Metodo EPA 1615. Misura di Enterovirus e Norovirus Presenza in Water di Cultura e RT-qPCR. Parte III. Rilevamento virus mediante RT-qPCR

Environment
 

Cite this Article

Copy Citation | Download Citations

Fout, G. S., Cashdollar, J. L., Griffin, S. M., Brinkman, N. E., Varughese, E. A., Parshionikar, S. U. EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR. J. Vis. Exp. (107), e52646, doi:10.3791/52646 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

PCR quantitativa (qPCR; vedi materiali supplementari per le definizioni dei termini utilizzati in questo manoscritto) e trascrizione inversa-qPCR (RT-qPCR) sono strumenti preziosi per il rilevamento e la quantificazione dei virus enterici umani in ambientale e acque potabili, e soprattutto per molti virus che fanno Non replicare o replicare male in sistemi di colture cellulari. Entrambi gli strumenti hanno dimostrato che molti tipi di virus sono presenti nelle acque potabili ambientali e in tutto il mondo 1-6. Il loro utilizzo insieme con il sequenziamento dei frammenti genomici amplificati durante indagini sui focolai di malattie ha fornito prove per la trasmissione del virus per via d'acqua, come hanno dimostrato che il virus trovato in acqua potabile è identica a quella capannone dai pazienti scoppio 7-10.

Sia qPCR e RT-qPCR sono utili strumenti di sanità pubblica. Ad esempio, i dati provenienti da studi condotti dalla US Environmental Protection Agency (EPA) ha dimostrato una forte relazione siale misure degli indicatori tween di qPCR e gli effetti sulla salute nelle acque ad uso ricreativo. Come risultato, finale 2012 Criteri di Qualità dell'acqua ricreativo dell'EPA include un metodo qPCR per monitorare le spiagge ricreativi 11,12. Borchardt e colleghi hanno anche trovato una forte relazione tra gastroenterite acuta in comunità con le acque sotterranee non trattate e il virus nelle acque sotterranee, come misurato mediante RT-qPCR 1.

Lo scopo di questo lavoro è quello di descrivere la componente analisi molecolare del metodo EPA 1615 13,14. Questo test utilizza RT-qPCR per fornire una stima quantitativa di enterovirus e copie genomiche norovirus (GC) per litro in base al volume originale di acqua ambientale o bere passato attraverso un filtro elettropositivo. Una panoramica della procedura molecolare è mostrato in Figura 1 punto. Protocollo 1 particolari le procedure per preparare la curva standard. Questi standard sono preparati da un reagente che contiene un RNUna copia della sequenza target per tutti i set di primer / sonda. Sezione 2 descrive la procedura di concentrazione terziaria. Sezione 3 illustra la procedura per estrarre RNA da campioni di acqua e di controllo concentrati. L'RNA da ogni campione viene inversione trascritto mediante saggi in triplo e primer casuali per innescare la trascrizione (sezione 4). Il cDNA da ogni reazione trascrizione inversa è suddiviso in cinque saggi specifici per il virus separate che vengono analizzati in triplice copia da qPCR (sezione 5; Figura 2). Il test utilizza primer e sonde dalla letteratura scientifica (Tabella 1) che sono progettati per rilevare molti enterovirus e norovirus e un reagente contenente epatite G RNA per identificare i campioni di prova che inibiscono RT-qPCR 15.

Protocol

Nota: utilizzare schede di monitorare tutte le fasi del protocollo; schede esempio dati sono riportati nel materiale supplementare Tabelle S2-S4.

1. Curva Preparazione standard

  1. Preparare uno stock di lavoro del reagente curva standard (ad esempio, Armored RNA EPA-1615) diluendo dalla concentrazione fornita dal produttore ad una concentrazione di 2,5 x 10 8 particelle / ml (2,5 x 10 8 GC / ml) utilizzando TSM tampone III. Dividere il brodo di lavoro in 250 aliquote microlitri utilizzando provette da 1,5 ml microcentrifuga e conservare a -20 ° C.
    NOTA: vedere supplementare protocollo materiali Passo S1 per le istruzioni sulle preparare scorte di lavoro dei virus e plasmidi per l'uso come reagenti curva standard alternativi.
  2. Scongelare una o più delle stock aliquote di lavoro. Preparare cinque diluizioni seriali di 10 volte utilizzando provette da 1,5 ml microcentrifuga, dando concentrazioni di 2,5 x 10 7, 2,5 x 10 6, 2.5 x10 5, 2,5 x 10 4, e 2,5 x 10 3 GC / ml.
    1. Preparare la prima diluizione con l'aggiunta di 25 ml di / ml di brodo di lavoro 2,5 x 10 8 GC a 225 ml di buffer di TSM III. Mescolare per 5-15 secondi utilizzando un vortex.
    2. Preparare la diluizione successiva con l'aggiunta di 25 ml di diluizione preparata al punto 1.2.1 a 225 ml di buffer di TSM III. Mescolare di nuovo e continuare un processo simile per preparare i prossimi tre diluizioni 10-fold.
  3. Estrarre l'RNA dallo stock di lavoro curva standard e cinque diluizioni immediatamente utilizzando la procedura nella sezione 3.

2. Concentrazione Terziario

  1. Preparare un concentratore centrifugo (30.000 molecolare cutoff peso) per ciascun campione raccolto aggiungendo almeno 10 ml di PBS 1x, 0,2% di albumina di siero bovino (BSA) per camera campione superiore. Assicurarsi che la soluzione ha riempito la sottile camera di concentrazione di canali, e quindi tenere O / N a 4 ° C.
  2. Aggiungere una quantità di concentrato acqua secondari di ogni campione di prova pari a S, il saggio Volume campione in concentratori centrifughi separati.
    1. Calcola S con l'equazione 1,
      Equazione 1
      Dove D è il volume di Campione d'acqua originale dosati, TSV è il volume del campione totale e FCSV è la Finale concentrato volume del campione. Vedere materiali supplementari S2 per un esempio di calcolo del S.
  3. Centrifugare ogni campione sottoposto ad 3,000-6,000 xga 4 ° C in un rotore bucket oscillante per 20 - 30 min. Controllare il volume nel sottile camera di concentrazione di canali.
    1. Se il volume è superiore a 400 ml, centrifugare nuovamente per 20 minuti o più. Continuare centrifugazione fino a quando il campione in the camera di concentrazione canale sottile è stato ridotto a meno di 400 ml. Non rimuovere il surnatante.
  4. Lavare lati del concentratore centrifugo con 1 ml di soluzione sterile di fosfato di sodio 0,15 M, pH 7-7,5 per aumentare il recupero virus. Centrifugare nuovamente a 3,000-6,000 xg e 4 ° C fino a quando il campione è stato ridotto a meno di 400 microlitri. Ripetere questa fase di lavaggio una volta in più.
  5. Usando una micropipetta 100-200 microlitri, misurare accuratamente e trasferire ciascun campione concentrato in una provetta da 1,5 ml (cioè, trasferire 200 ul alla provetta e quindi misurare il concentrato rimanente regolando la micropipetta finché il liquido rimanente può essere completamente elaborata nella punta pipetta). Aggiungere 0,15 M di fosfato di sodio, pH 7-7,5, per regolare il volume finale a 400 ± 2 microlitri.
  6. Estrarre acido nucleico immediatamente procedendo al punto 3. Tenere i campioni concentrati che non possono essere Processid immediatamente a 4 ° C per non più di 24 ore.

Isolamento 3. acidi nucleici

  1. Aggiungere 200 ml di tampone di estrazione preparato come descritto al punto 3.3 e 200 ml di concentrato terziaria da ogni campione di prova dal punto 2.5 o diluizione curva standard dal punto 1.3 per isolare etichettato 1,5 ml microprovette. Congelare rimanendo concentrati terziarie pari o inferiore a -70 ° C. Estrarre i acidi nucleici da ciascun campione secondo le istruzioni del kit del produttore estrazione degli acidi nucleici per il protocollo di rotazione per i campioni di sangue con le seguenti eccezioni.
  2. Non aggiungere proteasi ai campioni di acqua o utilizzare il tampone di estrazione fornita con il kit estrazione degli acidi nucleici.
  3. Preparare tampone di estrazione con carrier RNA
    1. Aggiungere 310 pl di tampone di diluizione carrier RNA ad una fiala contenente 310 mg di carrier RNA. Mescolare per sciogliere e poi dividere in 6 aliquote contenenti circa 50 ml. Conservare a -20° C.
    2. Aggiungere 28 ml di scongelati carrier RNA per ml di tampone di estrazione per ottenere una concentrazione carrier RNA di 0,027 mg / mL. Utilizzare il tampone di estrazione RNA modificato vettore al posto di quella fornita con il kit di estrazione.
  4. Preparare una soluzione maestro di tampone di eluizione aggiungendo ribonucleasi (RNasi) Inhibitor ad una concentrazione finale di 400 unità / ml per il tampone di eluizione fornito con il kit di estrazione.
    1. Eluire RNA dall'acido nucleico vincolante Spin Column ponendo 50 ml di tampone di eluizione con RNasi inibitore nella colonna. Attendere per 1 min, e quindi si centrifuga a 6000 xg per 1 min a RT.
    2. Ripetere il passaggio 3.4.1 e poi rimuovere ed eliminare la colonna.
  5. Preparare aliquote degli estratti di RNA dal punto 3.4.2. Preparare 6 aliquote dello stock di lavoro curva standard e ogni diluizione curva standard contenente almeno 15 ml ciascuno. Preparare 4 aliquote di tutti gli altri campioni di RNA contenenti almeno22 ml ciascuno. Conservare un'aliquota di ciascun campione e curva standard di controlli a 4 ° C, se possono essere elaborati mediante trascrizione inversa entro 4 ore; altrimenti, memorizzare tutti aliquote pari o inferiore a -70 ° C.

4. trascrizione inversa (RT)

  1. Preparare 100 mM soluzioni madre di ciascun primer oligonucleotide e sonda elencati nella Tabella 1 aggiungendo un volume di acqua PCR-grade ad ogni flacone utilizzando una quantità (in microlitri) pari a dieci volte il numero di nanomoli (nmol) di oligonucleotide presenti nel fiala (come indicato sull'etichetta del flacone o nella scheda tecnica del produttore (ad esempio, risospendere un primer contenente 36,3 nmol in 363 ml). Mescolare per sciogliere.
    1. Diluire 100 micron soluzioni 1:10 con acqua PCR-grade per preparare 10 micron soluzioni di lavoro.
  2. Preparare RT Master Mix 1 e 2 in una camera pulita utilizzando la guida nella tabella 2. Dispensare 16,5 ml di RT MasteR Mix 1 per ogni piastra PCR bene con una pipetta multicanale.
  3. Thaw, se bloccato, gli estratti acidi nucleici da ciascun campione di campo e di laboratorio fortificata matrice del campione (LFSM, cioè, campione di matrice acqua testa di serie).
    1. Diluire ciascun campo e LFSM campione 1: 5 e 1:25 in tampone di eluizione contenente 400 unità / ml di inibitore RNasi.
    2. Thaw, se congelato, ma non diluire Lab fortificato Blank (LFB, cioè un controllo di qualità positivo con acqua distillata teste di serie), Lab reagente Bianco (LRB, cioè, un controllo negativo di qualità con acqua distillata), Performance Evaluation (PE , cioè campioni di acqua distillata seminato utilizzati per valutare le prestazioni di laboratorio prima dell'inizio di uno studio), Performance Test (PT, cioè campioni di acqua di grado reagente seminato con titoli sconosciuti a un analista che vengono utilizzati per valutare le prestazioni di laboratorio durante uno studio ), NA batch di controllo di estrazione negativo, o RNA estratto dal set curva standard.
    3. Mettere 6.7 ml di RNA da ogni campione di prova, controllo e curva standard in pozzetti separati piastra PCR, utilizzando pozzi triplicato per i campioni di test e controlli e pozzetti duplicati per le curve standard (vedi Figura S1 per un esempio piatto RT).
      1. Mettere 6.7 ml di tampone di eluizione in diversi pozzetti della piastra PCR per controlli NTC (NTC). Includere 2-8 NTC per piastra RT, utilizzando due per il primo campione e quindi più di due per ogni quarto campione aggiuntivo.
      2. Distribuire l'estrazione controlli negativi e NTC tutta la piastra.
    4. Sigillare la piastra PCR con un piatto resistente al sigillante di calore. Mescolare i campioni per 5-10 secondi e poi centrifugare a ≥ 500 xg brevemente.
    5. Incubare la piastra per 4 min a 99 ° C e poi raffreddare rapidamente a 4 ° C in un termociclatore. Centrifugare di nuovo a ≥ 500 xg brevemente.
    6. Rimuovere con cautela la guarnizione della piastra e poi aggiungere 16,8 ml di RT Master Mix 2 di ogni bene. Seal piatto di nuovo con un foglio sigillante resistente al calore, seguita da miscelazione e una breve centrifugazione a ≥ 500 x g.
    7. Porre la piastra in un termociclatore ed eseguire per 15 min a 25 ° C, seguita da 60 minuti a 42 ° C, 5 min a 99 ° C, e poi da un 4 ° ciclo C attesa.
    8. Processo immediatamente o entro 8 ore dalla qPCR (punto 5), o conservare i campioni pari o inferiore a -70 ° C fino a che non può essere elaborato. Conservare i campioni che possono essere elaborati entro 8 ore a 4 ° C.

    5. Real-time PCR quantitativa (qPCR)

    1. Determinare la media epatite valore di G Cq per ogni lotto di epatite G reagente prima di eseguire eventuali campioni di prova.
      1. Eseguire un test RT utilizzando 10 replicati preparato come descritto per i controlli NTC (Fase 4.1.1). Eseguire l'epatite G qPCR saggio come descritto di seguito (i passaggi da 5.2 a 5.5.3). Calcolare il valore medio Cq delle 10 repliche.
      2. Regolare l'epatite G quantità di reagente in RT Master Mix 1 (tabella 2), Se necessario, per ottenere un valore medio Cq tra 25 e 32 unità. Compensare l'importo sollevato o abbassato modificando il volume di acqua aggiunta per mantenere il RT Master Mix 1 volume finale di 16,5 ml per saggio.
      3. Confermare le regolazioni ripetendo i punti da 5.1.1 a 5.1.2 e al cambiamento tabella 2 in modo da riflettere i quantitativi corretti.
    2. Preparare qPCR Master Mix in una stanza pulita utilizzando le guide nella Tabella 3 per enterovirus, Tabella 4 e Tabella 5 per norovirus genogruppo I, tabella 6 per norovirus genogruppo II, Tabella 7 per norovirus murino (norovirus genogruppo V), e la Tabella 8 per l'epatite G. Mix ogni master mix e poi centrifugare a ≥ 500 xg brevemente.
    3. Aggiungere i Master Mix PCR nei rispettivi pozzetti di una piastra di reazione ottica etichetta, utilizzando 14 microlitri per bene e piatti separati per ciascun saggio qPCR (si veda la Figura S2 Figura S1).
    4. Scongelare la piastra RT dal punto 4.8 a temperatura ambiente, se congelato. Mescolare con un mixer piatto e poi centrifugare a ≥ 500 xg brevemente.
    5. Dispensare 6 ml di cDNA adeguato alle pozzetti, all'interno della piastra di reazione ottica. Mescolare i campioni nella piastra di reazione ottica e centrifugare a ≥ 500 xg brevemente.
      1. Eseguire l'epatite G qPCR test sul campo non diluito e diluito e campioni LFSM prima di eseguire tutti gli altri saggi qPCR. Utilizzare la diluizione più basso di campo o campione LFSM che è <1 valore Cq maggiore del valore medio epatite G Cq per gli enterovirus e norovirus saggi qPCR.
      2. Impostare il software termociclatore PCR quantitativa in base alle istruzioni del produttore. Identificare i campioni della curva standard come standard e per ogni diluizione curva standard, inserire i valori di copia genomici indicati nella tabella 9.
    6. Determinare se ogni curva standard soddisfa i valori accettabili indicati nella tabella 10. Vedere la sezione materiali supplementari S3 per gli esempi.
      1. Calcolare la deviazione standard globale (StdDev) per la curva standard utilizzando Equazione 2,
        Equazione 2
        dove Cq è il valore riportato per ciascun replicato curva standard, Cq è il valore medio per ogni serie di repliche, #Cq è il numero totale di valori Cq per tutte le repliche di controllo standard che hanno valori positivi (cioè non indeterminato), e # Stds è il numero di controlli standard che hanno valori positivi.
      2. Se il software termociclatore PCR quantitativa non calcola la pendenza per ogni curva standard, calcolare la pendenza utilizzando equazione 3,60;
        Equazione 3
        dove Cq è il valore medio delle diluizioni alti e più bassi utilizzati e log GC è il registro del valore di copia genomica per le diluizioni alti e più bassi utilizzati dalla tabella 9.
      3. Calcolare il valore di R 2 usando l'equazione 4.
        Equazione 4
        dove Cq è la media di tutti i valori Cq e Log GC è il valore medio registro GC per ogni replica.
      4. Calcolare l'efficienza% utilizzando Equazione 5:
        Equazione 5
    7. Registrare i valori GC calcolati dal software termociclatore per tutti i campioni di prova basati su curve standard che soddisfano i criteri specificati nella Tabella 10 ei valori GC medi per ogni campione. Eseguire nuovamente tutti i campioni con le curve standard che non soddisfano i criteri di cui
    8. Determinare il GC per litro (GC L) per ciascun campione usando Equazione 6:
      Equazione 6
      dove GC è la media del numero di copie genomico dal punto 5.7, il fattore '199' è il fattore di diluizione totale delle riduzioni di volume che si verificano durante la concentrazione terziaria, estrazione di RNA e gradini RT-qPCR, DF è il fattore di diluizione che compensa l'inibizione , e D è il volume di campione originale dosati in litri. Vedere materiali supplementari sezione S4 per un esempio di calcolo del GC L.
    9. Calcolare il GC totale di LFB e LRB campioni moltiplicando il valore GC media dal punto 5.5 da 199 e dividendo per 0,3.

Representative Results

Il recupero complessivo virus è stato determinato utilizzando il campo associato e LFSM campioni di acqua a terra. Un totale di sette set di campioni sono stati analizzati utilizzando due set raccolti in occasioni diverse da tre impianti di depurazione pubblici, e un set campione prelevato dal pozzo privato. I livelli di sementi per i campioni LFSM sono stati 3 x 10 6 MPN di Sabin poliovirus sierotipo 3 e 5 x 10 6 PFU di norovirus murino. Norovirus Murine è stato utilizzato come un surrogato nella valutazione metodo per mancanza di scorte norovirus umani con una concentrazione di virus sufficiente per campioni LFSM. Per campioni di acque sotterranee media recupero poliovirus è stata del 20%, con un errore standard di 2%, 14 mentre significa recupero norovirus murino è stata del 30%, con un errore standard di 3% (Figura 3). Il campione campo sotterranee regolare per ogni LFSM aveva enterovirus rilevabile o norovirus.

Campioni LFB e LRB sono stati misurati utilizzando semi e unseeded wat grado reagenteER. Tutti LRB campioni sono risultati negativi (dati non riportati). Recupero poliovirus media 44% con un errore standard di 1% (Figura 3), mentre il recupero norovirus murino media 4% con un errore standard di 0,5%.

RT-qPCR richiede l'uso di adeguati reagenti curva standard. Figura 4 mostra una tipica curva standard per enterovirus e norovirus GII. La curva di norovirus GII risponde ai criteri di rendimento curva standard (Tabella 10), con un valore di R 2 di 0,9987, una deviazione standard globale di 0,14 e l'efficienza 101%. Norovirus GIA e le curve GIB (non mostrato) sono quasi identica a quella di norovirus GII. La curva enterovirus soddisfa i criteri di prestazione metodo con un valore di R 2 di 0,9874, una deviazione standard globale di 0,58 e l'efficienza del 103%, ma ha circa un centinaio di volte meno sensibilità e quindi un limite di rilevazione superiore alle curve di norovirus.


Figura 1. Panoramica sulla procedura molecolare. La procedura molecolare prevede la concentrazione del campione aggiuntivo oltre quello effettuato per misurare virus infettivo, l'estrazione degli acidi nucleici, in due fasi trascrizione inversa protocollo (RT), e PCR quantitativa (qPCR). Il volume iniziale (S) rappresenta una proporzione metodo definito di campione originale.

Figura 2
Figura 2. RT-qPCR schematica panoramica. Ogni RNA campione estratto viene trascritto inversa utilizzando saggi triplo (RT1, RT2, e RT3). Il cDNA da ciascuno dei dosaggi in triplo RT poi viene analizzato alla ricerca di virus specifici utilizzando enterovirus separato (EV PCR), norovirus genogruppo I (NoV GIA PCR e NoV GIB PCR), norovirus genogruppo II (NoV GII PCR), e l'epatite G (HGV PCR) test.

Figura 3
Figura 3. Media poliovirus e murino Norovirus recupero (%) da Ground e grado reagente acqua. Il recupero medio percentuale viene mostrato per poliovirus da terra ( Figura 3-1 ; n = 7) e dal grado reagente ( Figura 3-2 ; n = 12) di acqua e per norovirus murino da terra ( Figura 3-3 ; n = 7) e dal grado reagente ( Figura 3-4 ; n = 12) di acqua (1), dove "n" è il numero di campioni di acqua separati trasformati. Barre di errore rappresentano errore standard.

Figura 4 Figura 4. Enterovirus e Norovirus GII curva standard. Curve standard tipici per enterovirus e norovirus GII sono mostrati. Le formule che danno pendenza e R 2 valori per ogni curva sono calcolati dal termociclatore.

Supplemental 1. file Clicca qui per scaricare il file.

Virus Gruppo Primer / Sonda Nome (1) Sequence (2) Riferimento
Enterovirus
Entf (EV-L) 20
Entr (EV-R) ACCGGATGGCCAATCCAA 20
ENTP (Ev-sonda) 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA 21
Norovirus GIA
NorGIAF (JJV1F) GCCATGTTCCGITGGATG 22
NorGIAR (JJV1R) TCCTTAGACGCCATCATCAT 22
NorGIAP (JJV1P) 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA 22
Norovirus GIB
NorGIBF (QNIF4) CGCTGGATGCGNTTCCAT 23
NorGIBR (NV1LCR) CCTTAGACGCCATCATCATTTAC 23
NorGIBP (NV1LCpr) 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA 23
Norovirus GII
NorGIIF (QNIF2d) ATGTTCAGRTGGATGAGRTTCTCWGA 25
NorGIIR (COG2R) TCGACGCCATCTTCATTCACA 25
NorGIIP (QNIFS) 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA 25
Norovirus GV
MuNoVF1 AGATCAGCTTAAGCCCTATTCAGAAC 14
MuNoVR1 CAAGCTCTCACAAGCCTTCTTAAA 14
MuNoVP1 VIC-TGGCCAGGGCTTCTGT-MGB 14
Epatite G
HEPF (5'-NCR primer forward) CGGCCAAAAGGTGGTGGATG 19
HEPR (5'-NCR reverse primer) CGACGAGCCTGACGTCGGG 19
Hepp (epatite G TaqMan Probe 6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA 1

Tabella 1. Fondi e TaqMan sonde di individuazione del virus mediante RT-qPCR.
(1) Metodo 1615 primer e nomi della sonda sono le prime tre lettere del nome del virus concatenato a F, R, P o per avanti, indietro, e sonda. Il genogruppo norovirus è designato con l'aggiunta di GI e GII ai nomi. I due set di GI di primer norovirus anche si distinguono con A e B. Primer e sonda i nomi dei riferimenti principali sono indicate nel genitoreheses.
(2) La posizione del primer e della sonda è sequenze 5 'a 3'. I seguenti indicatori di base degenerati sono utilizzati: N-una miscela di tutti e quattro i nucleotidi; R-A + G; Y-T + C; W-A + T; e I-inosina.

Ingrediente Volume per reazione (ml) (2) Concentrazione finale Volume per Master Mix (ml) (3)
RT Master Mix 1
Primer Casuale 0.8 10 ng / ml (c. 5.6 micron) 84
Epatite G Armored RNA (4) 1 105
Acqua di grado PCR 14.7 1.543,5
ATal 16.5 1.732,5
RT Master Mix 2
10x PCR Buffer II 4 Tris 10 mM, pH 8.3, 50 mM KCl 420
25-mM MgCl 2 4.8 3 MM 504
DNTP da 10 mm 3.2 0,8 mM 336
100 mM DTT- 4 10 mM 420
RNase Inhibitor 0.5 0,5 unità / ml 52.5
SuperScript II RT 0.3 1,6 unità / ml 31.5
Totale 16.8 1764

Tabella 2. RT Master Mix 1 e 2 (1).
(1) Preparare RT Master Mix in un clcamera ean, cioè, una stanza in cui non vengono eseguite procedure molecolari e microbiologici.
(2) Il volume finale è saggio RT-40 microlitri.
(3) I volumi mostrano sono basati su 105 saggi. Questo è sufficiente per una piastra PCR a 96 pozzetti con i dosaggi supplementari aggiunti per tenere conto di perdite. La quantità può essere scalato o in funzione del numero di campioni e controlli che verranno analizzati.
(4) Determinare la quantità di epatite G reagente includere nella RT Master Mix 1 come descritto in materiali supplementari Passo S4.

Ingrediente Volume per reazione (ml) (2) Concentrazione finale Volume per Master Mix (ml) (3)
2x LightCycler 480 Sonde Master Mix 10 Proprietaria 1050
Riferimento ROXtintura (4) 0.4 0,5 mm 42
Acqua di grado PCR 1 105
10 micron Entf 0.6 300 Nm 63
10 micron entr 1.8 900 Nm 189
10 micron ENTP 0.2 100 nM 21
Totale 14 1470

Tabella 3. PCR Master Mix per Enterovirus (EV) Assay (1).
(1) Preparare tutti PCR Master Mix in una camera pulita.
(2) Il volume finale dosaggio qPCR è di 20 ml.
(3) I volumi mostrano sono basati su 105 saggi. Questo è sufficiente per una piastra PCR a 96 pozzetti con i dosaggi supplementari aggiunti per tenere conto di perdite. L'importo può essere scalato verso l'alto o verso il basso a seconda del numero di campioni e controlli che sarannoanalizzare.
(4) Sostituire acqua grado PCR di questo reattivo quando si utilizzano strumenti che non lo richiedono.

Ingrediente Volume per reazione (ml) (2) Concentrazione finale Volume per Master Mix (ml) (3)
2x LightCycler 480 Sonde Master Mix 10 Proprietaria 1050
Tintura di riferimento ROX (4) 0.4 0,5 mm 42
Acqua di grado PCR 1.4 147
10 micron NorGIAF 1 500 nM 105
10 micron NorGIAR 1 500 nM 105
10 micron NorGIAP 0.2 100 nM 21
Totale 14 1470

Tabella 4. PCR Master Mix per Norovirus GIA (NoV GIA) Assay (1).
Vedere la Tabella 3 per le note (1) - (4).

Ingrediente Volume per reazione (ml) (2) Concentrazione finale Volume per Master Mix (ml) (3)
2x LightCycler 480 Sonde Master Mix 10 Proprietaria 1050
Tintura di riferimento ROX (4) 0.4 0,5 mm 42
Acqua di grado PCR 0.3 31.5
10 micron NorGIBF 1 500 nM 105
10 micron NorGIBR 1.8 900 Nm 189
10 micron NorGIBP 0.5 250 nM 52.5
Totale 14 1470

Tabella 5. PCR Master Mix per Norovirus GIB (NoV GIB) Assay (1).
Vedere la Tabella 3 per le note (1) - (4).

<td> 0,5 mM
Ingrediente Volume per reazione (ml) (2) Concentrazione finale Volume per Master Mix (ml) (3)
2x LightCycler 480 Sonde Master Mix 10 Proprietaria 1050
Tintura di riferimento ROX (4) 0.4 42
Acqua di grado PCR 0.3 31.5
10 micron NorGIIF 1 500 nM 105
10 micron NorGIIR 1.8 900 Nm 189
10 micron NorGIIP 0.5 250 nM 52.5
Totale 14 1470

Tabella 6. PCR Master Mix per Norovirus GII (NoV GII) Assay (1).
Vedere la Tabella 3 per le note (1) - (4).

Ingrediente Volume per reazione (ml) (2) Concentrazione finale Volume per Master Mix (ml) (3)
2x LightCycler 480 Sonde Master Mix 10 Proprietaria 1050
Tintura di riferimento ROX (4) 0.4 0,5 mm 42
Acqua di grado PCR 0.3 31.5
10 micron MuNoVF1 1 500 nM 105
10 micron MuNoVR1 1.8 900 Nm 189
10 micron MuNoVP1 0.5 250 nM 52.5
Totale 14 1470

Tabella 7. PCR Master Mix per murino Norovirus Assay (1).
Vedere la Tabella 3 per le note (1) - (4).

Ingrediente Volumeper reazione (microlitri) (2) Concentrazione finale Volume per Master Mix (ml) (3)
2x LightCycler 480 Sonde Master Mix 10 Proprietaria 1050
Tintura di riferimento ROX (4) 0.4 0,5 mm 42
Acqua di grado PCR 1.4 147
10 micron HEPF 1 500 nM 105
10 micron HEPR 1 500 nM 105
10 micron Hepp 0.2 100 nM 21
Totale 14 1470

Tabella 8. PCR Master Mix dell'epatite G (HGV) Assay (1).
Vedere

Curva standard Concentrazione Copie genomiche per RT-qPCR Assay (1, 2)
2,5 x 10 8 502.500
2.5 x 10 7 50.250
2,5 x 10 6 5025
2.5 x 10 5 502.5
2,5 x 10 4 50.25
2,5 x 10 3 5,025

Tabella 9. Copia Curva standard genomica.
(1) Identificare i pozzetti curva standard come standard e posizionare le copie genomiche per valori di analisi RT-qPCR nel posto appropriato nel software termociclatore.
(2) Una curva standard accettabile avrà un'efficienza del 70% -110%, Un valore di R 2> 0.97, e una deviazione standard globale di <0,5 per norovirus e <1.0 per enterovirus.

Criteri Valore accettabile
Norovirus Enterovirus
Nel complesso Deviazione Standard <0,5 <1,0
R 2 > 0.97 > 0.97
Efficienza 70% al 115% 70% al 115%

Tabella 10. Criteri Curva standard di accettazione (1).
(1) Le curve standard con efficienze del 70% -110%% sono accettabili, ma valori nel 90% -115% gamma sono l'ideale. I valori inferiori a 90% possono indicare errori di pipettamento o di diluizione.

QA Componente Media Recupero Range (%) Coefficiente di variazione (%)
Lab Bianco reagente; campioni PT o PE negativi 0 N / A (1)
Lab fortificato in bianco; Lab matrice del campione fortificata 5-200 N / A
Campioni PT positivo e PE 15-175 ≤130

Tabella 11. Metodo 1615 Criteri relativi alle prestazioni.
(1) Non applicabile.

Media Composizione
0,15 M di fosfato di sodio, pH 7,0-7,5 Preparare fosfato 0,15 M di sodio sciogliendo 40,2 g di fosfato di sodio dibasico (Na 2 HPO 4 · 7H 2 O) in un volume finale di 1 L dH
5% BSA Preparare sciogliendo 5 g di BSA in 100 ml di dH 2 O. Sterilizzare facendo passare la soluzione attraverso un filtro sterilizzante da 0,2 micron.
PBS, BSA 0,2% Preparata aggiungendo 4 ml di 5% BSA a 96 ml di PBS. Sterilizzare facendo passare la soluzione attraverso un filtro sterilizzante da 0,2 micron.
Buffer TSM III Sciogliere 1,21 g Trisma base, 5,84 g di NaCl, 0,203 g MgCl 2, 1 ml di gelatina Prionex, e 3 ml di Mikrozid III in 950 ml di acqua distillata. Portare il pH a 7,0 e quindi portare il volume finale a 1 L. Sterilizzare facendo passare la soluzione attraverso un filtro sterilizzante da 0,2 micron.
0,525% di ipoclorito di sodio (NaClO) Preparare una soluzione di NaClO 0,525% diluendo candeggina 1:10 in dH 2 O. Conservare 0,525% soluzioni NaClO per un massimo di 1 settimana a RT.
1-M tiosolfato di sodio (Na 2 S 2 O 3) pentaidrato Preparare una soluzione 1 M sciogliendo 248,2 g di Na 2 S 2 O 3 in 1 L di dH 2 O. Conservare tiosolfato di sodio per un massimo di 6 mesi a temperatura ambiente.

Tabella 12. Tabella di Media.

Discussion

Larga scala studi nazionali di contaminazione virale di acque di fonte e bere richiedono l'utilizzo di più laboratori di analisi. In queste condizioni è necessario un metodo standard per garantire che i dati generati dai diversi laboratori è paragonabile. Ci sono molti metodi molecolari pubblicati di individuazione del virus, ma molto pochi metodi molecolari standardizzati. Metodo EPA 1615 è un metodo standardizzato specificamente progettato per il rilevamento di enterovirus e norovirus in matrici di acqua mediante RT-qPCR. Metodi molecolari standardizzati sono disponibili per il rilevamento di virus negli alimenti (CEN / TS 15216-1 e ISO CEN / TS 15216-2 ISO, 7 Aprile 2013) 16,17 e sono state applicate al rilevamento di virus dell'epatite A e norovirus in primavera acqua 16. Tutti i metodi standard devono comprendere controlli delle prestazioni di qualità e criteri per ridurre al minimo inter- e variazione intra-laboratorio e dati falsi positivi dovuti a contaminazione da laboratorio. Per ridurre ulteriormente i dati falsi, EMetodo PA 1615 segue la guida di EPA sui metodi molecolari, 18, ​​che prevede la separazione del lavoro durante la lavorazione e un modo flusso di lavoro. Esso comprende una epatite G 1,19 procedure di controllo e di ridurre al minimo risultati falsi negativi a causa di inibitori della RT-qPCR 15 interno. Esso utilizza analisi quantitative con volumi standardizzati sia di acqua campionata e acqua analizzata in modo che tutti i dati di campo è espressa in copie genomiche per litro del campo o di bere acqua campionata. Sebbene efficiente tubo singolo (one-step) saggi di RT-PCR sono disponibili in commercio, il metodo utilizza intenzionalmente test separati. Questo ha lo svantaggio di minimizzare la quantità di campione che può essere analizzato in ciascuna reazione, ma offre una maggiore flessibilità di impiego di più set di primer. Saggi di RT-qPCR sono limitati da e solo buono come primer e le sonde utilizzati e probabilmente senza primer rileveranno tutte le varianti del virus all'interno di un gruppo. Il set di primer enterovirus è stato scelto perchéesso si rivolge la regione codificante 5'-non conservati, 20,21 rileva una vasta gamma di sierotipi enterovirus e virus rilevati da esso sono associate con effetti sulla salute dal consumo di acque sotterranee non trattate 1. Due set di primer sono utilizzati per il rilevamento di genogruppo I norovirus 22,23. Il primo è stato scelto a causa della forte correlazione tra gli effetti sulla salute nei bambini e rilevato il virus 1. Il secondo genogruppo I set di primer e il set di primer utilizzato per genogruppo II norovirus sono stati scelti perché rilevano la più ampia varietà di ceppi 24,25.

Nonostante i principali vantaggi di procedure qPCR e RT-qPCR per la rilevazione di RNA virale in acqua, ci sono diverse limitazioni. In primo luogo, entrambe le particelle virali infettive e non infettive, comprese quelle inattivato da disinfettanti, possono essere amplificati da tali regimi. I risultati di Borchardt suggeriscono che si tratta di meno di un problema per le acque sotterranee non trattate facquiferi rom simili a quelli nelle comunità studiate che per le acque superficiali disinfettati 1. Per i virus coltivabili questo problema può essere superato utilizzando PCR in combinazione con la cultura 26,27. Il problema è stato affrontato anche per alcuni virus attraverso l'uso di acido nucleico reticolanti agenti 28-30. Quest'ultimo approccio è più efficace per i virus inattivati ​​ipoclorito e non efficaci per coloro inattivato da UV.

Una seconda limitazione di queste procedure molecolari è che il volume di campione concentrato che possono essere analizzati in genere è molto più piccolo di quello utilizzato per le procedure di coltura 6,31. Questo problema è spesso effettuata o sostituendo una procedura basata glicole-polietilene per la concentrazione secondaria standard con flocculazione organica, che permette al campione da risospeso in un volume più piccolo, o con l'aggiunta di una concentrazione del campione terziaria passo 6,32,33 . Metodo 1615 utilizza centrifultrafiltrazione ugal per fornire la concentrazione terziaria. Ultrafiltrazione centrifuga rimuove l'acqua e componenti meno di 30.000 Daltons conseguente sia la concentrazione di qualsiasi virus in campioni di prova e una riduzione in piccoli inibitori peso molecolare di saggi molecolari. Questo terziarie risultati fase di concentrazione in un fattore di concentrazione> 10 5 per qualsiasi virus che era presente nell'acqua in fase di test.

Una terza limitazione è la presenza di inibitori di procedure molecolari in campioni ambientali. Sebbene siano stati sviluppati numerosi approcci per rimuovere inibitori, nessun metodo è efficace per tutte le matrici acqua e virus tipi 6,34,35, rendendo l'uso di controlli interni volti a stimare il livello di inibizione essenziale. Il reagente epatite G utilizzata in questo metodo soddisfa questa esigenza fornendo un livello costante di RNA virale in tutte le reazioni e un saggio RT-qPCR per stimare inibizione. Quando il meglio di tegli inibitore approcci rimozione non riescono a rimuovere l'inibizione, concentrati campione possono essere diluiti fino a quando le concentrazioni di virus sono più alti di inibitori concentrazioni 14,15.

La procedura curva standard qui descritta presenta vantaggi e una limitazione importante. Un vantaggio è che il reagente utilizzato fornisce tutti i componenti necessari in un unico reattivo, consentendo un unico comando da utilizzare per tutti i saggi. Questo reagente è particolarmente un vantaggio per le analisi norovirus. Norovirus particelle possono essere ottenuti solo da individui infetti che rende molto difficile ottenere particelle virali per l'uso come standard. Un altro importante vantaggio è che fornisce uno standard per tutti i virus RNA RNA target in un reagente, come avente un livello di RNA è essenziale per la quantificazione accurata di RNA 36. Tuttavia, la sua capacità di quantificare virus precisione è limitata dal fatto che gli effetti di matrice non vengono presi in considerazione. Ciò significa che la copia genomicaI valori numerici non possono essere considerati assoluta e devono essere considerati solo in termini relativi. Si raccomanda che un numero sufficiente di curva standard di Stock Working aliquote (punto 1.2) essere pronta a coprire studi completi. Per esempio, ogni 250 microlitri aliquota fornisce reagente sufficiente per 6 piastre RT. Se è noto che uno studio richiederà analisi di 500 campioni, sarebbe necessario un minimo di 12 aliquote (500 campioni / 7 campioni per piastra RT / 6 piatti RT per aliquota).

Metodo EPA 1615 è un metodo basato sulle prestazioni. Molti produttori fanno reagenti equivalenti a quelle specificate e questi reagenti possono essere sostituiti a condizione che siano rispettati i criteri di performance. La curva standard, che serve anche come controllo positivo RT-qPCR, è di valore in problemi di prestazioni di risoluzione dei problemi. Le prestazioni possono diminuire a causa di degradazione dell'RNA, shelf life del reagente, il fallimento di congelatori, calibrazione dello strumento, e errore tecnico. Problemi di prestazioni devono essere sospettied se curve standard differisce da quella illustrata nella figura 4 o se non sono conformi alle specifiche prestazioni per curve standard. Il test RT-qPCR è abbastanza robusto; completo fallimento è probabilmente dovuto a un uso improprio di RNA o errore tecnico (ad esempio, un reagente mancante). Grande cura dovrebbe essere presa in gestione di campioni di RNA tra l'estrazione e il passo RT per ridurre la degradazione dell'RNA da ribonucleasi.

Recuperi poliovirus di acque sotterranee e di grado reagente e recuperi norovirus murini dalla falda incontrato il metodo EPA 1615 criteri di accettazione delle prestazioni (Tabella 11), e sono simili a quelli riportati da altri 33,37,38. Recuperi norovirus murini da campioni LFB erano molto inferiori a quelli dei poliovirus e non avrebbero soddisfatto i criteri di accettazione specifici poliovirus. Le ragioni di basso recupero norovirus murino di acqua distillata sono sconosciuti. Simili ai risultati nel presente documento, Karim e Colleagues segnalato un recupero per norovirus GI.1 del 4% da acqua di rubinetto 39. Lee et al. 37 riportato recuperi medi di norovirus murino e GII.4 norovirus umana del 18% e il 26% da acqua distillata con filtri a disco, rispettivamente. Utilizzando condizioni simili a Lee e colleghi, Kim e Ko osservato recuperi del 46% e del 43% per questi virus, rispettivamente, 38. Gibbons et al. 40 ottengono circa 100% di recupero di GII.4 norovirus umana da acqua di mare, ma Kim e Ko 38 hanno trovato che l'aggiunta di sale e l'acqua distillata a concentrazioni simili o superiori di mare significativamente ridotta recuperi del virus murino e portato in una riduzione di due volte nel recupero GII.4.

Materials

Name Company Catalog Number Comments
1.5 ml tube chamber Diversified Biotech CHAM-3000
1 °C cool brick Diversified Biotech BRIK-2501
10x PCR Buffer II and 25-mM MgCl2 Life Technologies N8080130
-20 °C freezer VWR 97043-346 Must be a manual defrost freezer
-70 °C or colder freezer Thermo Scientific MBF700LSAO-E
96-well chamber Diversified Biotech CHAM-1000
Absolute ethanol Fisher Scientific BP2818-100
Armored RNA EPA-1615 Asuragen Custom order Used for quantifying the RT-qPCR assay
Armored RNA Hepatitis G virus Asuragen 42024
Autoclave Steris Amsco Lab Series
Biosafety cabinet NuAir Laboratory Equipment Supply Labgard 437 ES
Bovine serum albumin (BSA) Affymetrix 10856 Crystalline grade or better
Buffer AVE Qiagen 1026956 Carrier RNA dilution buffer
Buffer AVL Qiagen 19073 Extraction buffer
Carrier RNA Qiagen Not applicable Use carrier RNA supplied with Buffer AVL
Centrifuge bottles Fisher Scientific 05-562-23 or 05-562-26
Centrifuge rotors Beckman Coulter 339080, 336380
Cool safe box Diversified Biotech CSF-BOX
Dithiothreitol (DTT) Promega P1171
LightCycler® 480 Probes Master kit Roche Diagnostics 4707494001
Microcentrifuge tubes Fisher Scientific 02-682-550 Use ribonuclease- and deoxyribonuclease-free tubes with snap caps
Microcide III Fitzgerald 99R-103
Microseal 'A' film Bio-Rad Laboratories HSA5001 Heat resistant
Microseal 'F' film Bio-Rad Laboratories MSA1001 Freezer resistant
Mini-plate spinner Labnet International MPS1000
Multichannel pipette Rainin L8-20
Multi-tube chamber Diversified Biotech CHAM-5000
Optical reaction plate Life Technologies 4314320
PCR nucleotide mix Promega U1515
PCR plate Bio-Rad Laboratories HSS9601
PCR-grade water Roche 3315932001
Phosphate buffered saline (PBS) U.S. Biological D9820
Plate mixer Scientific Industries MicroPlate Genie
Prionex gelatin Sigma Aldrich G0411
QIAamp DNA Blood Mini Kit Qiagen 51104 Includes Buffers AW1 (first wash buffer), AW2 (second wash buffer), AE (elution buffer); ethanol must be added to Buffers AW1 and AW2 before use; Do not use Buffer AL supplied with the kit
Quantitative PCR thermal cycler Life Technologies 4351405
Random primer Promega C1181
Reagent Reservoir Fisher Scientific 21-381-27E
Refrigerated centrifuge Beckman Coulter 367501
RNase Inhibitor Promega N2515 or N2615
ROX reference dye Life Technologies 12223
SuperScript II or III Reverse Transcriptase Life Technologies 18064-022 or 18080044
Surgical gloves Fisher Scientific 19-058-800
Thermal cycler Life Technologies 4314879
Trisma base Sigma Aldrich T1503
Vivaspin 20 centrifugal concentrator units Sartorius-Stedim VS2022

DOWNLOAD MATERIALS LIST

References

  1. Borchardt, M. A., Spencer, S. K., Kieke, B. A., Lambertini, E., Loge, F. J. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness. Environ. Health Perspect. 120, (9), 1272-1279 (2012).
  2. Ye, X. Y., et al. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 65, (3), 244-253 (2012).
  3. Williamson, W. M., et al. Enteric viruses in New Zealand drinking-water sources. Water Sci. Technol. 63, (8), 1744-1751 (2011).
  4. Lambertini, E., Borchardt, M. A., Kieke, B. A., Spencer, S. K., Loge, F. J. Risk of viral acute gastrointestinal illness from nondisinfected drinking water distribution systems. Environ. Sci. Technol. 46, (17), 9299-9307 (2012).
  5. Chigor, V. N., Okoh, A. I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health. 9, (11), 4017-4032 (2012).
  6. Fout, G. S., Martinson, B. C., Moyer, M. W., Dahling, D. R. A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl. Environ. Microbiol. 69, (6), 3158-3164 (2003).
  7. Hewitt, J., Bell, D., Simmons, G. C., Rivera-Aban, M., Wolf, S., Greening, G. E. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski resort. Appl. Environ. Microbiol. 73, (24), 7853-7857 (2007).
  8. Jack, S., Bell, D., Hewitt, J. Norovirus contamination of a drinking water supply at a hotel resort. New Zealand Med. J. 126, (1387), 98-107 (2013).
  9. Anderson, A. D., et al. A waterborne outbreak of Norwalk-like virus among snowmobilers-Wyoming, 2001. J. Infect. Dis. 187, (2), 303-306 (2003).
  10. Parshionikar, S. U., et al. Waterborne outbreak of gastroenteritis associated with a norovirus. Appl. Environ. Microbiol. 69, (9), 5263-5268 (2003).
  11. U.S. Environmental Protection Agency Office of Water. 820-F-12-058: Recreational Water Quality Criteria. 1-63 (2012).
  12. Wade, T. J., et al. Rapidly measured indicators of recreational water quality and swimming-associated illness at marine beaches: a prospective cohort study. Environ. Health. 9, 66 (2010).
  13. Fout, G. S., et al. Method 1615: Measurement of enterovirus and norovirus occurrence in water by culture and RT-qPCR (EPA/600/R-10/181). U. S. Environmental Protection Agency. 1-91 (2012).
  14. Cashdollar, J. L., et al. Development and Evaluation of EPA Method 1615 for Detection of Enterovirus and Norovirus in Water. Appl. Environ. Microbiol. 79, (1), 215-223 (2013).
  15. Gibson, K. E., Schwab, K. J., Spencer, S. K., Borchardt, M. A. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 46, (13), 4281-4291 (2012).
  16. Fuentes, C., et al. Standardized multiplex one-step qRT-PCR for hepatitis A virus, norovirus GI and GII quantification in bivalve mollusks and water. Food Microbiol. 40, 55-63 (2014).
  17. Coudray, C., Merle, G., Martin-Latil, S., Guillier, L., Perelle, S. Comparison of two extraction methods for the detection of hepatitis A virus in lettuces using the murine norovirus as a process control. J. Virol. Methods. 193, (1), 96-102 (2013).
  18. Sen, K., et al. EPA 815-B-04-001: Quality assurance/quality control guidance for laboratories performing PCR analyses on environmental samples. U.S. Environmental Protection Agency. 1-56 (2004).
  19. Schlueter, V., Schmolke, S., Stark, K., Hess, G., Ofenloch-Haehnle, B., Engel, A. M. Reverse transcription-PCR detection of hepatitis G virus. J. Clin. Microbiol. 34, (11), 2660-2664 (1996).
  20. De Leon, R., Shieh, C., Baric, R. S., Sobsey, M. D. Detection of enteroviruses and hepatitis A virus in environmental samples by gene probes and polymerase chain reaction. Proc. Water Qual. Technol. Conf. 1990 Nov 11-15, 833-853 (1990).
  21. Monpoeho, S., et al. Quantification of enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques. 29, (1), 88-93 (2000).
  22. Jothikumar, N., et al. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl. Environ. Microbiol. 71, (4), 1870-1875 (2005).
  23. da Silva, A. K., et al. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl. Environ. Microbiol. 73, (24), 7891-7897 (2007).
  24. Butot, S., et al. Evaluation of various real-time RT-PCR assays for the detection and quantitation of human norovirus. J. Virol. Methods. 167, (1), 90-94 (2010).
  25. Loisy, F., et al. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods. 123, (1), 1-7 (2005).
  26. Reynolds, K. A., Gerba, C. P., Pepper, I. L. Detection of infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62, (4), 1424-1427 (1996).
  27. Ming, H. X., Zhu, L., Zhang, Y. Rapid quantification of infectious enterovirus from surface water in Bohai Bay, China using an integrated cell culture-qPCR. Mar. Pollut. Bull. 62, (10), 2047-2054 (2011).
  28. Parshionikar, S., Laseke, I., Fout, G. S. Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl. Environ. Microbiol. 76, (13), 4318-4326 (2010).
  29. Sanchez, G., Elizaquivel, P., Aznar, R. Discrimination of infectious hepatitis A viruses by propidium monoazide real-time RT-PCR. Food Environ. Virol. 4, (1), 21-25 (2012).
  30. Kim, S. Y., Ko, G. Using propidium monoazide to distinguish between viable and nonviable bacteria, MS2 and murine norovirus. Lett. Appl. Microbiol. 55, (3), 182-188 (2012).
  31. Fout, G. S., Schaefer, F. W. 3rd, Messer, J. W., Dahling, D. R., Stetler, R. E. EPA/600/R-95/178: ICR Microbial Laboratory Manual, I.1-ApD-23. U.S. Environmental Protection Agency. (1996).
  32. Abbaszadegan, M., Stewart, P., LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 65, (2), 444-449 (1999).
  33. Lambertini, E., et al. Concentration of enteroviruses, adenoviruses, and noroviruses from drinking water by use of glass wool filters. Appl. Environ. Microbiol. 74, (10), 2990-2996 (2008).
  34. Rodriguez, R. A., Thie, L., Gibbons, C. D., Sobsey, M. D. Reducing the effects of environmental inhibition in quantitative real-time PCR detection of adenovirus and norovirus in recreational seawaters. J. Virol. Methods. 181, (1), 43-50 (2012).
  35. Iker, B. C., Bright, K. R., Pepper, I. L., Gerba, C. P., Kitajima, M. Evaluation of commercial kits for the extraction and purification of viral nucleic acids from environmental and fecal samples. J. Virol. Methods. 191, (1), 24-30 (2013).
  36. Fey, A., et al. Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism. Appl. Environ. Microbiol. 70, (6), 3618-3623 (2004).
  37. Lee, H., et al. Evaluation of electropositive filtration for recovering norovirus in water. J. Water Health. 9, (1), 27-36 (2011).
  38. Kim, M., Ko, G. Quantitative characterization of the inhibitory effects of salt, humic acid, and heavy metals on the recovery of waterborne norovirus by electropositive filters. J. Water Health. 11, (4), 613-622 (2013).
  39. Karim, M. R., Rhodes, E. R., Brinkman, N., Wymer, L., Fout, G. S. New electropositive filter for concentrating enteroviruses and noroviruses from large volumes of water. Appl. Environ. Microbiol. 75, (8), 2393-2399 (2009).
  40. Gibbons, C. D., Rodriguez, R. A., Tallon, L., Sobsey, M. D. Evaluation of positively charged alumina nanofibre cartridge filters for the primary concentration of noroviruses, adenoviruses and male-specific coliphages from seawater. J. Appl. Microbiol. 109, (2), 635-641 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics