EPA Método 1615. Medição de Enterovirus e Norovirus Ocorrência na água por cultura e RT-qPCR. Parte III. Detecção de vírus por RT-qPCR

Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

PCR quantitativo (qPCR, ver materiais suplementares para definições dos termos utilizados neste manuscrito) e transcrição reversa-qPCR (RT-qPCR) são ferramentas valiosas para detectar e quantificar vírus entéricos humanos no meio ambiente e beber águas e, especialmente, para muitos vírus que fazer não replicar ou mal replicar em sistemas de cultura de células. Ambas as ferramentas têm demonstrado que muitos tipos de vírus estão presentes em águas ambientais e de consumo em todo o mundo 1-6. A sua utilização juntamente com sequenciamento de fragmentos genómicos amplificados durante investigações de surtos de doença apresentou elementos de prova para a transmissão do vírus por via aquática, como eles têm mostrado que o vírus encontrados na água potável é idêntico ao galpão por pacientes surto 7-10.

Ambos qPCR e RT-qPCR são ferramentas úteis de saúde pública. Por exemplo, os dados dos estudos realizados pela Agência de Proteção Ambiental (EPA) mostraram uma relação forte seras medições dos indicadores tween por qPCR e efeitos na saúde em águas de recreio. Como resultado, finais de 2012 Critérios de Qualidade da Água Recreativa da EPA inclui um método para o monitoramento qPCR praias recreativas 11,12. Borchardt e seus colegas também descobriram uma forte relação entre gastroenterite aguda em comunidades que utilizam águas subterrâneas não tratadas e vírus nas águas subterrâneas como medido por RT-qPCR 1.

O objetivo deste artigo é descrever a componente do ensaio molecular do Método EPA 1615 13,14. Este ensaio utiliza RT-qPCR para fornecer uma estimativa quantitativa de enterovírus e norovírus cópias genómicas (GC) por litro com base no volume original de água potável ou ambiental passada através de um filtro de electropositivo. Uma visão geral do processo molecular é mostrada na Figura 1 seção. Protocol 1 detalha os procedimentos para preparar a curva padrão. Estes padrões são preparados a partir de um reagente que contém um RNUma cópia da sequência alvo para todos os conjuntos iniciador / sonda. A Seção 2 descreve o procedimento concentração terciária. Seção 3 apresenta o método de extracção de ARN a partir de amostras de água e concentrados de controlo. O ARN de cada amostra de teste é transcrito de forma inversa utilizando ensaios em triplicado e iniciadores aleatórios para iniciar a transcrição (Secção 4). O cDNA a partir de cada reacção de transcrição reversa é dividido em cinco ensaios específicos do vírus separadas, que são analisadas em triplicado por qPCR (Secção 5; Figura 2). O ensaio utiliza primers e sondas a partir da literatura científica (Tabela 1) que são concebidos para detectar muitas enterovírus e noroviruses e um reagente contendo hepatite G ARN para identificar amostras de teste que são inibidores de RT-qPCR 15.

Protocol

Nota: folhas de dados usar para acompanhar todas as etapas do protocolo; folhas exemplo de dados são indicadas nas tabelas de materiais suplementares S2-S4.

1. Preparação da curva Padrão

  1. Preparar um estoque de trabalho do reagente de curva padrão (por exemplo, blindado ARN EPA-1615), diluindo-lo a partir da concentração fornecido pelo fabricante para uma concentração de 2,5 x 10 8 partículas / ml (2,5 x 10 8 GC / ml) usando o TSM tampão III. Dividir o estoque de trabalho em 250 mL alíquotas de 1,5 ml utilizando tubos de microcentrífuga e armazenar a -20 ° C.
    NOTA: Ver suplementar protocolo materiais Passo S1 para obter instruções sobre como preparar os stocks de trabalho dos vírus e plasmídeos para uso como reagentes alternativos curva padrão.
  2. Descongelar uma ou mais das alíquotas banco de trabalho. Preparar cinco diluições em série de 10 vezes usando 1,5 ml de tubos de microcentrífuga, dando concentrações de 2,5 x 10 7, 2,5 x 10 6, 2,5 x10 5, 2,5 x 10 4, e 2,5 x 10 3 CG / ml.
    1. Preparar a primeira diluição por adição de 25 ul de 2,5 x 10 a 8 GC / ml de estoque de trabalho de 225 ul de tampão TSM III. Misturar durante 5-15 segundos usando um misturador de vórtice.
    2. Prepara-se o seguinte de diluição por adição de 25 ul de uma diluição preparada no Passo 1.2.1-se 225 ul de tampão TSM III. Misturar novamente e continuar um processo semelhante para preparar os próximos três diluições de 10 vezes.
  3. Extraia o RNA do estoque trabalhando curva padrão e as cinco diluições imediatamente usando o procedimento na Seção 3.

2. Concentração terciária

  1. Preparar um concentrador centrífugo (30.000 corte de peso molecular) para cada uma das amostras colhidas por adição de pelo menos 10 ml de PBS 1x, 0,2% de albumina de soro bovino (BSA) para a câmara de amostra superior. Certifique-se de que a solução encheu o compartimento de concentração canal fina, e então segure O / N a 4 ° C.
  2. Adicionar uma quantidade de concentrado de água secundário a partir de cada amostra de ensaio igual a S, o volume de ensaio de amostra em concentradores centrífugos separados.
    1. Calcular S usando a Equação 1,
      Equação 1
      Onde D é o volume de Original Amostra de Água Analisada, TSV é o volume total da amostra e FCSV é o concentrado de volume amostra final. Ver materiais suplementares S2 para um exemplo do cálculo de S.
  3. Centrifugar cada amostra de teste a 3.000-6.000 x g a 4 ° C num rotor basculante durante 20 - 30 min. Verificar o volume na câmara de canal concentração fina.
    1. Se o volume é maior do que 400 ul, de centrifugação novamente durante 20 min ou mais. Continue a centrifugação até que a amostra em the compartimento de concentração canal fina foi reduzido para menos de 400 ul. Não remova o sobrenadante.
  4. Lavar os lados do concentrador centrífugo com 1 ml de fosfato estéril a 0,15 M, pH 7-7,5 de sódio para aumentar a recuperação do vírus. Centrifugar novamente a 3.000-6.000 x g e 4 ° C até a amostra ter sido reduzido para menos de 400 ul. Repita este passo de lavagem uma vez adicional.
  5. Usando uma micropipeta de 100-200 uL, com cuidado medir e transferir cada amostra concentrada para um tubo de microcentrífuga de 1,5 ml (isto é, transferir 200 ul ao tubo de microcentrífuga e depois medir o concentrado restante ajustando a micropipeta até que o líquido remanescente pode ser completamente elaborado na ponta da pipeta). Adicionar fosfato de sódio 0,15 M, pH 7-7,5, para ajustar o volume final para 400 ± 2 ul.
  6. Extracto de ácido nucleico imediatamente por prosseguir para a etapa 3. Manter as amostras concentradas que não pode ser processed imediatamente a 4 ° C durante não mais do que 24 horas.

Isolamento 3. Ácido Nucleico

  1. Adicionar 200 ul de tampão de extracção preparado como descrito no passo 3.3 e 200 ul do concentrado terciária de cada amostra de teste a partir do Passo 2.5 ou diluição curva padrão a partir do Passo 1,3 a 1,5 ml separada marcadas tubos de microcentrífuga. Congelar restante concentrados terciárias a ou abaixo de -70 ° C. Extrair os ácidos nucleicos a partir de cada amostra de acordo com as instruções do fabricante do kit de extracção de ácido nucleico de a para o protocolo de centrifugação para amostras de sangue com as seguintes excepções.
  2. Não adicionar protease para as amostras de água ou usar o tampão de extracção fornecido com o kit de extracção de ácido nucleico.
  3. Preparar tampão de extracção de RNA com transportador
    1. Adicionar 310 ul de tampão de diluição de ARN transportador para um frasco contendo 310 ug de ARN transportador. Misture para dissolver e depois dividir em 6 alíquotas contendo cerca de 50 ul. Armazenar a -20° C.
    2. Adicionar 28 ul de ARN transportador descongelado por ml de tampão de extracção para obter uma concentração de ARN transportador de 0,027 ug / uL. Utilizar o tampão de extracção de ARN alterado-transportador no lugar do que fornecido com o kit de extracção.
  4. Prepara-se uma solução de mestre de tampão de eluição por adição de ribonuclease (RNase) inibidor para uma concentração final de 400 unidades / ml para o tampão de eluição fornecido com o kit de extracção.
    1. Eluir o RNA a partir do ácido nucleico de ligação coluna de centrifugação, colocando 50 ul de tampão de eluição com inibidor de RNase para a coluna. Espera durante 1 min, e depois centrifugar a 6.000 xg durante 1 min à temperatura ambiente.
    2. Repita o passo 3.4.1 e, em seguida, remover e descartar a coluna.
  5. Preparar alíquotas dos extractos de ARN a partir do passo 3.4.2. Prepare 6 alíquotas do estoque trabalhando curva padrão e cada diluição curva padrão contendo pelo menos 15 ul cada. Prepare a 4 alíquotas de todas as outras amostras de ARN que contenham pelo menos22 ul cada. Armazenar uma alíquota de cada amostra e controles curva padrão a 4 ° C, se eles podem ser processados ​​por transcrição reversa dentro de 4 horas; de outra forma, todas as alíquotas de armazenar a ou abaixo de -70 ° C.

4. Transcrição Reversa (RT)

  1. Preparar 100 uM soluções de estoque de cada oligonucleótido iniciador e sonda listados na Tabela 1, por adição de um volume de água de PCR-grade para cada frasco utilizando uma quantidade (em microlitros) igual a dez vezes o número de nanomoles (nmol) de oligonucleótido presentes na frasco (como mostrado no rótulo do frasco ou em folha de especificações do fabricante (por exemplo, ressuspender uma cartilha contendo 36,3 nmol em 363 ul). Misture a se dissolver.
    1. Dilui-se a 100 uM soluções 1:10 com água de grau de PCR para preparar soluções de trabalho de 10 uM.
  2. Prepare RT Master Mix 1 e 2 em uma sala limpa, utilizando a guia na Tabela 2. Pipetar 16,5 ul de RT MasteR Mistura 1 para cada placa de PCR poço utilizando uma pipeta multicanal.
  3. Thaw, se forem congelados, os extractos ácidos nucleicos a partir de cada amostra de campo e laboratório Fortificado matriz da amostra (LFSM, ou seja, sem sementes amostra matriz de água).
    1. Diluir cada amostra de campo e LFSM 1: 5 e 1:25 em tampão de eluição contendo 400 unidades / ml de inibidor de RNase.
    2. Thaw, se forem congelados, mas não diluir Lab Fortificado em branco (LFB, ou seja, um controlo positivo qualidade usando reagente de qualidade de água sem sementes), Reagente Lab em branco (LRB, ou seja, um controle de qualidade negativa usando reagente de qualidade da água), Avaliação de Desempenho (PE ; isto é, o reagente semeadas amostras de água grau utilizado para avaliar o desempenho do laboratório antes do início do estudo), Teste de Desempenho (PT; ou seja, as amostras de água de grau reagente semeadas com títulos desconhecidos para um analista que são usados ​​para avaliar o desempenho do laboratório durante um estudo ), NA Batch controle de extração negativo, ou RNA extraído do conjunto curva padrão.
    3. Colocar 6.7 ul do ARN a partir de cada amostra de teste, controlo e curva padrão em poços de placas separadas de PCR, utilizando-se cavidades em triplicado para as amostras de teste e controlos e poços em duplicado para curvas padrão (ver Figura S1 durante um exemplo da placa de RT).
      1. Colocar 6.7 ul de tampão de eluição em poços separados de placas de PCR para os controlos não há molde (NTC). Incluir 2-8 NTC por placa RT, usando dois para a primeira amostra e, em seguida, mais dois para cada quarta amostra adicional.
      2. Distribuir a extracção controlos negativo e NTC em toda a placa.
    4. Selar a placa de PCR com um vedante de placa resistente ao calor. Misture as amostras para 5-10 segundos e, em seguida, centrifugar a ≥ 500 xg brevemente.
    5. Incubar a placa durante 4 min a 99 ° C e, em seguida, arrefecer rapidamente até 4 ° C num termociclador. Centrifugar novamente a ≥ 500 xg brevemente.
    6. Remover cuidadosamente a placa do selo e, em seguida, adicionar 16,8 mL de RT Master Mix 2 a cada poço. Seai novamente a placa com uma placa vedante resistente ao calor, seguida por mistura e uma breve centrifugação a 500 x g ≥.
    7. Colocar a placa num termociclador e correr durante 15 min a 25 ° C, seguido de 60 min a 42 ° C, 5 min a 99 ° C, e em seguida por um ciclo de 4 ° C preensão.
    8. Processo imediatamente ou dentro de 8 horas por qPCR (Etapa 5), ​​ou armazenar amostras a ou abaixo de -70 ° C até que possam ser processados. Armazenar as amostras que podem ser processados ​​dentro de 8 horas a 4 ° C.

    5. Real-time PCR quantitativa (qPCR)

    1. Determinar a média da hepatite G Cq valor para cada lote de reagente G hepatite antes de executar quaisquer amostras de teste.
      1. Executar um ensaio de RT utilizando 10 repetições preparados como descrito para os controlos NTC (Passo 4.1.1). Executar o ensaio da hepatite G qPCR como descrito abaixo (Passos 5.2 a 5.5.3). Calcular o valor médio das Cq 10 repetições.
      2. Ajuste a quantidade de reagente G hepatite em RT Master Mix 1 (Tabela 2), Se necessário, para se obter um valor médio Cq entre 25 e 32 unidades. Compensar a quantidade levantada ou baixada, alterando o volume de água adicionado para manter o volume final de RT Master Mix 1 em 16,5 uL por ensaio.
      3. Confirme os ajustes, repetindo as etapas 5.1.1 a 5.1.2 e mudança Tabela 2 para refletir as quantidades ajustadas.
    2. Prepare qPCR misturas principais em uma sala limpa usando as guias na Tabela 3 para enterovírus, Tabela 4 e Tabela 5 para norovirus genogrupo I, Tabela 6 para norovirus genogrupo II, a Tabela 7 para norovirus murino (norovirus genogrupo V), e Tabela 8 para a hepatite G. Mix cada master mix e, em seguida, centrifugar a ≥ 500 xg brevemente.
    3. Adicionar as misturas principais de PCR para os poços apropriados de uma placa de reacção óptica marcado, utilizando 14 ul por cavidade e as placas separadas para cada ensaio de qPCR (ver Figura S2 na figura S1).
    4. Descongelar a placa de RT do Passo 4.8, à TA, se congelado. Misture usando um misturador de placa e, em seguida, centrifugar a ≥ 500 xg brevemente.
    5. Dispensar 6 ul de ADNc apropriada para os poços apropriados da placa de reacção óptica. Misturar as amostras na placa de reacção óptica e centrifugar a 500 ≥ brevemente xg.
      1. Execute o teste da hepatite G qPCR no campo não diluída e diluída e amostras LFSM antes de executar todos os outros ensaios qPCR. Use o menor diluição de campo ou amostra LFSM que é <1 Cq valor maior do que a média da hepatite G valor Cq para os enterovírus e norovírus ensaios qPCR.
      2. Defina-se a PCR quantitativa termociclador de software de acordo com as instruções do fabricante. Identificar as amostras da curva padrão como padrões e para cada diluição curva padrão, digite os valores de cópias genômicas apresentados na Tabela 9.
    6. Determinar se cada curva padrão atende aos valores aceitáveis ​​dadas na Tabela 10. Consulte a seção materiais suplementares S3 para exemplos.
      1. Calcular o desvio padrão global (Desvio Padrão) para a curva padrão utilizando a Equação 2,
        Equação 2
        onde Cq é o valor relatado para cada curva padrão de repetição, Cq é o valor médio para cada conjunto de réplicas, #Cq é o número total de valores Cq para todos os replicados de controlo de padrão que possuem valores positivos (ou seja, não indeterminada), e # Dst é o número de controlos normais que possuem valores positivos.
      2. Se a PCR quantitativa software termociclador não calcular o declive de cada curva padrão, calcular a inclinação usando a Equação 3,60;
        Equação 3
        onde Cq é o valor médio das diluições maiores e menores usados ​​e log GC é o log do valor cópia genômica para as diluições maiores e menores utilizados a partir da Tabela 9.
      3. Calcule o valor R2 usando a Equação 4.
        Equação 4
        onde Cq representa a média de todos os valores de log Cq e GC é o valor médio Log GC para cada replicado.
      4. Calcule a Eficiência% usando a Equação 5:
        Equação 5
    7. Registre os valores GC calculados pelo software termociclador para todas as amostras de teste com base em curvas padrão que atendem aos critérios especificados na Tabela 10 e os valores médios GC para cada amostra. Execute novamente todas as amostras com curvas padrão que não cumprem os critérios estabelecidos no
    8. Determine o GC por litro (GC L) para cada amostra de teste usando a Equação 6:
      Equação 6
      onde GC é o número de cópia genómica significativo do passo 5.7, o factor '199' é o factor de diluição total para as reduções de volume que ocorrem durante a concentração terciária, a extracção de ARN e as etapas de RT-qPCR, DF é o factor de diluição, que compensa para a inibição e D é o volume da amostra original de água ensaiadas em litros. Ver materiais suplementares seção S4 para um exemplo do cálculo do GC L.
    9. Calcule o GC total de LFB e LRB amostras multiplicando o valor GC média do Passo 5,5 por 199 e dividindo por 0,3.

Representative Results

A recuperação global vírus foi determinada utilizando campo emparelhado e LFSM amostras de água do solo. Um total de sete conjuntos de amostras foram analisadas utilizando dois conjuntos recolhidos em ocasiões separadas a partir de três estações de tratamento públicos e um conjunto de amostras coletadas a partir do poço particular. Os níveis de sementes para as amostras LFSM foram 3 x 10 6 MPN de Sabin poliovírus sorotipo 3 e 5 x 10 6 UFP de norovirus murino. Norovírus de murideo foi utilizada como um substituto para a avaliação método devido a uma falta de existências de norovírus humanos com uma concentração de vírus suficiente para amostras LFSM. Para amostras de água a recuperação média foi 20% poliovírus, com um erro padrão de 2%, enquanto que 14 significa recuperação norovirus murino foi de 30%, com um erro padrão de 3% (Figura 3). A amostra de campo subterrâneas regular para cada LFSM não tinha enterovírus detectável ou norovírus.

LFB amostras e LRB foram medidos usando wat de grau reagente sem sementes e unseededer. Todas as amostras foram LRB negativo (dados não mostrados). Recuperação Poliovírus média de 44% com um erro padrão de 1% (Figura 3), enquanto a recuperação norovirus murino média de 4% com um erro padrão de 0,5%.

RT-qPCR requer o uso de reagentes curva padrão adequado. A Figura 4 mostra uma curva padrão típica para enterovírus e norovírus GII. A curva de norovirus GII atende aos critérios de desempenho padrão curva (Tabela 10) com um valor de R 2 de 0,9987, um desvio-padrão geral de 0,14, ea eficiência de 101%. Norovirus GIA e curvas GIB (não mostrado) são quase idênticos ao da norovírus GII. A curva de enterovírus satisfaz os critérios de desempenho do método com um valor de R2 de 0,9874, um desvio padrão global de 0,58, e a eficiência de 103%, mas tem cerca de uma centena de vezes menos sensibilidade e, portanto, um limite de detecção mais elevado do que as curvas de norovírus.


Figura 1. Visão geral do Processo Molecular. O procedimento molecular inclui concentração da amostra adicional para além da realizada para medir o vírus infeccioso, extração de ácidos nucléicos, uma de duas etapas transcrição reversa (RT) protocolo, e PCR quantitativo (qPCR). O volume de partida (S) representa uma proporção definida pelo método da amostra original de água.

Figura 2
Figura 2. RT-qPCR esquemática visão geral. Cada amostra de teste RNA extraído é transcrito de forma inversa utilizando ensaios em triplicado (RT1, RT2, e rT3). O ADNc de cada um dos ensaios de RT em triplicado, em seguida, é analisada à presença de vírus específicos, usando enterovírus separado (EV PCR), norovírus genogrupo I (Nov GIA PCR e NoV GIB PCR), norovírus genogrupo II (NoV GII PCR), e ensaios da hepatite G (VHG PCR).

Figura 3
Figura 3. Média Poliovírus e Murino Norovirus Recuperação (%) a partir do solo e da água de grau reagente. A média de recuperação por cento é mostrado para o poliovírus do terreno ( Figura 3-1 ; n = 7) e a partir do grau de reagente ( Figura 3-2 ; n = 12) de água e para norovirus murino de solo ( Figura 3-3 ; n = 7) e a partir do grau de reagente ( Figura 3-4 ; n = 12) de água (1), em que "n" é o número de amostras processadas de água separados. As barras de erro representam o erro padrão.

Figura 4 Figura 4. Enterovirus e Norovirus GII curva padrão. Curvas padrão típicas para enterovírus e norovírus GII são mostrados. As fórmulas que dão inclinação e R 2 valores para cada curva é calculado mediante o termociclador.

Suplementar 1. Arquivo Por favor clique aqui para fazer o download deste arquivo.

Virus Grupo Primer / Probe Nome (1) Sequência (2) Referência
Enterovirus
EntF (EV-L) 20
Entr (EV-R) ACCGGATGGCCAATCCAA 20
Entp (Ev-sonda) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Hepatite G
HEPF (5'-NCR iniciador directo) CGGCCAAAAGGTGGTGGATG 19
HEPR (5'-NCR iniciador inverso) CGACGAGCCTGACGTCGGG 19
Hepp (hepatite G Sonda TaqMan 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tabela 1. Primers e TaqMan Sondas para detecção de vírus por RT-qPCR.
(1) Método de 1615 cartilha e os nomes de teste são as três primeiras letras do nome do vírus concatenadas para F, R, P ou para frente, para trás, e sonda. O genogrupo norovirus é designado pela adição de GI e GII aos nomes. Os dois conjuntos de primers GI norovírus são também distinguidos utilizando nomes de A e B. Iniciador e Sonda das referências primárias são dados no paiheses.
(2) A orientação de sequências de iniciadores e a sonda é 5 'para 3'. Os seguintes indicadores de bases degeneradas são utilizados: N- uma mistura de todos os quatro nucleótidos; R-A + G; Y-T + C; W-A + T; e I-inosina.

Ingrediente Volume por reacção de (l) (2) A concentração final Volume por Master Mix (l) (3)
RT Master Mix 1
Iniciador aleatório 0,8 10 ng / ul (c. 5,6 uM) 84
ARN da hepatite G blindada (4) 1 105
PCR água grau 14,7 1543,5
Paratal 16,5 1732,5
RT Master Mix 2
PCR 10X tampão II 4 Tris 10 mM, pH 8,3, KCl 50 mM 420
25 mM de MgCl2 4.8 3 mm 504
10 mM dNTPs 3.2 0,8 mm 336
100 mM DTT 4 10 mM 420
RNase Inhibitor 0,5 0,5 unidades / ul 52,5
SuperScript II RT 0,3 1,6 unidades / ul 31,5
Total 16,8 1764

Tabela 2. RT Master Mix 1 e 2 (1).
(1) Prepare RT Mestre Mixes em uma clquarto ean, ou seja, uma sala onde os procedimentos moleculares e microbiológicos não são executadas.
(2) O volume final de ensaio de RT é de 40 ul.
(3) Os volumes mostram baseiam-se em 105 ensaios. Isto é suficiente para uma placa de 96 poços com os ensaios de PCR adicionais adicionados para compensar as perdas. A quantidade pode ser escalada para cima ou para baixo de acordo com o número de amostras e os controlos que vai ser analisado.
(4) determinar a quantidade de reagente de G da hepatite para incluir na mistura de RT 1 mestre, tal como descrito em materiais suplementares Passo S4.

Ingrediente Volume por reacção de (l) (2) A concentração final Volume por Master Mix (l) (3)
2x LightCycler 480 Sondas Master Mix 10 Proprietário 1050
ROX referênciacorante (4) 0,4 0,5 mM 42
PCR água grau 1 105
10 uM EntF 0,6 300 nM 63
10 mM Entr 1.8 900 nm 189
10 uM entp 0,2 100 nM 21
Total 14 1470

Tabela 3. PCR Master Mix para enterovirus (EV) Ensaio (1).
(1) Prepare todos os Mestres Misturas de PCR em um quarto limpo.
(2) O volume final do ensaio é de 20 ul qPCR.
(3) Os volumes mostram baseiam-se em 105 ensaios. Isto é suficiente para uma placa de 96 poços com os ensaios de PCR adicionais adicionados para compensar as perdas. O montante pode ser escalado para cima ou para baixo de acordo com o número de amostras e controles que vãoser analisados.
(4) Substituto PCR água grau reagente para este quando utilizar instrumentos que não exigem isso.

Ingrediente Volume por reacção de (l) (2) A concentração final Volume por Master Mix (l) (3)
2x LightCycler 480 Sondas Master Mix 10 Proprietário 1050
Corante de referência ROX (4) 0,4 0,5 mM 42
PCR água grau 1.4 147
10 uM NorGIAF 1 500 nM 105
10 uM NorGIAR 1 500 nM 105
10 uM NorGIAP 0,2 100 nM 21
Total 14 1470

Tabela 4. PCR Master Mix para Norovirus GIA (Nov GIA) Assay (1).
Ver Tabela 3 para as notas de rodapé (1) - (4).

Ingrediente Volume por reacção (l) (2) Concentração final Volume por Master Mix (l) (3)
2x LightCycler 480 Sondas Master Mix 10 Proprietário 1050
Corante de referência ROX (4) 0,4 0,5 mM 42
PCR água grau 0,3 31,5
10 uM NorGIBF 1 500 nM 105
10 uM NorGIBR 1.8 900 nm 189
10 uM NorGIBP 0,5 250 nM 52,5
Total 14 1470

Tabela 5. PCR Master Mix para Norovirus GIB (Nov GIB) Assay (1).
Ver Tabela 3 para as notas de rodapé (1) - (4).

<td> 0,5 mM
Ingrediente Volume por reacção (l) (2) Concentração final Volume por Master Mix (l) (3)
2x LightCycler 480 Sondas Master Mix 10 Proprietário 1050
Corante de referência ROX (4) 0,4 42
PCR água grau 0,3 31,5
10 uM NorGIIF 1 500 nM 105
10 uM NorGIIR 1.8 900 nm 189
10 uM NorGIIP 0,5 250 nM 52,5
Total 14 1470

Tabela 6. PCR Master Mix para Norovirus GII (NoV GII) Assay (1).
Ver Tabela 3 para as notas de rodapé (1) - (4).

Ingrediente Volume por reacção (l) (2) Concentração final Volume por Master Mix (l) (3)
2x LightCycler 480 Sondas Master Mix 10 Proprietário 1050
Corante de referência ROX (4) 0,4 0,5 mM 42
PCR água grau 0,3 31,5
10 uM MuNoVF1 1 500 nM 105
10 uM MuNoVR1 1.8 900 nm 189
10 uM MuNoVP1 0,5 250 nM 52,5
Total 14 1470

Tabela 7. PCR Master Mix para Murino Norovirus Ensaio (1).
Ver Tabela 3 para as notas de rodapé (1) - (4).

Ingrediente Volumepor reacção (l) (2) Concentração final Volume por Master Mix (l) (3)
2x LightCycler 480 Sondas Master Mix 10 Proprietário 1050
Corante de referência ROX (4) 0,4 0,5 mM 42
PCR água grau 1.4 147
10 uM HEPF 1 500 nM 105
10 uM HEPR 1 500 nM 105
10 mM Hepp 0,2 100 nM 21
Total 14 1470

Tabela 8. PCR Master Mix para vírus da hepatite G (VHG) Ensaio (1).
Vejo

Curva de concentração padrão Cópias genómicas por RT-qPCR de ensaio (1, 2)
2,5 x 10 8 502.500
2,5 x 10 7 50.250
2,5 x 10 6 5025
2,5 x 10 5 502.5
2,5 x 10 4 50.25
2,5 x 10 3 5,025

Tabela 9. Cópias curva padrão genômico.
(1) Identificar os poços da curva padrão como as normas e colocar as cópias genómicas por valores de ensaio RT-qPCR no local apropriado no software termociclador.
(2) Uma curva padrão aceitável terá um rendimento de 70% -110%, Um valor de R 2> 0,97, e um desvio-padrão geral de <0,5 para norovirus e <1,0 por enterovírus.

Critérios Valor aceitável
Norovirus Enterovirus
Desvio padrão global <0,5 <1,0
R2 > 0,97 > 0,97
Eficiência 70% a 115% 70% a 115%

Tabela 10. Critérios de curva padrão de aceitação (1).
(1) As curvas padrão com% eficiências de 70% -110% são aceitáveis, mas os valores na faixa de 90% -115% são ideais. Valores inferiores a 90% pode indicar erros de pipetagem ou de diluição.

Componente QA A média de recuperação Range (%) Coeficiente de variação (%)
Reagente de laboratório em branco; PT ou PE amostras negativas 0 N / A (1)
Lab fortificada em branco; Lab Matrix Amostra Fortificado 5-200 N / D
PT amostras positivas e PE 15-175 ≤130

Tabela 11. Modo de 1615 Critérios de Desempenho.
(1) Não é aplicável.

Mídia Composição
Fosfato de sódio 0,15 M, pH 7,0-7,5 Prepare fosfato de sódio 0,15 M por dissolução de 40,2 g de fosfato de sódio, dibásico (Na 2 HPO 4 · 7H 2 O) em um volume final de 1 L dH
5% de BSA Preparar por dissolução de 5 g de BSA em 100 mL de dH2O Esterilizar a solução por passagem através de um filtro de esterilização de 0,2-uM.
PBS, BSA a 0,2% Preparar por adição de 4 mL de BSA a 5% para 96 ​​mL de PBS. Esterilizar a solução por passagem através de um filtro de esterilização de 0,2-uM.
Tampão TSM III Dissolve-se 1,21 g de base de Trisma, 5,84 g de NaCl, 0,203 g de MgCl2, 1 ml de gelatina Prionex, e 3 ml Microcide III em 950 ml de água de grau de reagente. Ajustar o pH para 7,0 e, em seguida, levar o volume final de 1 L. Esterilizar a solução por passagem através de um filtro de esterilização de 0,2-uM.
0,525% de hipoclorito de sódio (NaClO) Preparar uma solução de NaClO 0,525% diluindo lixívia doméstica 1:10 em dH 2 O. Armazenar 0,525% de soluções de NaClO de 1 semana até à TA.
Tiossulfato de sódio a 1-M (Na 2 S 2 O 3) pentahidratado Prepara-se uma solução 1 M por dissolução de 248,2 g de Na 2 S 2 O 3 em 1 L de dH2O Loja de tiossulfato de sódio até 6 meses à temperatura ambiente.

Tabela 12. Tabela de mídia.

Discussion

Estudos de grande escala nacional de contaminação virai de origem e de águas de beber exigem o uso de vários laboratórios de análise. Sob estas condições, é necessário um método padrão para assegurar que os dados gerados pelos vários laboratórios é comparável. Existem muitos métodos moleculares publicados para detecção de vírus, mas muito poucos métodos moleculares padronizados. Método EPA 1615 é um método padronizado projetado especificamente para a detecção de enterovírus e norovírus em matrizes de água RT-qPCR por. Métodos moleculares padronizados estão disponíveis para a detecção de vírus em alimentos (CEN / ISO TS 15216-1 e CEN / ISO TS 15216-2; 07 abril de 2013) 16,17 e têm sido aplicados à detecção de vírus da hepatite A e norovírus na primavera água 16. Todos os métodos padrão deve incluir controles de qualidade de desempenho e critérios para minimizar variação inter e intra-laboratorial e dados falsos positivos devido à contaminação de laboratório. Para reduzir ainda mais dados falsos, EPA Método 1615 segue a orientação de EPA em métodos moleculares, 18, ​​que estipula a separação do trabalho durante o processamento e uma maneira de fluxo de trabalho. Ele inclui uma hepatite G 1,19 controle e procedimentos para minimizar resultados falso-negativos devido aos inibidores de RT-qPCR 15 interna. Ele usa ensaios quantitativos, juntamente com volumes padronizados de ambos água amostrada e água analisados ​​para que todos os dados de campo é expressa em cópias genômicas por litro de campo ou beber água amostrada. Embora eficiente tubo único (um passo) ensaios de RT-PCR estão disponíveis comercialmente, o método utiliza intencionalmente ensaios separados. Isto tem a desvantagem de reduzir ao mínimo a quantidade de amostra que pode ser ensaiada em cada reacção, mas dá uma maior flexibilidade na utilização de múltiplos conjuntos de iniciadores. RT-qPCR ensaios são limitados por e apenas tão bom quanto os primers e sondas utilizadas e, provavelmente, nenhum conjunto de primers irá detectar todas as variantes do vírus dentro de um grupo. O conjunto de enterovírus cartilha foi escolhido porqueque tem como alvo a região de codificação 5 'não conservado, 20,21 detecta uma ampla variedade de serótipos de enterovirus, e vírus detectados por ela estão associados com efeitos sobre a saúde decorrentes do consumo de águas subterrâneas não tratadas 1. Dois conjuntos de iniciadores são usados ​​para a detecção de genogrupo I norovírus 22,23. O primeiro foi escolhido devido à forte correlação entre os efeitos na saúde em crianças pequenas e detectados vírus 1. A segunda genogrupo I primer eo conjunto de iniciador utilizado para norovírus genogrupo II foram escolhidos porque eles detectam a mais ampla variedade de cepas 24,25.

Apesar das grandes vantagens de qPCR e RT-qPCR procedimentos para a detecção de RNA viral em água, há várias limitações. Primeiro, ambas as partículas virais infecciosas e não infecciosas, incluindo aqueles inactivado por desinfectantes, podem ser amplificados por estes procedimentos. Os resultados da Borchardt sugerem que isso é menos de um problema para as águas subterrâneas não tratadas faquíferos rom semelhantes àquelas nas comunidades estudadas do que para as águas superficiais desinfetados 1. Para vírus cultiváveis ​​este problema pode ser superado através de PCR, em combinação com a cultura 26,27. O problema foi também tratada por alguns vírus através do uso de agentes de ligação cruzada de ácido nucleico 28-30. Esta última abordagem é mais eficaz para os vírus inativados por hipoclorito e não eficazes para aqueles inactivado por UV.

Uma segunda limitação destes processos moleculares que é o volume da amostra concentrada que pode ser ensaiada é tipicamente muito menor do que o utilizado para procedimentos de cultura 6,31. Este problema é muitas vezes tratada por qualquer substituição de um procedimento à base de polietilenoglicol para a concentração secundário padrão pela floculação orgânica, que permite que a amostra a ser ressuspensas num volume mais pequeno, ou pela adição de um passo de concentração da amostra terciário 6,32,33 . Método 1615 usa CentrifUGAL ultrafiltração para proporcionar uma concentração superior. Ultrafiltração centrífuga remove a água e os componentes menos do que 30.000 Daltons, resultando em ambos concentração de vírus nas amostras de teste e uma redução em inibidores de baixo peso molecular de ensaios moleculares. Este passo de concentração terciárias resulta num factor de concentração global de> 10 5 para qualquer vírus que estava presente na água a ser testada.

Uma terceira limitação é a presença de inibidores de processos moleculares em amostras ambientais. Apesar de várias abordagens para remover inibidores têm sido desenvolvidos, nenhuma abordagem é eficaz para todas as matrizes de água e tipos de vírus 6,34,35, tornando o uso de controles internos destinados a estimar o nível de inibição essencial. O reagente da hepatite G utilizado neste método satisfaz este requisito ao proporcionar um nível constante de ARN virai em todas as reacções e um ensaio de RT-qPCR para a estimativa de inibição. Quando o melhor de tele inibidor de remoção abordagens não conseguem remover inibição, os concentrados de amostra pode ser diluída, enquanto as concentrações de vírus são maiores do que as concentrações de inibidor 14,15.

O procedimento curva padrão aqui descrito tem vantagens e uma maior limitação. Uma vantagem é que o reagente utilizado material de todos os componentes necessários num único reagente, permitindo que um único controlo a serem utilizados para todos os ensaios. Este reagente é especialmente uma vantagem para ensaios de norovírus. Partículas Norovirus só pode ser obtido a partir de indivíduos infectados, tornando muito difícil a obtenção de partículas virais para uso como padrões. Uma vantagem mais importante é que fornece um padrão de RNA para todos os vírus de RNA específicas a um reagente, como tendo um padrão de RNA é essencial para a quantificação exacta de ARN 36. No entanto, a sua capacidade de quantificar com precisão vírus é limitada pelo facto de que os efeitos da matriz não são tidos em conta. Isto significa que a cópia genômicaOs valores de número não pode ser considerado absoluto e só deve ser considerada em termos relativos. Recomenda-se que um número suficiente de curva padrão alíquotas de ações de trabalho (passo 1.2) estar preparado para cobrir estudos completos. Por exemplo, cada alíquota de 250 ul de reagente fornece suficiente para 6 placas RT. Se é sabido que um estudo irá requerer a análise de amostras 500, um mínimo de 12 alíquotas seria necessário (500 amostras / 7 amostras por placa RT / RT 6 placas) por alíquota.

Método EPA 1615 é um método baseado desempenho. Muitos fabricantes fazem reagentes equivalentes aos aqui especificados e destes reagentes pode ser substituído, desde que sejam cumpridos os critérios de desempenho. A curva padrão, que também serve como um controlo positivo no teste RT-qPCR, é de valor em solucionar problemas de desempenho. O desempenho pode diminuir devido à degradação do RNA, a vida de prateleira de reagentes, a falha de freezers, calibração de instrumentos, e erro técnico. Problemas de desempenho deve ser suspeitoed se curvas padrão diferentes dos mostrados na Figura 4 ou se não cumprir a especificação de desempenho para curvas padrão. O ensaio de RT-qPCR é bastante robusta; fracasso completo é provavelmente devido ao manuseio inadequado de RNA ou erro técnico (por exemplo, um reagente em falta). Grande cuidado deve ser tomado na manipulação de amostras de RNA entre a extração ea etapa de RT para reduzir a degradação do RNA ribonucleases.

Recuperações de poliovírus a partir de águas subterrâneas e de grau reagente e recuperações norovirus murino de águas subterrâneas conheceu o Método EPA 1615 critérios de aceitação de desempenho (Tabela 11) e são semelhantes aos relatados por outros 33,37,38. Recuperações de norovírus murino a partir de amostras LFB foram muito menores do que os de poliovírus e não teria conhecido os critérios de aceitação específicos do poliovírus. As razões para a menor recuperação norovirus murino de água grau reagente são desconhecidos. Semelhante aos resultados aqui descritos, Karim e Colleagues relatou uma recuperação para norovirus GI.1 de 4% da água da torneira 39. Lee et ai. Relataram 37 recuperações médias para norovirus murino e humano GII.4 norovírus de 18% e 26% de água destilada usando filtros de disco, respectivamente. Usando condições semelhantes às Lee e seus colegas, Kim e Ko observadas recuperações de 46% e 43% para estes vírus, respectivamente 38. Gibbons et al. 40 obtida em torno de recuperação de 100% de GII.4 norovirus humano a partir de água do mar, mas Kim e Ko 38 verificaram que a adição de sal à água destilada em concentrações semelhantes ou mais elevados do que a água do mar recuperações significativamente reduzida do vírus de murino e resultou em cerca de uma redução de duas vezes na recuperação GII.4.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics