus inaktivert av hypokloritt og ikke effektive for de inaktivert av UV.

En annen begrensning av disse molekylære fremgangsmåtene er at volumet av konsentrert prøve som kan analyseres typisk er mye mindre enn den som anvendes for kultur prosedyrer 6,31. Dette problem er ofte håndteres enten ved å anvende en polyetylenglykol-basert fremgangsmåte for standard sekundær konsentrasjonen av organisk flokkulering, som tillater prøven å bli resuspendert i et mindre volum, eller ved tilsetning av et tertiært prøvekonsentrasjon trinn 6,32,33 . Metode 1615 bruker sentrifugeugal ultrafiltrering for å gi høyere konsentrasjon. Sentrifugal ultrafiltrering fjerner vann og komponentene mindre enn 30.000 dalton som resulterer i både konsentrasjonen av alle virus i testprøver og en reduksjon i små molekylvekt inhibitorer av molekylære assays. Dette tertiære konsentrasjonstrinn resulterer i en total konsentrasjon faktor på> 10 5 for en hvilken som helst virus som var til stede i vannet som blir testet.

En tredje begrensning er tilstedeværelsen av inhibitorer av molekylære prosedyrer i miljøprøver. Selv om tallrike fremgangsmåter for å fjerne inhibitorer har blitt utviklet, er ingen metode effektiv for alle vann matriser og virustyper 6,34,35, som gjør bruk av interne kontroller utformet for å anslå graden av inhibering avgjørende. Hepatitt-G-reagenset anvendt i denne fremgangsmåten tilfredsstiller dette krav ved å tilveiebringe et konstant nivå av viralt RNA i alle reaksjoner og en RT-qPCR-analyse for å beregne inhibering. Når de beste av than inhibitor fjerning tilnærminger ikke klarer å fjerne hemming, eksempel konsentrater kan fortynnes så lenge viruskonsentrasjonen er høyere enn inhibitorkonsentrasjoner 14,15.

Standardkurven fremgangsmåte som er beskrevet heri, har både fordeler og en stor begrensning. En fordel er at det anvendte reagens leverer alle de nødvendige komponenter i et enkelt reagens, slik at en enkelt kontroll for å brukes for alle analyser. Denne reagensen er spesielt en fordel for norovirus analyser. Norovirus partikler kan bare fås fra infiserte individer som gjør det svært vanskelig å oppnå viruspartikler for anvendelse som standarder. En mer viktig fordel er at det gir et RNA-standard for alle målrettet RNA-virus i en reagens, som har et RNA-standard er avgjørende for nøyaktig kvantifisering av RNA 36. Imidlertid er dens evne til å kvantifisere virus nøyaktig begrenset av det faktum at matrise virkninger ikke blir tatt hensyn til. Dette betyr at genomisk kopitallverdier kan ikke anses som absolutte og bør bare vurderes i relative termer. Det anbefales at et tilstrekkelig antall av standard kurvearbeidslager alikvoter (trinn 1.2) fremstilles for å dekke fullstendig studier. For eksempel gir hver 250 mL delmengde tilstrekkelig reagent for 6 RT plater. Dersom det er kjent at en studie vil kreve analyse av 500 prøver, ville minst 12 alikvoter være nødvendig (500 prøver / syv samplinger pr plate RT RT / 6 plater pr delmengde).

EPA Method 1615 er en forestilling basert metode. Mange produsenter gjør tilsvar reagenser til de som er nevnt her, og disse reagenser kan erstattes så lenge ytelseskriteriene er oppfylt. Standardkurven, som også fungerer som en positiv RT-qPCR kontroll, er av verdi i feilsøking ytelsesproblemer. Ytelse kan avta på grunn av degradering av RNA, reagent holdbarhet, svikt i frysere, instrument kalibrering og teknisk feil. Ytelsesproblemer bør være mistankeed hvis standardkurver avvike fra det som er vist i figur 4, eller hvis de ikke oppfyller de spesifiserte funksjonene for standardkurver. RT-qPCR-analyse er ganske robust; fullstendig fiasko skyldes sannsynligvis feil håndtering av RNA eller teknisk feil (for eksempel en manglende reagens). Stor forsiktighet bør utvises ved håndtering av RNA prøver mellom utvinning og RT skritt for å redusere RNA degradering fra ribonucleases.

Poliovirus inngang fra bakke og reagenskvalitet farvann og muse norovirus inngang fra grunnvann møtte EPA Method 1615 ytelse akseptkriterier (tabell 11), og er lik de som er rapportert av andre 33,37,38. Murine Norovirus inngang fra LFB prøvene var mye lavere enn de av poliovirus, og ville ikke ha oppfylt poliovirus spesifikke akseptkriterier. Årsakene til lavere muse norovirus utvinning fra reagenskvalitet vannet er ukjent. I likhet med resultatene heri, Karim og colleagues rapporterte en bedring for norovirus GI.1 på 4% fra springvann 39. Lee et al. 37 rapporterte gjennomsnitts inngang for murine norovirus og menneskelig norovirus GII.4 på 18% og 26% fra destillert vann ved hjelp av skivefiltre, henholdsvis. Med lignende forhold til Lee og kolleger, Kim og Ko observert inngang på 46% og 43% for disse virusene, henholdsvis 38. Gibbons et al., 40 oppnås omkring 100% utbytte av human norovirus GII.4 fra sjøvann, men Kim og Ko 38 funnet at tilsetning av salt til destillert vann ved konsentrasjoner tilsvarende eller høyere enn sjøvann betydelig redusert inngang på den murine virus og resulterte i omtrent et to-gangers reduksjon i GII.4 utvinning.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics