EPA Metod 1615 Mätning av Enterovirus och Norovirus förekomst i vatten efter kultur och RT-qPCR. Del III. Virus Detection med RT-qPCR

1National Exposure Research Laboratory, U.S. Environmental Protection Agency, 2Technical Services Center, Office of Ground Water and Drinking Water, U.S. Environmental Protection Agency
Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Kvantitativ PCR (qPCR, se kompletterande material för definitioner av begrepp som används i detta manuskript) och omvänd transkription-qPCR (RT-qPCR) är värdefulla verktyg för att detektera och kvantifiera mänskliga enter virus i miljö- och dricka vatten, och särskilt för många virus som gör inte replikera eller replikeras dåligt i cellodlingssystem. Båda verktygen har visat att många virustyper finns i miljö- och dricka vatten i hela världen 1-6. Deras användning i kombination med sekvensering av amplifierade genomiska fragment under utredningar sjukdomsutbrott har lagt fram bevis för vattenburna virusöverföring, eftersom de har visat att viruset finns i dricksvattnet är identisk med den som skjul vid utbrott patienter 7-10.

Både qPCR och RT-qPCR är användbara folkhälsoverktyg. Till exempel, data från studier som utförts av US Environmental Protection Agency (EPA) visade en stark relation varalan indikatormätningar av qPCR och hälsoeffekter i rekreationsvatten. Som ett resultat, EPA: s slutliga 2012 rekreationsvattensystem kvalitetskriterier inkluderar ett qPCR förfarande för övervakning rekreations stränder 11,12. Borchardt och hans kollegor fann också ett starkt samband mellan akut gastroenterit i samhällen som använder obehandlad grundvatten och virus i grundvatten mätt med RT-qPCR 1.

Syftet med detta dokument är att beskriva den molekylära analyskomponent av EPA Method 1615 13,14. Denna analys använder RT-qPCR att ge en kvantitativ uppskattning av enterovirus och norovirus genom kopior (GC) per liter baserad på den ursprungliga volymen av miljö eller dricksvatten passera genom en elektrofilter. En översikt av den molekylära förfarande visas i figur 1. Protokoll avsnitt 1 detaljer de förfaranden för framställning av standardkurvan. Dessa standarder framställs från ett reagens som innehåller ett RNEn kopia av målsekvensen för samtliga primer / probuppsättningar. I avsnitt 2 beskrivs förfarandet tertiära koncentrationen. Avsnitt 3 ger förfarandet för att extrahera RNA från de koncentrerade vatten- och kontrollprover. RNA från varje prov omvänt transkriberas med hjälp av trippelanalyser och slumpprimers till prime transkriptionen (avsnitt 4). CDNA från varje omvänd transkriptionsreaktion är uppdelad i fem olika virusspecifika analyser som analyseras i tre exemplar av qPCR (§ 5, figur 2). Analysen använder primers och prober från den vetenskapliga litteraturen (Tabell 1) som är utformade för att upptäcka många enterovirus och norovirus och ett reagens innehållande hepatit G-RNA för att identifiera prov som är hämmande för RT-qPCR 15.

Protocol

Obs: Använd datablad för att spåra alla steg i protokollet; exempel datablad ges i kompletterande material Tabeller S2-S4.

1. Standardkurva Förberedelse

  1. Förbered en fungerande lager av standardkurvan reagens (t.ex. Armored RNA EPA-1615) genom att späda det till följd av koncentrationen från tillverkaren till en koncentration av 2,5 x 10 8 partiklar / ml (2,5 x 10 8 GC / ml) med hjälp av TSM III-buffert. Dela upp arbets lager i 250 | il alikvoter med användning av 1,5 ml mikrocentrifugrör och förvara vid -20 ° C.
    OBS: Se kompletterande material protokoll Steg S1 för instruktioner om de förbereder arbets lager av virus och plasmider för användning som alternativa standardkurva reagens.
  2. Tina en eller flera av de arbetande lager portioner. Bered fem 10-faldiga serieutspädningar med användning av 1,5 ml mikrocentrifugrör, vilket ger koncentrationer av 2,5 x 10 7, 2,5 x 10 6, 2,5 x10 5, 2,5 x 10 4, och 2,5 x 10 3 GC / ml.
    1. Förbered första utspädningen genom att tillsätta 25 pl av 2,5 x 10 8 GC / ml arbets lager till 225 il TSM III buffert. Blanda i 5-15 sekunder med en vortexblandare.
    2. Förbered nästa utspädningen genom att tillsätta 25 ul av utspädnings framställd i steg 1.2.1 till 225 il TSM III buffert. Blanda igen och fortsätter en liknande process för att framställa de nästa tre 10-faldiga utspädningar.
  3. Utdrag RNA från standardkurvan arbets lager och de fem utspädningar omedelbart med hjälp av förfarandet i avsnitt 3.

2. Tertiär Koncentration

  1. Förbered en centrifugalkoncentrator (30 tusen molekylviktsgräns) för varje prov uppsamlades genom tillsats av åtminstone 10 ml 1 x PBS, 0,2% bovint serumalbumin (BSA) till den övre provkammaren. Försäkra dig om att lösningen har fyllt den tunna kanalen koncentrationskammare, och sedan hålla O / N vid 4 ° C.
  2. Lägg till ett belopp av sekundär vatten koncentrat från varje prov som är lika med S, analysprovet Volym i separata centrifuganrikningstest.
    1. Beräkna S användning av ekvation 1,
      Ekvation 1
      Där D är volymen av original vattenprov analyseras, är TSV den totala provvolymen och FCSV är finalen Koncentrerad Provvolym. Se kompletterande material S2 ett exempel på beräkning av S.
  3. Centrifugera varje testprov vid 3,000-6,000 xg vid 4 ° C i en svängande hink rotor under 20 - 30 minuter. Kontrollera volymen i den tunna kanalen koncentrationen kammaren.
    1. Om volymen är större än 400 | j, l, centrifugera igen under 20 min eller längre. Fortsätt centrifugering tills provet i the tunn kanal koncentrationskammare har minskat till mindre än 400 l. Ta inte bort supernatanten.
  4. Tvätta sidorna av centrifugalkoncentrator med 1 ml steril 0,15 M natriumfosfat, pH 7-7,5 för att öka virusutvinning. Centrifugera igen vid 3,000-6,000 xg och 4 ° C tills provet har minskat till mindre än 400 l. Upprepa detta tvättsteg en ytterligare tid.
  5. Med hjälp av en 100 till 200 | j, l mikropipett, noggrant mäta och överföra varje koncentrerade provet till en 1,5 ml mikrocentrifugrör (dvs överför 200 pl till mikrocentrifugrör och sedan mäta den kvarvarande koncentratet genom att justera mikropipett tills den återstående vätskan kan helt upprättas in i pipetteringsspetsen). Lägg 0,15 M natriumfosfat, pH 7-7,5, för att justera den slutliga volymen till 400 ± 2 pl.
  6. Utdrag nukleinsyra omedelbart vidare till steg 3. Håll alla koncentrerade prover som inte kan processed omedelbart vid 4 ° C under högst 24 timmar.

3. nukleinsyraisolering

  1. Tillsätt 200 | il extraktionsbuffert framställd såsom beskrivits i steg 3.3 och 200 pl av den tertiära koncentrat från varje testprov från steg 2,5 eller standardkurva utspädning från steg 1,3 för att separera märkt 1,5 ml mikrocentrifugrör. Freeze återstående tertiära koncentrat vid eller under -70 ° C. Extrahera nukleinsyrorna från varje prov i enlighet med den nukleinsyra Extraction Kit tillverkarens instruktioner för centrifugeringsprotokoll för blodprover med följande undantag.
  2. Lägg inte till proteas till vattenproven eller använd extraktionsbufferten levereras med nukleinsyran Extraction Kit.
  3. Förbered extraktionsbuffert med bärar-RNA
    1. Lägg 310 il bärare RNA utspädningsbuffert till en flaska innehållande 310 mikrogram bärare RNA. Blanda för att lösa och sedan dela in 6 portioner innehållande cirka 50 pl. Förvara vid -20° C.
    2. Lägg 28 | il av den upptinade bärar-RNA per ml av extraktionsbuffert för att erhålla en bärare RNA-koncentration av 0,027 ug / ul. Använd transportören RNA-ändrade extraktionsbuffert i stället för som levereras med utvinning kit.
  4. Bered en masterlösning av elueringsbuffert genom tillsats ribonukleas (RNas) Inhibitor till en slutlig koncentration av 400 enheter / ml till elueringsbufferten medföljer Extraction Kit.
    1. Eluera RNA från den nukleinsyrabindande spinnkolonn genom att 50 | il elueringsbuffert med RNas-inhibitor i kolonnen. Vänta 1 min och centrifugera sedan vid 6000 xg under 1 min vid rumstemperatur.
    2. Upprepa steg 3.4.1 och sedan ta bort och kasta kolonnen.
  5. Förbered alikvoter av RNA-extrakt från steg 3.4.2. Förbered 6 alikvoter av standardkurvan arbets lager och varje standardkurva utspädning innehållande minst 15 | j, l vardera. Förbered 4 alikvoter av alla andra RNA-prover som innehåller minst22 pl vardera. Lagra en alikvot av varje kontroller prov- och standardkurva vid 4 ° C, om de kan bearbetas genom omvänd transkription inom 4 h; annars lagra alla alikvoter vid eller under -70 ° C.

4. Omvänd transkription (RT)

  1. Bered 100 pM stamlösningar av varje oligonukleotidprimer och sond listade i tabell 1 genom tillsats av en volym av PCR-kvalitet vatten till varje flaska med användning av en mängd (i mikroliter) som är lika med tio gånger antalet nanomol (nmol) av oligonukleotid som är närvarande i injektionsflaska (som visas på flaskans etikett eller i tillverkarens specifikationer blad (t.ex. resuspendera en primer innehållande 36,3 nmol i 363 pl). Blanda för att lösa.
    1. Späd 100 iM lösningar 1:10 med PCR-kvalitet vatten för att framställa 10 iM fungerande lösningar.
  2. Förbered RT Master Mix 1 och 2 i ett renrum med hjälp av guiden i tabell 2. Pipett 16,5 il RT Master Blanda 1 till varje PCR platta brunn med en flerkanalspipett.
  3. Tö, om de är frysta, nukleinsyra-extrakt från varje prov fält och Lab Berikade provmatris (LFSM, dvs, ympades vattenmatrisprov).
    1. Späd ut varje fält och LFSM prov 1: 5 och 1:25 i elueringsbuffert innehållande 400 enheter / ml RNas-inhibitor.
    2. Tina, om de är frysta, men inte försvaga Lab Fortified Blank (LFB, dvs en positiv kvalitetskontroll med hjälp av seedade reagenskvalitet vatten), Lab reagens Blank (LRB, dvs en negativ kvalitetskontroll med hjälp av reagenskvalitet vatten), Performance Evaluation (PE , det vill säga, seedade reagenskvalitet vattenprov används för att utvärdera laboratorieprestanda före starten av en studie), Performance Test (PT, dvs seedade reagenskvalitet vattenprover med titer okända för en analytiker som används för att utvärdera laboratorie prestanda under en studie ), NA Batch negativ utvinning kontroll, eller extraheras RNA från standardkurvan set.
    3. Placera 6,7 ^ il av RNA från varje testprov, kontroll, och standardkurva i separata PCR-plattbrunnar, med användning av tre brunnar för testproverna och kontrollerna och dubbla brunnar för standardkurvor (se Figur S1 för en RT platta exempel).
      1. Placera 6,7 ​​il elueringsbuffert i separata PCR-plattbrunnar för kontrollerna utan strängar (NTC). Inkludera 2-8 NTC per RT platta, med två för det första provet och sedan två mer för var fjärde ytterligare prov.
      2. Fördela negativa utvinning och NTC kontroller hela plattan.
    4. Täta PCR-plattan med en värmetålig plattförslutning. Blanda prover för 5-10 sekunder och centrifugera sedan vid ≥ 500 xg kort.
    5. Inkubera plattan under 4 min vid 99 ° C och sedan kylas snabbt till 4 ° C i en termocykelapparat. Centrifugera igen på ≥ 500 xg kort.
    6. Försiktigt bort plattan tätningen och sedan lägga 16,8 il RT Master Mix 2 till varje brunn. Seal plattan igen med en värmebeständig plattförslutning, följt av blandning och en kort centrifugering vid ≥ 500 X g.
    7. Placera plattan i en termocykelapparat och kördes under 15 min vid 25 ° C, följt av 60 min vid 42 ° C, 5 min vid 99 ° C och därefter genom en 4 ° C hållcykeln.
    8. Process omedelbart eller inom 8 tim med qPCR (steg 5), eller förvara prover vid eller under -70 ° C tills de kan behandlas. Förvara proverna som kan bearbetas inom 8 timmar vid 4 ° C.

    5. Realtids Kvantitativ PCR (qPCR)

    1. Bestäm medelvärdet hepatit G Cq värde för varje parti av hepatit G reagens innan du kör några testprover.
      1. Kör en RT-analys med hjälp av 10 replikat framställda såsom beskrivits för NTC kontroller (steg 4.1.1). Kör hepatit G qPCR analys som beskrivs nedan (steg 5,2 till 5.5.3). Beräkna medelvärdet Cq värdet av de 10 replik.
      2. Justera hepatit G reagensmängd i RT Master Mix 1 (tabell 2), Om nödvändigt, för att erhålla ett medelvärde Cq värde mellan 25 och 32 enheter. Kompensera beloppet höjas eller sänkas genom att ändra volymen vatten tillsätts för att hålla RT Master Mix 1 slutlig volym på 16,5 pl per analys.
      3. Bekräfta eventuella justeringar genom att upprepa steg 5.1.1 till 5.1.2 och förändring Tabell 2 för att återspegla de justerade kvantiteter.
    2. Förbered qPCR huvudmixarna i ett renrum med hjälp av guiderna i tabell 3 för enterovirus, tabell 4 och tabell 5 för norovirus genogroup I tabell 6 för norovirus genogroup II, tabell 7 för mus norovirus (norovirus genogroup V), och tabell 8 för hepatit G. Mix varje Master Mix och centrifugera sedan vid ≥ 500 xg kort.
    3. Lägg PCR huvudmixarna till lämpliga brunnar i en märkt optisk reaktionsplatta, med hjälp av 14 pl per brunn och separata plattor för varje qPCR analys (se figur S2 figur S1).
    4. Tina RT plattan från steg 4,8 vid RT, om de är frysta. Blanda med hjälp av en plattblandare och centrifugera sedan vid ≥ 500 xg kort.
    5. Fördela 6 pl av den lämpliga cDNA till lämpliga brunnar i den optiska reaktionsplattan. Blanda proverna i den optiska reaktionsplattan och centrifugera vid ≥ 500 xg kort.
      1. Kör hepatit G qPCR analys på den outspädda och utspädda fält och LFSM prover innan du kör alla andra qPCR analyser. Använd lägsta utspädning av fält eller LFSM prov som är <1 Cq värde som är större än den genomsnittliga hepatit G Cq värde för tero och norovirus qPCR analyser.
      2. Ställ in kvantitativ PCR termocyklern programvaran enligt tillverkarens instruktioner. Identifiera standardkurvan prover som standard och för varje standardkurva utspädning anger iska kopierings värden som visas i tabell 9.
    6. Avgöra om varje standardkurva uppfyller de acceptabla värden som anges i tabell 10. Se kompletterande material under rubrik S3 för exempel.
      1. Beräkna den totala standardavvikelsen (stdDev) för standardkurvan med användning av ekvation 2,
        Ekvation 2
        där Cq är det värde som redovisas för varje standardkurva replikera, är Cq medelvärdet för varje uppsättning replikat är #Cq det totala antalet Cq värden för alla standardstyrreplik som har positiva värden (dvs inte obestämd), och # stds är antalet standardkontroller som har positiva värden.
      2. Om kvantitativa PCR termocykler programmet inte beräkna lutningen för varje standardkurva, beräkna lutningen med hjälp av ekvation 3,60;
        Ekvation 3
        där Cq är medelvärdet av de högsta och lägsta utspädningar som används och logga GC är logaritmen för genomisk kopia värdet för de högsta och lägsta utspädningar som används i tabell 9.
      3. Beräkna värdet R2 med hjälp av ekvation 4.
        Ekvation 4
        där Cq är medelvärdet av alla Cq värden och Log GC är medelvärdet logg GC värde för varje replikat.
      4. Beräkna% effektivitet med hjälp av ekvation 5:
        Ekvation 5
    7. Registrera GC värden som räknats fram termocyklern programvara för alla testprover baserade på standardkurvor som uppfyller de kriterier som anges i tabell 10 och medel GC värdena för varje prov. Köra alla prover med standardkurvor som inte uppfyller kriterierna i
    8. Bestäm GC per liter (GC L) för varje testprov genom att använda ekvation 6:
      Ekvation 6
      där GC är den genomsnittliga genom kopietal från steg 5,7, är den faktor "199" den totala utspädningsfaktorn för volymminskningar som inträffar under den tertiära koncentrationen, är utspädningsfaktorn som kompenserar för hämnings RNA-extraktion och RT-qPCR steg DF och D är volymen av original vattenprov analyserade i liter. Se kompletterande material under rubrik S4 för ett exempel på beräkning av GC L.
    9. Beräkna den totala GC av LFB och LRB prov genom att multiplicera den genomsnittliga GC värdet från steg 5,5 med 199 och dividera med 0,3.

Representative Results

Total återvinnings viruset bestämdes med användning av parade fält och LFSM marken vattenprov. Totalt sju provuppsättningar analyserades med hjälp av två uppsättningar som samlats vid olika tillfällen från tre allmänna reningsverk, och en provuppsättning som samlats in från egen brunn. Seed nivåer för LFSM proverna var 3 x 10 6 MPN av Sabin poliovirus serotyp 3 och 5 x 10 6 PFU av murin norovirus. Murin norovirus användes som ett surrogat i metoden utvärdering på grund av bristen på mänskliga noroviruslager med ett virus koncentration som är tillräcklig för LFSM prover. För grundvattenprover medelvärdet polio återhämtningen var 20%, med ett standardfel på 2%, 14 medan menar murina norovirus återhämtning var 30%, med ett standardfel på 3% (Figur 3). Den regelbundna prov fältet grundvatten för varje LFSM hade ingen påvisbar enterovirus eller norovirus.

LFB och LRB prover mättes med hjälp av seedade och oympade reagenskvalitet water. Alla LRB proverna var negativa (data visas ej). Poliovirus återhämtning genomsnitt 44% med ett standardfel på en% (figur 3), medan murina norovirus återhämtning genomsnitt 4% med ett standardfel på 0,5%.

RT-qPCR kräver användning av adekvata standardkurva reagens. Figur 4 visar en typisk standardkurva för enterovirus och norovirus GII. Norovirus GII kurvan uppfyller standardkurvan prestationskriterier (tabell 10) med ett värde R2 av 0,9987, en övergripande standardavvikelse 0,14 och 101% effektivitet. Norovirus GIA och GIB kurvor (ej visade) är nästan identisk med den för norovirus GII. Den enterovirus Kurvan uppfyller kriterierna metod prestanda med ett värde R2 av 0,9874, en övergripande standardavvikelse på 0,58 och 103% effektivitet, men har ett hundratal gånger mindre känslighet och därmed en högre detektionsgräns än norovirus kurvor.


Figur 1. Översikt över Molecular ordningen. Den molekylära förfarande innehåller ytterligare provkoncentration än den som utförs för att mäta smittsamt virus, extraktion av nukleinsyror, en två-steg omvänd transkription (RT) protokoll och kvantitativ PCR (qPCR). Utgångsvolymen (S) representerar en metod definierad andel av den ursprungliga vattenprov.

Figur 2
Figur 2. RT-qPCR översikt schema. Varje extraherat prov RNA transkriberades omvänt med användning av tredubbla analyser (RT1, RT2 och RT3). CDNA från var och en av de tredubbla RT-analyser därefter analyseras för specifika virus som använder separat enterovirus (EV-PCR), norovirus genogroup I (NOV GIA PCR och NOV GIB-PCR), norovirus genogroup II (Nov GII PCR) och hepatit G (HGV-PCR) analyser.

Figur 3
Figur 3. Genomsnittlig Poliovirus och Murine Norovirus Recovery (%) från Ground och reagenskvalitet vatten. Den genomsnittliga procentuella återhämtningen visas för poliovirus från marken ( Figur 3-1 ; n = 7) och från reagenskvalitet ( Figur 3-2 ; n = 12) vatten och för murin norovirus från jord ( Figur 3-3 ; n = 7) och från reagenskvalitet ( Figur 3-4 ; n = 12) vatten (1), där "n" är antalet separata vattenprover bearbetade. Felstaplar representerar standardfelet.

Figur 4 Figur 4. Enterovirus och Norovirus GII standardkurva. Typiska standardkurvor för enterovirus och norovirus GII visas. Formlerna ger lutning och R 2 värden för varje kurva beräknas av termocyklern.

Kompletterande fil 1. Klicka här för att ladda ned den här filen.

Virus Grupp Primer / Sond namn (1) Sekvens (2) Hänvisa till
Enterovirus
EntF (EV-L) 20
Entr (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-prob) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Hepatit G
HepF (5'-NCR framåtprimer) CGGCCAAAAGGTGGTGGATG 19
HepR (5'-NCR omvänd primer) CGACGAGCCTGACGTCGGG 19
Hepp (hepatit G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tabell 1. Primers och TaqMan Probes för virusdetektion genom RT-qPCR.
(1) Metod 1615 primer och sondnamn är de tre första bokstäverna i virusnamnet sammanfogas till F, R eller P för framåt, bakåt, och sond. Norovirus genogroup betecknas genom tillsats av GI och GII till namnen. De två norovirus GI primeruppsättningar också utmärker använder A och B. primer och sond namn från de primära hänvisas till i moderheses.
(2) Orienteringen av primer och sond-sekvenser är 5 'till 3'. Följande degenererade grundindikatorerna används: N-en blandning av alla fyra nukleotider; R-A + G; Y-T + C; W-A + T; och I-inosin.

Ingrediens Volym per reaktion (il) (2) Slutlig koncentration Volym per Master Mix (il) (3)
RT Master Mix 1
Slumpmässig primem 0,8 10 ng / ul (c. 5,6 M) 84
Hepatit G Armored RNA (4) 1 105
PCR-kvalitet vatten 14,7 1543,5
Tilltal 16,5 1732,5
RT Master Mix 2
10x PCR-buffert II 4 10 mM Tris, pH 8,3, 50 mM KCl 420
25-mM MgCl2 4,8 3 mM 504
10-mM dNTP 3,2 0,8 mM 336
100-mM DTT 4 10 mM 420
RNas-inhibitor 0,5 0,5 enheter / ^ il 52,5
Superscript II RT 0,3 1,6 enheter / ^ il 31,5
Total 16,8 1764

Tabell 2. RT Master Mix 1 och 2 (1).
(1) Förbered RT Mästare Mixes i en clean rum, det vill säga, ett rum där molekylära och mikrobiologiska förfaranden inte utförs.
(2) Den slutliga RT-analysvolymen är 40-il.
(3) Volymerna visar bygger på 105 analyser. Detta är tillräckligt för en 96-håls PCR-platta med de extra analyserna läggas till svars för förluster. Beloppet kan skalas upp eller ner beroende på antalet prover och kontroller som ska analyseras.
(4) Bestäm mängden hepatit G-reagens för att inkludera i RT Master Mix 1 såsom beskrivits i kompletterande material steg S4.

Ingrediens Volym per reaktion (il) (2) Slutlig koncentration Volym per Master Mix (il) (3)
2x LightCycler 480 Sönder Master Mix 10 Proprietary 1050
ROX referensfärgämne (4) 0,4 0,5 mM 42
PCR-kvalitet vatten 1 105
10 pM EntF 0,6 300 nM 63
10 pM Entr 1,8 900 nM 189
10 pM ENTP 0,2 100 nM 21
Total 14 1470

Tabell 3. PCR Master Mix för Enterovirus (EV) analys (1).
(1) Förbered alla PCR master Mixes i ett renrum.
(2) Den slutliga qPCR analysvolymen är 20 l.
(3) Volymerna visar bygger på 105 analyser. Detta är tillräckligt för en 96-håls PCR-platta med de extra analyserna läggas till svars för förluster. Beloppet kan skalas upp eller ner beroende på antalet prover och kontroller som kommeranalyseras.
(4) Suppleant PCR-kvalitet vatten för denna reagens när du använder instrument som inte kräver det.

Ingrediens Volym per reaktion (il) (2) Slutlig koncentration Volym per Master Mix (il) (3)
2x LightCycler 480 Sönder Master Mix 10 Proprietary 1050
ROX referens färgämne (4) 0,4 0,5 mM 42
PCR-kvalitet vatten 1,4 147
10 pM NorGIAF 1 500 nM 105
10 pM NorGIAR 1 500 nM 105
10 pM NorGIAP 0,2 100 nM 21
Total 14 1470

Tabell 4. PCR Master Mix för Norovirus GIA (NOV GIA) analys (1).
Se tabell 3 för fotnoter (1) - (4).

Ingrediens Volym per reaktion (il) (2) Slutlig koncentration Volym per Master Mix (il) (3)
2x LightCycler 480 Sönder Master Mix 10 Proprietary 1050
ROX referens färgämne (4) 0,4 0,5 mM 42
PCR-kvalitet vatten 0,3 31,5
10 pM NorGIBF 1 500 nM 105
10 pM NorGIBR 1,8 900 nM 189
10 pM NorGIBP 0,5 250 nM 52,5
Total 14 1470

Tabell 5. PCR Master Mix för Norovirus GIB (NOV GIB) analys (1).
Se tabell 3 för fotnoter (1) - (4).

<td> 0,5 mM
Ingrediens Volym per reaktion (il) (2) Slutlig koncentration Volym per Master Mix (il) (3)
2x LightCycler 480 Sönder Master Mix 10 Proprietary 1050
ROX referens färgämne (4) 0,4 42
PCR-kvalitet vatten 0,3 31,5
10 pM NorGIIF 1 500 nM 105
10 pM NorGIIR 1,8 900 nM 189
10 pM NorGIIP 0,5 250 nM 52,5
Total 14 1470

Tabell 6. PCR Master Mix för Norovirus GII (NOV GII) analys (1).
Se tabell 3 för fotnoter (1) - (4).

Ingrediens Volym per reaktion (il) (2) Slutlig koncentration Volym per Master Mix (il) (3)
2x LightCycler 480 Sönder Master Mix 10 Proprietary 1050
ROX referens färgämne (4) 0,4 0,5 mM 42
PCR-kvalitet vatten 0,3 31,5
10 iM MuNoVF1 1 500 nM 105
10 pM MuNoVR1 1,8 900 nM 189
10 iM MuNoVP1 0,5 250 nM 52,5
Total 14 1470

Tabell 7. PCR Master Mix för Murine Norovirus analys (1).
Se tabell 3 för fotnoter (1) - (4).

Ingrediens Volymper reaktion (| il) (2) Slutlig koncentration Volym per Master Mix (il) (3)
2x LightCycler 480 Sönder Master Mix 10 Proprietary 1050
ROX referens färgämne (4) 0,4 0,5 mM 42
PCR-kvalitet vatten 1,4 147
10 pM HepF 1 500 nM 105
10 pM HepR 1 500 nM 105
10 pM Hepp 0,2 100 nM 21
Total 14 1470

Tabell 8. PCR Master Mix för hepatit G (HGV) analys (1).
Se

Standardkurva Koncentration Iska kopior per RT-qPCR analys (1, 2)
2,5 X 10 8 502.500
2,5 x 10 7 50.250
2,5 x 10 6 5025
2,5 x 10 5 502,5
2,5 x 10 4 50,25
2,5 x 10 3 5,025

Tabell 9. Standardkurva Iska kopior.
(1) Identifiera standardkurvan brunnarna som standarder och placera iska kopior per RT-qPCR analysvärden på lämplig plats i termo programvaran.
(2) En acceptabel standardkurva kommer att ha en verkningsgrad på 70% -110%, Värde en R2> 0,97, och en övergripande standardavvikelse <0,5 för norovirus och <1,0 för enterovirus.

Kriterier Acceptabelt värde
Norovirus Enterovirus
Övergripande Standardavvikelse <0,5 <1,0
R 2 > 0,97 > 0,97
Effektivitet 70% till 115% 70% till 115%

Tabell 10. Standardkurva Acceptanskriterier (1).
(1) Standardkurvor med% Efficiencies 70% -110% är acceptabla, men värdena i 90% -115% intervall är idealiska. Värden som är mindre än 90% kan tyda på pipettering eller utspädning fel.

QA Komponent Genomsnittlig Recovery Range (%) Variationskoefficient (%)
Lab Reagens Blank; negativa PT eller PE prover 0 N / A (1)
Lab Berikade Blank; Lab spetsat prov Matrix 5-200 N / A
Positiv PT och PE prover 15-175 ≤130

Tabell 11. Metod 1615 prestandakriterier.
(1) Ej tillämpligt.

Media Sammansättning
0,15 M natriumfosfat, pH 7,0 till 7,5 Förbered 0,15 M natriumfosfat genom upplösning 40,2 g natriumfosfat, dibasiskt (Na 2 HPO 4 · 7 H2O) i en slutlig volym av 1 L dH
5% BSA Förbered genom att lösa 5 g av BSA i 100 ml dH2O Sterilisera genom att passera lösningen genom ett 0,2-im steriliseringsfilter.
PBS, 0,2% BSA Tillsätt 4 ml av 5% BSA till 96 ml PBS. Sterilisera genom att passera lösningen genom ett 0,2-im steriliseringsfilter.
TSM III buffert Lös 1,21 g Trisma-bas, 5,84 g NaCl, 0,203 g MgCl2, 1 ml Prionex gelatin och 3 ml Microcide III i 950 ml reagenskvalitet vatten. Justera pH till 7,0 och sedan bringa den slutliga volymen till 1 L. Sterilisera genom att lösningen genom ett 0,2-im steriliseringsfilter.
0,525% natriumhypoklorit (NaClO) Förbered en 0,525% NaClO lösning genom att späda blekmedel 1:10 i dH2O Lagra 0,525% NaClO lösningar för upp till 1 vecka vid rumstemperatur.
1-M natriumtiosulfat (Na 2 S 2 O 3) pentahydrat Bered en 1 M lösning genom upplösning av 248,2 g Na2S 2 O 3 i 1 L av dH2O Butiks natriumtiosulfat i upp till 6 månader vid RT.

Tabell 12. Tabell Media.

Discussion

Storskaliga nationella studier av viral kontamination av källa och dricka vatten kräver användning av flera analyslaboratorier. Under dessa betingelser krävs en standardmetod för att säkerställa att de data som genereras av de multipla laboratorierna är jämförbara. Det finns många publicerade molekylära metoder för virusdetektion, men väldigt få standardiserade molekylära metoder. EPA Metod 1615 är en standardiserad metod särskilt utformad för detektering av enterovirus och norovirus i vatten matriser med RT-qPCR. Standardiserade molekylära metoder finns tillgängliga för virusdetektion i livsmedel (CEN / ISO TS 15216-1 och CEN / ISO TS 15216-2, April 7, 2013) 16,17 och har använts för detektion av hepatit A-virus och norovirus på våren vatten 16. Alla standardmetoder måste innehålla kvalitet Prestandakontroller och kriterier för att minimera inter- och intra-laboratoriet variation och falska positiva data på grund av laboratoriekontaminering. För att ytterligare minska felaktiga uppgifter, EPA Metod 1615 följer EPA: s riktlinjer om molekylära metoder, 18 som föreskriver separation av arbete under bearbetning och ett sätt arbetsflödet. Den innehåller en hepatit G 1,19 intern kontroll och rutiner för att minimera falska negativa resultat på grund av hämmare av RT-qPCR 15. Den använder kvantitativa analyser tillsammans med standardiserade volymer av både vatten samplas och vatten analyseras, så att alla datafältet uttrycks i genomiska kopior per liter av fältet eller dricksvatten samplas. Även om effektiv enda rör (en-steg) RT-PCR-analyser är kommersiellt tillgängliga, använder förfarandet avsikt separata analyser. Detta har nackdelen att minimera mängden prov som kan analyseras i varje reaktion, men ger större flexibilitet vid användning av multipla primeruppsättningar. RT-qPCR analyser begränsas av och bara så bra som de primers och prober som används och sannolikt ingen primer set kommer att upptäcka alla virusvarianter inom en grupp. Den enterovirus primeruppsättning valdes eftersomden mål den konserverade 5'-icke-kodande regionen, 20,21 detekterar ett stort antal olika enterovirusserotyper, och virus som detekteras av det är associerade med hälsoeffekter från konsumtion av obehandlade grundvatten 1. Två primeruppsättningar används för detektion av genogroup jag norovirus 22,23. Den första valdes på grund av det starka sambandet mellan hälsoeffekter hos små barn och upptäckte virus 1. Den andra genogroup jag primeruppsättningen och primeruppsättningen används för genogroup II norovirus valdes eftersom de upptäcker den bredaste utbud av stammar 24,25.

Trots de stora fördelarna med qPCR och RT-qPCR förfaranden för att detektera viral RNA i vatten, det finns flera begränsningar. Först både infektiösa och icke-infektiösa viruspartiklar, inklusive de som inaktiverats genom desinfektionsmedel, kan amplifieras genom dessa förfaranden. Resultaten från Borchardt tyder på att detta är ett mindre problem för obehandlat grundvatten from akviferer som liknar dem i de samhällen studerade än desinficerade ytvatten 1. För odlingsbara virus detta problem kan övervinnas genom användning av PCR i kombination med kultur 26,27. Problemet har också behandlats för vissa virus genom användning av nukleinsyra-tvärbindningsmedel 28-30. Detta senare tillvägagångssätt är mer effektivt för virus inaktiveras av hypoklorit och inte är effektiva för dem som inaktiveras av UV.

En andra begränsning av dessa molekylära förfaranden är att volymen av koncentrerad prov som kan analyseras typiskt är mycket mindre än den som används för odlingsförfaranden 6,31. Detta problem hanteras ofta av antingen insätta en polyetylenglykol baserad procedur för att de sekundära koncentration genom organisk flockulering, vilket tillåter provet att återsuspenderas i en mindre volym, eller genom tillsats av en tertiär prov koncentreringssteg 6,32,33 . Metod 1615 använder centrifugeUGAL ultrafiltrering för att ge tertiär koncentration. Centrifugal ultrafiltrering tar bort vatten och komponenter mindre än 30.000 Dalton vilket resulterar i både koncentrationen av virus i testprover och en minskning av lågmolekylära hämmare av molekylära analyser. Denna tertiära koncentration steg resulterar i en total koncentrationsfaktor av> 10 5 för alla virus som var närvarande i vattnet som testas.

En tredje begränsning är förekomsten av inhibitorer av molekylära förfaranden inom miljöprover. Trots att många metoder för att ta bort hämmare har utvecklats, finns ingen metod effektiv för alla vatten matriser och virustyper 6,34,35, göra användningen av intern kontroll som syftar till att uppskatta nivån av inhibering viktigt. Hepatit G reagens som används i denna metod uppfyller detta krav genom att tillhandahålla en konstant nivå av viralt RNA i alla reaktioner och en RT-qPCR analys för att uppskatta inhibition. När det bästa av than hämmare borttagning metoder misslyckas med att avlägsna inhibition, prov koncentrat kan spädas så länge viruskoncentrationer är högre än inhibitorkoncentrationer 14,15.

Standardkurvan förfarandet beskrivet häri har både fördelar och en stor begränsning. En fördel är att det reagens som används levererar alla nödvändiga komponenter i ett enda reagens, vilket gör att en enda styr som skall användas för alla analyser. Detta reagens är särskilt en fördel för norovirus analyser. Norovirus partiklar kan endast erhållas från infekterade individer gör det mycket svårt att erhålla viruspartiklar för användning som standarder. En mer viktig fördel är att det ger en RNA standard för alla riktade RNA-virus i ett reagens, såsom att ha en RNA-standarden är nödvändig för noggrann kvantifiering av RNA 36. Emellertid är dess förmåga att kvantifiera virus exakt begränsad av det faktum att matriseffekter inte beaktas. Detta innebär att genomiskt kopiasiffervärden kan inte anses vara absolut och bör endast övervägas i relativa termer. Det rekommenderas att ett tillräckligt antal standardkurva arbetsaktie portioner (steg 1,2) vara beredd att täcka hela studier. Till exempel, ger varje 250 ul alikvot tillräckligt med reagens för 6 RT-plattor. Om det är känt att en studie kommer att kräva analys av 500 prover skulle behövas minst 12 portioner (500 prover / 7 prover per RT platta / 6 RT plattor per portion).

EPA Metod 1615 är ett prestationsbaserat metod. Många tillverkare gör motsvarande reagens som anges häri och dessa reagens kan ersättas så länge prestationskriterier uppfylls. Standardkurvan, som även fungerar som ett positivt RT-qPCR kontroll, är av värde vid felsökning prestandaproblem. Prestanda kan minska på grund av nedbrytning av RNA, reagens hållbarhetstid, fel i frysar, instrumentkalibrering och tekniskt fel. Prestandaproblem bör vara misstänkted om standardkurvor skiljer sig från den som visas i figur 4 eller om de inte uppfyller prestanda specifikation för standardkurvor. RT-qPCR analysen är ganska robust, fullständigt misslyckande är sannolikt på grund av felaktig hantering av RNA eller tekniskt fel (t.ex. en saknad reagens). Stor försiktighet bör iakttas vid hantering RNA-prover mellan extraktion och RT steg för att minska RNA nedbrytning från ribonukleaser.

Poliovirus återvinningar från marken och reagenskvalitet vatten och murina norovirus återvinningar från grundvatten träffade EPA Method 1615 kriterier prestanda acceptans (tabell 11) och liknar de som rapporterats av andra 33,37,38. Murina norovirusåtervinningar från LFB prover var mycket lägre än för poliovirus och skulle inte ha uppfyllt acceptanskriterier poliovirus specifika. Orsakerna till lägre mus norovirus återhämtning från reagenskvalitet vatten är okända. I likhet med resultaten häri, Karim och colleaGues rapporterade en återhämtning för norovirus GI.1 på 4% från kranvatten 39. Lee et al. 37 rapporterade genomsnittliga utbyten för murin norovirus och humant norovirus GII.4 av 18% och 26% från destillerat vatten med användning skivfilter, respektive. Med användning av liknande villkor för Lee och kollegor, Kim och Ko observerade återvinningar av 46% och 43% för dessa virus, respektive 38. Gibbons et al. 40 erhållas omkring 100% återvinning av mänsklig norovirus GII.4 från havsvatten, men Kim och Ko 38 tyckte att tillsatsen av salt till destillerat vatten vid koncentrationer liknande eller högre än havsvatten betydligt minskade återvinningar av det murina virus och result i ungefär en två-faldig reduktion av GII.4 återhämtning.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics