Generazione di ricombinante umano IgG anticorpi monoclonali da immortalizzate cellule ordinati B

* These authors contributed equally
JoVE Journal
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nogales-Gadea, G., Saxena, A., Hoffmann, C., Hounjet, J., Coenen, D., Molenaar, P., Losen, M., Martinez-Martinez, P. Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells. J. Vis. Exp. (100), e52830, doi:10.3791/52830 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

L'obiettivo di questo articolo è quello di descrivere in dettaglio una metodologia per generare e caratterizzare gli anticorpi monoclonali IgG umane ottenute da cellule umane mononucleate del sangue periferico (PBMC).

L'interesse per lo studio anticorpi umani si è sviluppata in diversi campi di ricerca. In particolare, molti gruppi di ricerca sono interessati alla patologia causata da autoanticorpi 1-3. Abbiamo clonato e caratterizzato patogeni auto-anticorpi 1. Lo studio di auto-anticorpi può aiutare a identificare i loro obiettivi e per lo sviluppo di strategie terapeutiche, ad esempio, l'uso di anticorpi concorrenti 4. Inoltre, lo studio di anticorpi umani può anche essere di interesse in altri campi di ricerca, cioè, per valutare la risposta immunitaria dopo la vaccinazione 5, per caratterizzare il profilo di anticorpi di individui che sono stati esposti e che sono diventate resistenti a patogeni specifici 6 o per studiare quale anticorpi sono inil repertorio naturali 7,12.

Numerose tecniche sono state sviluppate per generare anticorpi monoclonali umani ricombinanti 8-12; la maggior parte di questi utilizzano phage display e immortalizzazione cellule B. L'uso di phage display è stato ampiamente applicato per la scoperta di nuovi anticorpi 13. Tuttavia ha un grande svantaggio, vale a dire che le coppie di catena pesante e leggera della immunoglobulina umana diventare dissociato nel processo. La produzione di ibridomi con cellule B umane o trasformazione EBV supera questo inconveniente.

Usiamo l'infezione delle cellule B del timo con EBV in combinazione con la stimolazione delle cellule B policlonale via Toll-like receptor 9 (TLR-9) 6,12.

In questo articolo, descriviamo in dettaglio la tecnologia che usiamo per lo sviluppo di anticorpi umani IgG, con una panoramica completa di tutte le fasi di isolamento PBMC alla vitro generazione di anticorpi in. Questoprotocollo può essere utilizzato per l'analisi di qualsiasi tipo di profilo IgG umana. Nel nostro laboratorio, le cellule B che producono anticorpi IgG sono stati separati con successo dal resto del PBMC dopo la cernita. Cinquanta ordinati cellule B 8 possono essere placcati in piastre multi-pozzetti e immortalati da EBV e TLR-9 di attivazione, per l'espansione clonale di singole cellule B. Come cellule feeder, sono stati utilizzati fibroblasti di tessuto polmonare embrionali, linea cellulare wi38, che facilita la visualizzazione delle cellule B immortalizzate. Da queste cellule B, le sequenze delle catene pesanti e leggere di immunoglobulina possono essere ottenuti mediante PCR, e geni gli anticorpi 'clonati in vettori di espressione immunoglobulina G e prodotti in vitro. Usando questa tecnica, singoli anticorpi con esattamente la stessa sequenza anticorpo trovato nel donatore possono essere studiate.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Il consenso informato è stato ottenuto dai partecipanti allo studio. Lo studio è stato approvato dal comitato etico istituzionale.

1. Isolamento di cellule mononucleate del sangue periferico (PBMC)

  1. Centrifugare 25 ml di sangue eparinizzato dei partecipanti a 900 xg per 15 min, non appena possibile dopo l'estrazione del sangue. Se c'è meno sangue, ridimensionare i reagenti di conseguenza. Eseguire tutti i passi successivi in ​​un cappuccio.
  2. Trasferire il siero in una provetta pulita. Può essere utilizzato nelle fasi successive per il congelamento PBMC o in caso di pazienti autoimmuni, per testare auto-anticorpi.
  3. Diluire il sangue con 10 ml di RPMI 1640 media e risospendere le cellule pipettando su e giù.
  4. Aggiungere 15 ml di una soluzione contenente polysucrose e sodio diatrizoato (1.077 g / ml) in un tubo da 50 ml.
  5. Strato delicatamente il sangue sulla parte superiore della soluzione in fase 1.4 portando le due aperture del tubi vicino togetlei finché i due liquidi vengono molto lentamente a contatto, e poi decantare la sospensione PBMC lentamente sopra il tubo 50 ml. Questo passaggio è fondamentale per avere una buona separazione delle PBMC.
  6. Centrifugare il tubo ottenuto nel passaggio 1,5 a 400 xg senza freno a temperatura ambiente per 20 min.
  7. Dopo la centrifugazione, recuperare con la pipetta l'anello bianco che appare nella parte centrale del tubo, che contiene i PBMCs.
  8. Lavare le cellule con 25 ml di RPMI 1640 media.
  9. Centrifugare 300 xg a temperatura ambiente per 10 min.
  10. Eliminare il surnatante e lavare le cellule con 10 ml di RPMI 1640. Centrifuga di nuovo come al punto 1.9.
  11. Contare i PBMC con una camera di Neubauer come riportato in precedenza 14.
  12. Elaborare il PBMC come nella sezione 2 o memorizzarli per un uso successivo come segue: 10 milioni di PBMC per congelamento per provetta esageratamente diluito in 1 ml di 10% dimetilsolfossido (DMSO) e 90% di siero ottenuti nel passo 1.2. Congelare progressivamente e per lungo tempo stola rabbia in azoto liquido.

2. colorazione PBMC per Ordinamento CD22 + e IgG + da Cell Citometria

  1. Piastra le PBMC in 25 cm 2 cella pallone di coltura con 6 ml di completo RPMI 1640 (integrato con L-glutammina, tampone HEPES 10 mM, 50 U / ml di penicillina, 50 mg / ml di streptomicina e 10% di siero fetale bovino) e far loro recuperare O / N in incubatrice a 37 ° C al 5% di CO 2.
  2. Bloccare i tubi FACS sterili con sterile 4% di albumina tampone fosfato salino (PBS) Soluzione O / N. Lavare le provette due volte con PBS e riempirli con 500 microlitri di completo RPMI 1640 medium. Utilizzare questi tubi per il recupero delle cellule dopo la cernita.
  3. Raccogliere le PBMC in un tubo e centrifugare a 400 xg a temperatura ambiente per 5 min.
  4. Risospendere le cellule in tampone di etichettatura (vedere i passi 2.5 e 2.6) e contarli 14. Il buffer di etichettatura è 2% di siero fetale bovino sterile e 1 mM di acido etilendiamminotetraacetico (EDTA) in PBS.
  5. Preparare 3 separazione delle cellule (FACS) i tubi a fluorescenza-attivato con 10 5 cellule ciascuno e li risospendere in 100 ml di buffer di etichettatura. Questi tubi serviranno per definire le porte di smistamento.
    1. Nel primo tubo aggiungere 5 ml di anticorpo anti CD22 PerCP (raccomandato nella scheda tecnica del produttore), nel secondo tubo 20 ml di anticorpi anti IgG PE (raccomandato nella scheda tecnica del produttore), e nulla nel terzo tubo. Incubare su ghiaccio e nel buio durante 30 min.
  6. Risospendere 5 milioni di cellule in 200 ml di buffer di etichettatura in un tubo FACS ed aggiungere 10 ml di anticorpi anti CD22 PerCP e 40 ml di IgG contro PE. Incubare le cellule su ghiaccio e buio durante 30 min. Se si desidera la selezione di un numero maggiore di cellule, scalare tutti i reagenti.
  7. Cellule centrifugare a 400 xg con un freno basso per 5 minuti a temperatura ambiente.
  8. Decantare delicatamente il surnatante.
  9. Risospendere le cellule in 500 μl di tampone di etichettatura. Cellule centrifugare a 400 xg con un freno basso per 5 minuti a temperatura ambiente. Ripetere i punti 2.7 e 2.8
  10. Decantare dolcemente il surnatante e risospendere le cellule in 300 ml di RPMI multimediale completo.
  11. Passare le cellule attraverso un filtro da 0,45 micron. Le cellule sono pronti a ordinare.

3. L'ordinamento delle cellule B CD22 + e IgG +

  1. Utilizzare 3 tubi di controllo per stabilire la vitalità delle cellule. Nel controllo, senza macchie, utilizzare la trama in avanti e le dimensioni scatter per definire il gating dei linfociti. I controlli con il CD22 PerCP e anti-IgG PE servono a stabilire le porte e il cancello di smistamento. Eseguire i seguenti dati precedentemente riportati 15.
    Nota: Un cancello è un insieme di valori limite (confini) che servono ad isolare un gruppo specifico di eventi citometriche, nelle nostre cellule caso, da un grande insieme. Nel caso di una porta di smistamento limiti valore consente il recupero degli eventi citometria, cellule, che sono all'interno dellai confini stabiliti: CD22 + e IgG +.
  2. Come un tubo di raccolta di smistamento, utilizzare i tubi bloccati con 500 ml di completo RPMI 1640 medium, ottenuti a partire dal punto 2.2.
  3. Procedere per ordinare doppia positiva 15: CD22 + IgG +. Annotare il numero totale di cellule in ogni condizione. Piatto allineati cellule in cima cellule feeder appena possibile.

4. L'irradiazione di cellule di alimentazione

Nota: eseguire la preparazione delle cellule di alimentazione tra 1-3 giorni prima di ordinamento. Almeno 5.000 wi38 cellule sono necessari per pozzetto in una piastra ben rotondo 96. Eseguire le operazioni 4.1, 4.2 e 4.4 in un cappuccio.

  1. Coltivare le cellule wi38 a 37 ° C e 5% CO 2 in completo RPMI 1640 medium (come per PBMC) finché il numero desiderato di cellule vengono raggiunti.
  2. Li Irradiare a 50 Grays, seguendo un protocollo descritto in precedenza 16. Eseguire irradiazione una volta che le cellule sono state wi38 tripsinizzati e risospese in complete mezzo RPMI, o con wi38 attaccato al pallone di coltura e tripsinizzati dopo l'irradiazione. Seguire il metodo per tripsinizzazione indicata dal fornitore di cellule wi38. Irradiare il numero di cellule necessarie per coprire i pozzetti necessari per la placcatura cellule IgG + B (1% del totale PBMC conteggiato nel passo 1.11).
  3. Piatto 90 ml contenenti 5.000 irradiati wi38 cellule in ciascun pozzetto della piastra ben rotondo 96. Lasciare i pozzetti nella riga esterna del piatto vuoto (perché evaporano più velocemente), e utilizzare solo i 60 pozzi nel centro del piatto per la placcatura cellule. Riempire i pozzetti esterni che sono incorniciano il piatto con 200 ml di PBS.
  4. Metterli in un incubatore a 37 ° C al 5% di CO 2, fino a quando necessario.

5. placcatura Ordinati PBMC, EBV Infezione e Growing

  1. Diluire le PBMC ordinati, alla piastra 50 cellule in 50 ml di terreno RPMI 1640 completo per bene in 96 pozzetti rotondo (wit precedenza placcatoh wi38 cellule irradiate). Eseguire le operazioni in un cappuccio attrezzato per lavoro EBV.
    Nota: l'infezione di 50 cellule per pozzetto è ottimizzato ed aumenta la likehood per produrre un anticorpo monoclonale 8, tuttavia, si consiglia di verificare questo mediante PCR come descritto sopra 1,6.
  2. Aggiungere 60 ml di EBV surnatante (contenenti 3-4 x 10 8 copie virali / ml) in ciascun pozzetto della piastra ben 96 rotondo 17. Si deve usare cautela durante il lavoro EBV.
  3. Aggiungere 1 mg / ml di CpG (ODN2006) per pozzetto.
  4. Lasciare le cellule in un incubatore a 37 ° C al 5% di CO 2.
  5. Visivamente clone Monitor crescente al microscopio dopo una settimana.
    Nota: Alcuni esempi di crescita delle cellule B può essere visto sotto nella sezione dei risultati. Si noti che i tassi di crescita dei cloni possono variare, e più tempo, potrebbe essere necessario iniziare a vedere un po 'di massa di cellule che cresce nel mezzo del pozzo.
  6. Dopo il 1 ° due settimaneclone Monitor s crescente sotto il microscopio ottico e procedere al primo scambio dei media. Lentamente pipettare 90 ml di terreno dalla parte superiore del pozzo e raccogliere in una piastra a 96 pozzetti pulita. (Cellule B si trovano nel fondo del pozzo, quindi non c'è alcun rischio per aspirare loro).
    1. Aggiungere ad ogni pozzetto 100 ml di completo RPMI 1640 multimediale integrato con 1 mg / ml di CpG (ODN2006) e 50 U / ml di IL2. Se i cloni sono in crescita, analizzare questo primo scambio media da parte ELISA come al punto 6.
  7. Monitorare clone crescere e cambiare media dopo la 3 ° e la 4 ° settimana di crescere di nuovo prendendo 90 ml di mezzi di comunicazione e l'aggiunta di 100 ml di completo RPMI 1640 multimediale integrato con 1 mg / ml di CpG (ODN2006) e 50 U / ml di IL2. Utilizzare il surnatante raccolte per monitorare la produzione da IgG ELISA come al punto 6.
    Nota: Dopo un clone di mese in crescita dovrebbe essere evidente osservando aggregati di cellule rotonde that solito si trovano in mezzo al fondo tondo bene.
  8. A questo punto, cambiare supporto allo stesso modo che le settimane precedenti ma solo con completi RPMI 1640 media. Un buon indicatore per conoscere il momento di cambiare i media è il colore dei media, se sta diventando cellule giallastri hanno bisogno di un cambio dei media.
  9. Quando piastre a 96 pozzetti vengono contenenti grandi cloni (circa 5 x 10 5 cellule), trasferirli in un pozzo piano di un 24-pozzetti. Aggiungere 300 ml di completo RPMI 1640 media per il nuovo pozzo. Risospendere il clone 96 pozzetti in crescita, pipettando su e giù parecchie volte, e le cellule di trasferimento al nuovo pozzo, distribuendo in modo omogeneo. Aggiungi nuovo supporto quando necessario.
    1. Quando pozzetti della piastra da 24 pozzetti sono pieni di cellule (circa 5 x 10 6 cellule), trasferire ad un pozzo piatta di una piastra da 6 pozzetti. Aggiungere 2 ml di completi RPMI 1640 media per il nuovo pozzo. Risospendere le cellule nella piastra da 24 pozzetti pipettando su e giù parecchie volte, e distribuirli omogeneamente nel nuovo pozzo.
  10. Aggiungere supporto quando necessario. Se le cellule non devono essere mantenute in coltura, agglomerare le cellule a 400 xg per 5 minuti a temperatura ambiente. Conservare il surnatante per il test ELISA. Lavare il pellet di cellule una volta con 1 x PBS, centrifugare di nuovo a 400 xg per 5 min, e secco conservati a -80 ° C fino al momento dell'estrazione dell'RNA.
    1. Quando le cellule nella piastra da 6 pozzetti divengono confluenti (circa 20 x 10 6 cellule), trasferimento in una piastra di coltura 60 mm. Aggiungere 4 ml di completo RPMI 1640 media per la nuova piastra. Risospendere le cellule in 6 pozzetti e trasferirli come fatto è i passi 5.9 e 5.10.
  11. Aggiungi nuovo supporto quando necessario. A questo punto, congelare cellule a 10-30.000.000 / ml nel siero di vitello fetale 90% e 10% DMSO. Se grandi quantità di cellule sono ricercati, proseguire l'espansione dei cloni in piani di riscontro più grandi.

6. ELISA per IgG anticorpo di rilevazione

  1. Dispensare 50 ml / pozzetto in una piastra ELISA of capra F (ab) anticorpi Fc 2 antiumano diluito 1 200 in tampone di rivestimento. Tampone di rivestimento contiene 50 mM Na 2 CO 3 pH 9,6.
  2. Sigillare le piastre con un adesivo di plastica, e incubare 1 ora a 37 ° C. In alternativa, incubare a 4 ° CO / N.
  3. Lavare ogni ben 6 volte con 200 ml di tampone di lavaggio. Tampone di lavaggio contiene 0,05% Tween-20 in 1 x PBS. Non toccare o graffiare la superficie pozzo dove l'anticorpo si è legato.
  4. Bloccare con tampone di arresto, 100 l / pozzetto. Blocco tampone contiene 4% di latte in polvere senza grassi in PBS. Sigillare la piastra e incubare 1 ora a 37 ° C.
  5. Non lavare. Scartare tampone bloccante e schiaffo la piastra 3 volte a testa in giù su un tovagliolo di carta per rimuovere il liquido residuo.
  6. Incubare supernatanti e standard cloni.
    1. Per un primo test, diluire surnatanti clone ottenuti nella fase 5.6 o 5.7 1/3 in RPMI. Per gli standard di diluire con RPMI soluzione a medio IgG umano di ottenere: 1,000 ng /ml, 500 ng / ml, 250 ng / ml, 125 ng / ml, 62,5 ng / ml, 31,25 ng / ml, 15,6 ng / ml e vuoto. Utilizzare 50 microlitri / pozzetto ed incubare a 37 ° C per 60 min. Analizzare ulteriormente diluizioni del clone supernatante 'per testare l'affinità di anticorpi, come 1/10 o 1/100.
  7. Lavare come fatto nella fase 6.3.
  8. Usare 50 ml / pozzetto di capra F (ab) 2 anti-umane perossidasi IgG Fc coniugato diluito 1: 20.000 in tampone di incubazione. Tampone di incubazione contiene 1% BSA e 0,02% Tween 20 in PBS 1x. Incubare a 37 ° C per 60 min.
  9. Lavare come fatto nella fase 6.3.
  10. Aggiungere 100 ml / soluzione ben substrato contenente 0,1% 3,3 ', 5,5'-Tetrametilbenzidina (TMB). Incubare 10 minuti fino a quando uno stabile forme di colore blu nei pozzetti. Stai attento; non aspettare troppo a lungo!
  11. Arrestare la reazione aggiungendo 50 ml di 2 MH 2 SO 4. Misurare l'assorbimento a 450 nm, entro 30 minuti dopo l'interruzione della reazione.
    Nota: s Tutti i cloni 'upernatants con 3 deviazioni standard sopra il vuoto saranno considerati positivi per anticorpi umani IgG. Per conferma dei cloni positivi questa ELISA deve essere ripetuto almeno tre volte in differenti surnatanti dello stesso clone. Anche scartare la possibilità di aspecifico reattività incrociata è raccomandato per assicurare che non vi è alcun segnale quando supernatanti sono incubati in pozzetti non rivestiti ma bloccati. A questo punto, un test di rilevamento per lo screening per la specificità antigenica degli anticorpi di interesse può essere effettuata prima di passare alla sezione 7.

7. RNA Isolamento e First Strand cDNA Synthesis dei Produrre IgG cloni

  1. Non appena la produzione di IgG è confermata mediante ELISA, estrarre l'RNA del clone.
  2. Per l'estrazione di RNA da cellule in crescita a passi 5.7 o 5.9, utilizzare il kit di apice sintesi del DNA delle cellule III diretto, che permette di ottenere il DNA da 10.000 cellule a una cella.
  3. Per l'estrazione di RNA da larger quantità di cellule o dal pellet memorizzato nel passo 5.11 usa il kit di isolamento alta RNA puro. Altri sistemi di estrazione dell'RNA possono essere adatti a questo passo. Seguire le istruzioni del produttore.
  4. Per il numero di cellule tra 1 x 10 6 e 1 x 10 4 uso il sistema di trascrizione inversa, seguendo le istruzioni del produttore. Altri sistemi per la sintesi di cDNA del primo filamento possono anche essere utilizzati.

8. 1 ° e 2 ° PCR per l'amplificazione del pesante e Catene Leggere delle IgG-producono cloni delle cellule B

  1. Con il cDNA dei cloni cellulari ottenuti nel passo 5.6 e 5.7 e positivo a IgG ELISA nel passaggio 6, effettuare PCR con i primer elencati nella Tabella 1.
  2. Impostare PCR indipendenti per ogni pesante, kappa e lambda catena IgG. Fare una soluzione madre con in avanti e reverse primer in concentrazioni uguali. Aggiungeteli alla reazione a 0.4 micron concentrazione finale. </ Li>
  3. Usare 1 ml di sintesi del DNA per eseguire il 1 ST PCR. Qui, effettuare 20 reazioni microlitri utilizzando Takara Taq istruzioni del produttore. In alternativa, utilizzare altre polimerasi.
  4. Posizionare il 1 ° PCR nelle seguenti condizioni ciclo: 94 ° C per 5 min; (50 cicli di: 94 ° C per 30 sec; 58 ° C per 30 sec e 72 ° C per 45 secondi, 72 ° C per 7 minuti, lasciarlo raffreddare a 4 ° C.Include un vuoto nella reazione, per rilevare eventuali contaminazioni.
  5. Preparare TBE 1x (89 mM Tris-borato e 2 mM EDTA). In un volume di 100 ml di TBE 1x aggiungere 1 g di agarosio (1% gel di agarosio). Riscaldare la soluzione nel microonde per circa 1 minuto, fino l'agarosio si dissolve. Quindi aggiungere 4 ml di 10 mg / ml di bromuro di etidio (o tintura DNA equivalente) e mescolare.
    1. Versare il contenuto in un cassetto e aspettare che viene polimerizzato. Eseguire 5 microlitri della miscela PCR nel gel per visualizzare le bande. Frammento Catena pesantes dovrebbe essere di circa 400-550 bp, mentre catena leggera dovrebbe essere di circa 300-400 bp. Se le bande non vengono rilevati, procederà allo stesso modo al 2 PCR.
  6. Usare 1 ml della prima PCR mescolare per eseguire il 2 ° PCR. Utilizzare gli stessi reagenti che nel passaggio 8.2 ma utilizzando il mix adeguato di primer (vedi tabella 1). Per i 2 nd utilizzare PCR le seguenti condizioni: 94 ° C per 5 min; (50 cicli di: 94 ° C per 30 sec; 56,5 ° C per 30 sec e 72 ° C per 55 sec); 72 ° C per 7 min; lasciarlo raffreddare a 4 ° C. Includere un vuoto nella reazione, per rilevare eventuali contaminazioni della PCR.
  7. Preparare un gel di agarosio come descritto in 8.5. Eseguire il gel per visualizzare il prodotto di PCR, come in 8.5.1 Utilizzare i amplificazioni che contengono i frammenti di dimensioni giuste per la clonazione al punto 9 e produrre gli anticorpi al punto 10.
  8. Sequence il DNA, utilizzando 10 microlitri di reazione contenente: 100 ng del 2 ° PCR, 0.2 mM del primer o miscela di primer, 1 ml di terminatore e 1 ml di tampone. Eseguire la reazione di sequenziamento in queste condizioni: (25 cicli di: 96 ° C per 10 sec; 50 ° C per 5 sec e 60 ° C per 4 min); 60 ° C per 7 min; lasciarlo raffreddare a 4 ° C.
  9. Purificare le reazioni di sequenziamento con microspin colonne G50 seguenti istruzioni del produttore. Valutare le sequenze della legatura in un analizzatore automatico di sequenza come descritto in precedenza 18. Elettroferogrammi deve essere pulita e corrispondono ad una singola sequenza di immunoglobulina.
    Nota: Se i prodotti di PCR mostrano sequenze di immunoglobulina poco chiare o misti, perche per clonare utilizzando il sistema TopoTA, per ottenere sequenze isolate e quindi passare al punto 9.

9. Clonazione e sequenziamento delle catene pesanti e leggere dei cloni Producing IgG

  1. Preparare 1 mg di DNA di vettori pFUSE2ss-clig-hk, pFUSE2ss-Clig-HL2 e pFUSEss-Chig-HG1.
  2. Digerire questi vettori con gli opportuni enzimi di restrizione. Usa Eco RI e Bsi WI per pFUSE2ss-clig-hk, Eco RI e Avr II per pFUSE2ss-clig-HL2, e Eco RI e Nhe I per pFUSEss-Chig-HG1. Utilizzare 3 unità di ogni enzima di restrizione per 1 mg di DNA di vettore.
    1. Digest con un enzima e purificare il prodotto digerito con un kit di purificazione PCR. Digest con il secondo enzima e purificare con un kit di Gel Extraction (secondo il protocollo del produttore). Tagliare il frammento di interesse da parte del gel. Preparare gel di agarosio come al punto 8.5.
  3. Digerire i 2 ° di PCR prodotti della produzione di clone IgG: Eco RI e Bsi WI per la catena kappa di amplificazione, Eco RI e Avr II per la catena lambda amplificazione, e Eco RI e Nhe I per pesante catena di amplificazione. Digest con un enzima e purificare il prodotto digerito con un PCR Kit Purificazione. Digest con il secondo enzima e purificare il prodotto digerito con un kit di purificazione PCR. Usa le stesse unità di enzimi e quantità di DNA come al punto 9.2.
  4. Legare i frammenti di PCR all'interno dei vettori con raccomandazioni T4 DNA ligase 16 ° CO / N seguenti del produttore. Il rapporto utilizzato dovrebbe essere 1: 2 (vettore: insert).
  5. Usare 1 ml di legatura di trasformare i batteri DH5α. Seguire condizioni DH5α produttore 'per la trasformazione. Diffondere i batteri in piastre blasticidin o zeocin, a seconda del tipo di vettore utilizzato. Incubare le piastre O / N a 37 ° C.
  6. Crescere singole colonie, ed estrarre il DNA con un kit miniprep, seguendo le istruzioni del produttore. Utilizzare per singola colonia crescere e DNA all'estrazione del produttore, consigli dal kit miniprep DNA. Analizzarli mediante digestione con enzimi utilizzati per la preparazione di vettori e inserti come nei passi 9.2 e 9.3.
  7. Sequenza di DNA, per using 100 ng del vettore, come avviene in fasi 8.8 e 8.9.

10. La produzione di anticorpi in cellule HEK

  1. Crescere le cellule HEK in Dulbecco Modified Eagle Medium (DMEM) supplementato con 10% di siero fetale bovino, 1% L-glucosio, 1% di penicillina / streptavidina (DMEM +) ad una confluenza del 75% in una piastra di coltura cellulare 150 mm. Eseguire in una cappa passi 10,1-10,7.
  2. Prima di trasfezione, scambiare media e medio come prima, ma senza siero fetale di vitello.
  3. Per ogni pesante, catena leggera trasfezione, preparare una miscela di trasfezione con 2,5 ml di DMEM (senza siero), 9 mg di vettore con la catena pesante, 6 mg di vettore con la catena leggera, e 100 ml di polyethylenimine (PEI soluzione) (da un 1 mg / mL magazzino). Incubare a temperatura ambiente per 15 min.
  4. Aggiungere delicatamente 2,5 ml della miscela trasfezione preparato al punto 10.3 alle cellule HEK nella piastra. Rock the plate per distribuire in modo omogeneo.
  5. Incubate le cellule in incubatore a 37 ° C con 5% di CO 2 per 24 ore.
  6. Modificare il terreno di coltura per mezzo senza siero fetale bovino.
  7. Raccogliere il medium dalle piastre 4 giorni dopo.
    Nota: Gli anticorpi nei media possono essere utilizzati per caratterizzare la loro reattività in vitro e in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Il gating ordinamento dopo colorazione cellule CD22 positive e IgG è mostrato in Figura 1 In questa immagine la zona delle cellule doppio positive -. È selezionata per ordinare tutte queste cellule in un tubo separato - cellule B che producono anticorpi IgG. Nell'analisi, circa l'1% dei PBMC totali corrispondono a questa doppia popolazione positiva. Il numero di cellule filtrate ottenute dipenderà dal numero di cellule ottenute nella sezione 1.

I diversi risultati dopo 5 settimane di EBV immortalizzazione e CpG (ODN2006) stimoli sono mostrati nella Figura 2 La rilevazione dei cloni crescita è facile.; Cellule feeder Wi38 hanno una forma più allungata fibroblasti, ei cloni di cellule B appaiono come cellule rotonde molto piccoli cluster crescere nel mezzo della piastra multi-pozzo fondo rotondo. In questa fase, è evidente che alcuni cloni iniziano a crescere. Tuttavia, la velocità di crescita può essere variabile e naturalmente alcuni dei pozzi contenining immortalato le cellule non possono avere alcun cellule in crescita a tutti.

Il supernatante dei cloni crescono viene testato in un test ELISA per rilevare IgG come mostrato nella tabella 2. In questo ELISA una curva standard per IgG viene testato, insieme con il supernatante dei cloni e gli spazi vuoti. Un clone positivo è considerato quando il valore della ELISA è 3 deviazioni standard sopra il valore del bianco. Valori negativi cloni "sono sotto i 3 deviazioni standard del vuoto. Per conferma, cloni positivi dovrebbero essere positivi in ​​ELISA almeno tre volte in differenti surnatanti dello stesso clone e possibilmente verificato da un metodo di screening aggiuntivo.

La sequenza completa di un anticorpo IgG umano ottenuto applicando la procedura descritta in questo manoscritto è illustrato nella figura 3. Questa sequenza è stata ottenuta dopo la clonazione la coppia catena pesante e lambda immunoglobuline da una cellula B clonale espanso. Variabile unnd regioni costanti della catena pesante e leggera possono essere caratterizzate con questa tecnica. Dopo aver ottenuto le sequenze, sequenze anticorpi possono essere clonati e prodotti in vitro in colture di cellule HEK.

Figura 1
Figura 1. analisi citofluorimetrica di CD22 + e IgG + cellule da cellule mononucleari del sangue periferico. (A) Selezione della popolazione di cellule viventi è mostrato in P1. (B) in avanti della dispersione. (C) Dimensione diagramma a dispersione. (D) L'asse Y mostra cellule separate da anti-CD22-PerCP e sull'asse X separati da IgG-PE. P4 quadrato indica la frazione di cellule che è stato ordinato (CD22 +, IgG +) e recuperato per la cultura. Clicca qui per vedere una versione più grande di questo fifigura.

Figura 2
Figura 2. Immagine rappresentativa della cellula B immortalato cloni in un pozzo piatto-96 dopo 5 settimane di coltura. (A) In questo pozzo senza immortalizzazione è stata osservata dopo 5 settimane, ma wi38 irradiato cellule di alimentazione può essere osservato. (B) Un clone lenta crescita è stata osservata in questo pozzo, con aggregati tondi piccoli in mezzo. (C) clone rapida crescita mostrando turno aggregati di cellule B immortalate. Cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. sequenze di anticorpi umani di coppia pesante e catena leggera da un essere umano immortalato clone di cellule B, F5.2, Indicando V CDR1, CDR2 e sequenze CDR3. Cliccate qui per vedere una versione più grande di questa figura.

"> Λ
1 st primer PCR
Forward (5'-3 ') Reverse (3'-5 ')
IgG 5 'L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 3 'Cγ CH1 GGAAGGTGTGCACGCCGCTGGTC
5 'L-VH 3 AAGGTGTCCAGTGTGARGTGCAG
5 'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG
5 'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG
κ 5 'L Vκ 1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 3 'Cκ 543 GTTTCTCGTAGTCTGCTTTGCTCA
5 'L Vκ 3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 3 'Cκ 494 GTGCTGTCCTTGCTGTCCTGCT
5 'L Vκ 4 ATTTCTCTGTTGCTCTGGATCTCTG
5 'Pan Vκ ATGACCCAGWCTCCABYCWCCCTG
λ 5 'L Vλ 1 GGTCCTGGGCCCAGTCTGTGCTG 3 'Cλ CACCAGTGTGGCCTTGTTGGCTTG
5 'L Vλ 2 GGTCCTGGGCCCAGTCTGCCCTG
5 'L Vλ 3 GCTCTGTGACCTCCTATGAGCTG
5 'L Vλ 4/5 GGTCTCTCTCSCAGCYTGTGCTG
5 'L Vλ 6 GTTCTTGGGCCAATTTTATGCTG
5 'L Vλ 7 GGTCCAATTCYCAGGCTGTGGTG
5'L Vλ 8 GAGTGGATTCTCAGACTGTGGTG
2 ° primer PCR
Forward (5'-3 ') Reverse (3'-5 ')
IgH 5 'EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG
TGCAG
3 'NheI JH 1,2,4,5 CTGCTAGCTAGCTGAGGAGACGGT
GACCAG
5 'EcoRI VH1 a 5 CAACCGGAATTCAGAGGTGCAGCTG
GTGCAG
3 'NheI JH 3 CTGCTAGCTAGCTGAGAGACGGTGA
CCATTG
5 'EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG
GTGGAG
3 'NheI JH 6 CTGCTAGCTAGCTGAGGAGACGGTG
ACCGTG
5 'EcoRI VH3 23 CAACCGGAATTCAGAGGTGCAGCT
GTTGGAG
5 'EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT
GCAGGAG
5 'EcoRI VH 4 34 CAACCGGAATTCACAGGTGCAGCTAC
AGCAGTG
5 'EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT
GGTGCAG
5 'EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT
GGTACAG
5 'EcoRI VH3 33 CTTCCGGAATTCACAGGTGCAGCT
GGTGGAG
5 'EcoRIVH 3 9 GATCCGGAATTCAGAAGTGCAGCT
GGTGGAG
5 'EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT
GCAGGAG
5 'EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT
GCAGCAG
κ 5 'EcoRI Vκ 1 5 CAACCGGAATTCAGACATCCAGATGA
CCCAGTC
3 'BsiWI Jκ 1-4 GCCACCGTACGTTTGATYTCCACCTTGGTC
5 'EcoR1 Vκ 1 9 CTTCCGGAATTCAGACATCCAGTTGAC
CCAGTCT
3 'BsiWI Jκ 2 GCCACCGTACG TTTGATCTCCAG
CTTGGTC
5 'EcoR1 Vκ 1D 43 CTTGGCGAATTCAGCCATCCGGATGA
CCCAGTC
3 'BsiWI Jκ 3 GCCACCGTACGTTTGATATCCACT
TTGGTC
5 'EcoR1 Vκ 2 24 CTTCCGGAATTCAGATATTGTGATGA
CCCAGAC
5 'EcoR1 Vκ 2 28 CTTCCGGAATTCAGATATTGTGATG
ACTCAGTC
5 'EcoR1 Vκ 2 30 CTTCCGGAATTCAGATGTTGTGATGA
CTCAGTC
5 'EcoR1 Vκ 3 11 CTTCCGGAATTCAGAAATTGTGTTG
ACACAGTC
5 'EcoR1 Vκ 3 15 CTTCCGGAATTCAGAAATAGTGATG
ACGCAGTC
5 'EcoR1 Vκ 3 20 CTTCCGGAATTCAGAAATTGTGTTGA
CGCAGTCT
5 'EcoR1 Vκ 4 1 CTTCCGGAATTCAGACATCGTGATG
ACCCAGTC
5 'EcoR1 Vλ 1 CTTCCGGAATTCACAGTCTGTGCT
GACKCAG
3 'AvrII Jλ 1-3 CTGGTTACCTAGGAGGACGGTSACCT
TGGTCCC
5 'EcoR1 Vλ 2 CTTCCGGAATTCACAGTCTGCCC
TGACTCAG
3 'AvrII Jλ 4 CTGGTTACCTAGGAAAATGATCAGC
TGGGTTCC
5 'EcoR1 Vλ 3 CTTCCGGAATTCATCCTATGAGC
TGACWCAG
3 'AvrII Jλ 5 CTGGTTACCTAGGAGGACGGTCAGC
TCGGTCCC
5 'EcoR1 Vλ 4-5 CTTCCGGAATTCACAGCYTGTG
CTGACTCA
3 'AvrII Jλ 6 CTGGTTACCTAGGAGGACGGTCAGCT
GGGTGCC
5 'EcoR1 Vλ 6 CTTCCGGAATTCAAATTTTATGC
TGACTCAG
3 'AvrII Jλ 7 CTGGTTACCTAGGAGGACGGTCAC
TTGGTCCAT
5 'EcoR1 Vλ 7-8 CTTCCGGAATTCACAGRCTGTG
GTGACYCAG
"> Tabella 1. Primer utilizzati.

EFT "> 0.080
1 2 3 4 5 6 7 8 9 10 11 12
La 0.076 0,077 2.003 0.080 0.138 0,102 0,188 0,338 0.040 2.041 0.051 0,081
B 2.011 0,085 0,074 0,069 0,081 0,122 0,372 2.133 0.119 0.097 0,072 0,072
C 0.068 0,179 0,091 0,073 0,077 0.097 0,606 1.882 0,081 2.071 0,094 0.075
D 0,063 0.070 0,065 0,071 0,082 2.071 0,339 2.089 0.076 0,086 0,066 0,069
E 1.921 0,077 0,065 0,085 0,095 1.968 1.910 0,122 0,072 0.070 0,065 0,066
F 0,113 0.068 0,066 0,082 0,088 0,090 0.460 0.070 0,079 0,952 0,098 0,065
Sol 2.041 2.108 1.472 0,665 0,331 0,194 0.123 0,094 0,072 0.070 0,072
H 2.146 2.132 1.634 0,665 0.341 0,178 0.132 0,094 0,082 0.080 0,074 0.068
Norme ng / ml 1000 500 250 125 62.5 31.25 15.6 7.8 3.9 1.95 0,975 0

Tabella 2. Risultati rappresentativi di IgG screening ELISA. Clone supernatanti sono in A1-A10, B1-B10, C1-C10, D1-D10, E1-E10, F1-F10. Gli spazi sono in A11, B11, C11, D11, E11, F11, A12, B12, C12, D12, E12, la curva F12.Standard è duplicata: G1-G12 e H1-H12. La concentrazione corrispondente di immunoglobuline in ogni duplicato viene mostrata below.Positive o IgG cloni che producono sono mostrati in grigio scuro. Cloni che producono negativi o non-IgG sono mostrati in grigio chiaro

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In questo manoscritto, tutti i passaggi per la generazione di anticorpi IgG da PBMC umane sono presentati in dettaglio. Questo protocollo comprende alcuni vantaggi rispetto alle tecniche precedentemente pubblicati. Uno dei vantaggi è che gli anticorpi prodotti mantiene le catene pesanti e leggere corrispondenti alla coppia originale nel clone cellulare B. L'identificazione di anticorpi IgG può essere fatto in qualsiasi tipo di donatore umano, e non vi è alcuna necessità di esacerbazione della risposta immunitaria grazie alla vaccinazione 5. L'uso del wi38 linea cellulare di fibroblasti come cella alimentatore, consente una più rapida individuazione dei cloni crescenti, poiché sono morfologicamente diverse e molto facile distinguere, rispetto ai PBMC utilizzate come cellule feeder in precedenza descritto opere 1,6- 8. Inoltre l'uso di wi38 come cella alimentatore favorisce il congelamento di grandi quantità di aliquote cellulari che possono essere facilmente scongelati e coltivate prima di ogni esperimento.

Uno dei critpassi iCal in questo protocollo è il materiale di partenza: il PBMC. Se il sangue è stato in attesa troppo lungo per centrifugazione, o dopo l'estrazione del PBMC, essi non sono memorizzati in condizioni appropriate di congelamento; come sarà ridotto come il numero di cellule vitali, insieme al numero di cellule B IgG produrre cloni ottenuti. Per questo motivo, una estrazione precoce e una buona conservazione del PBMC sono raccomandati per un esito positivo. Il numero di IgG cloni che producono sarà limitata al numero delle PBMC all'inizio dell'esperimento. I numeri più alti di PBMC darà i numeri più alti di IgG cloni di produzione e una produzione di anticorpi diversi. Un altro punto critico è la clonazione di frammenti PCR delle catene leggere e pesanti dell'anticorpo. Se la legatura non riesce dopo vari tentativi, si raccomanda un ulteriore passo di clonazione del 2 ° prodotto di PCR in un sistema TopoTA. La digestione dell'inserto con gli enzimi appropriati può essere più facilenel vettore TopoTA, per una successiva legatura nei vettori di espressione pFUSEss.

Questa tecnica può essere trasferito in qualsiasi tipo di tessuto umano in cui le cellule B umane sono arricchiti 3. Esso può essere applicato anche allo studio di altri tipi di immunoglobuline, semplicemente cambiando gli anticorpi marcati utilizzati per l'ordinamento (anticorpi contro IgM, IgE, IgA o IgD), il disegno primer per la PCR, ei vettori esprimenti. Gli studi di questi immunoglobuline possono essere di interesse per capire, le risposte immunitarie iniziali, la secrezione mucosa anticorpo e profili di allergia, tra gli altri.

In conclusione, abbiamo descritto una tecnica per la produzione di anticorpi monoclonali ricombinanti umani IgG che lascia le pesanti e leggere catene coppie di immunoglobulina umana intatto. La tecnica è utile e facile da eseguire partendo da un campione di sangue. Gli anticorpi monoclonali ottenuti tramite questo metodo sono potenzialmente utili in studi su immunitario umanorisposte. Inoltre, gli anticorpi monoclonali prodotti con questo metodo potrebbe essere un buon punto di partenza per lo sviluppo di immuno-terapie per diverse condizioni patologiche.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere interessi finanziari in competizione.

Acknowledgments

Contratto di ricerca Miguel Servet (ISCIII CD14 / 00032) a (GN-G.). Fellowship dalla Organizzazione olandese per la ricerca scientifica "Graduate School of Translational Neuroscience Programma" (022005019) a (CH).

Le sovvenzioni da parte Prinses Beatrix Fonds (Progetto WAR08-12) e dell'Association Française contre les Myopathies a (PM-M.); nonché da un Veni Fellowship dell'Organizzazione olandese per la ricerca scientifica (916.10.148) una borsa di studio della Fondazione cervello dei Paesi Bassi (FS2008 (1) -28) e il Prinses Beatrix Fonds (Progetto WAR08-12) (a ML ).

Ringraziamo Jozien Jaspers per il suo aiuto nel B-cell sorting mediante citometria di flusso.

Materials

Name Company Catalog Number Comments
Histopaque-1077  Sigma-Aldrich 10771 solution containing polysucrose and sodium diatrizoate
FACSAria II cell sorter  BD Biosciences 
96 U-bottom micro well plates  Costar 3799
Advanced Roswell Park Memorial Institute (RPMI) 1640 medium  Gibco, Life Technologies 12633-020
30% v/v EBV-containing supernatant of the B95-8 cell line   ATCC CRL-1612 3.4 x 108 copies/ml
CpG2006  Invivogen ODN 7909
Wi38 cells  Sigma-Aldrich 90020107
Interleukin-2 Roche  10799068001
ELISA plates Greiner Bio-One, Microlon 655092
AffiniPure F(ab')2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific (unconjugated) Jackson ImmunoResearch 109-006-008
4% non-fat dry milk (Blotting Grade Blocker)  Biorad 170-6404
Human IgG  Sigma I 2511 HUMAN IgG purified Immunoglobulin, 5.6 mg/ml
Goat F(ab)2 antihuman IgG Fcγ (conjugated with peroxidase (PO)) Jackson ImmunoResearch 109-036-008
ELISA reader (Perkin Elmer 2030)  Perkin Elmer  2030-0050
Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc5µ  Jackson ImmunoResearch 309-035-095
SuperScript III Cells Direct cDNA Synthesis System  Invitrogen  18080-200
Applied Biosystems (ABI) GeneAm PCR System 2700 Applied Biosystems
High Pure RNA Isolation Kit  Roche 11828665001
Reverse transcription system kit  Promega A3500
Recombinant Taq DNA Polymerase TAKARA R001A
Primers (2 μl) Sigma
Ultrapure Agarose  Invitrogen 16500-500
100 bp ladder Invitrogen 15628-019
Quantity One 4.5.2 (Gel Doc 2000) Biorad 170-8100
QIAquick PCR purification kit QIAGEN 28106
BigDye Terminator v3.1 cycle sequencing kit  Applied Biosystems 4337455
0.1 ml reaction plate (MicroAMP Optical 96-well) Applied Biosystems 4346906
Genetic analyser ABI300  Applied Biosystems 4346906
DH5α competent cells (E. coli) Invitrogen 18263-012
pFUSEss-CHIg-hG1 (4,493 bp) Invivogen pfusess-hchg1
pFUSEss-CHIg-hG4 (4,484 bp)  Invivogen pfusess-hchg4
pFUSE2ss-CLIg-hk (3,875 bp) Invivogen pfuse2ss-hclk
pFUSE2ss-CLIg-hl2 (3,883 bp)  Invivogen pfuse2ss-hcll2
SOC medium Invitrogen 15544-034
LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar) Invivogen fas-zn-s
Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB) Invivogen fas-zn-l
DNA Miniprep kit  Omega Bio Technology D6942-02
Nanodrop (ND1000 Spectrophotometer) Nanodrop
LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar) Invivogen fas-bl-s
Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB) Invivogen fas-bl-l
EcoRI New England Biolabs R0101S 20,000 U/ml, in 10x NEBuffer EcoRI
NheI New England Biolabs R0131S 10,000 U/ml, in 10x NEBuffer 2.1
2-Log DNA ladder New England Biolabs N3200S 0.1-10.0 kb, 1,000 μg/ml
XmaI New England Biolabs R0180S 10,000 U/ml, in 10x CutSmart Buffer 
BsiWI New England Biolabs R0553S 10,000 U/ml, in 10x NEBuffer 3.1
AvrII New England Biolabs R0174S 5,000 U/ml, in 10x CutSmart Buffer 
FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 1 U/µl, in 10x FastAP Buffer
DH5α competent cells  Invitrogen 18263-012
PE Mouse Anti-Human IgG BD Pharmingen 555787
anti-CD22, PerCP-Cy5.5, Clone: HIB22 Fisher scientific BDB563942
QIAprep Spin Miniprep Kit  QIAGEN 27106
BigDye Terminator v3.1 Applied Biosystems 4337455

DOWNLOAD MATERIALS LIST

References

  1. Vrolix, K., et al. Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor. J Autoimmun. 52, 101-112 (2014).
  2. Yamashita, M., Katakura, Y., Shirahata, S. Recent advances in the generation of human monoclonal antibody. Cytotechnology. 55, (2-3), 55-60 (2007).
  3. Pereira, K. M., Dellavance, A., Andrade, L. E. The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies. Clin Chim Acta. 437, 403-410 (2014).
  4. Losen, M., et al. Treatment of myasthenia gravis by preventing acetylcholine receptor modulation. Ann N Y Acad Sci. 1132, 174-179 (2008).
  5. Smith, K., et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen. Nat Protoc. 4, (3), 372-384 (2009).
  6. Fraussen, J., et al. A novel method for making human monoclonal antibodies. J Autoimmun. 35, (2), 130-134 (2010).
  7. Traggiai, E., et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 10, (8), 871-875 (2004).
  8. Fraussen, J., et al. Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients. J Neuroimmunol. 261, (1-2), 98-107 (2013).
  9. Yamashita, M., et al. Different individual immune responses elicited by in vitro immunization. Cytotechnology. 40, (1-3), 161-165 (2002).
  10. Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. Human B cell immortalization for monoclonal antibody production. Methods Mol Biol. 1131, 183-189 (2014).
  11. Tiller, T., et al. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 329, (1-2), 112-124 (2008).
  12. Lanzavecchia, A., Corti, D., Sallusto, F. Human monoclonal antibodies by immortalization of memory B cells. Curr Opin Biotechnol. 18, (6), 523-528 (2007).
  13. Traggiai, E. Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies. Methods Mol Biol. 901, 161-170 (2012).
  14. Strober, W., et al. Monitoring cell growth. Curr Protoc Immunol / edited by. John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).
  15. Ibrahim, S. F., van den Engh, G. Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol. 106, 19-39 (2007).
  16. Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. Effects of feeder cells on the X-ray sensitivity of human colon cancer cells. Radiother Oncol. 21, (1), 53-59 (1991).
  17. Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines. J Vis Exp. (57), 3321 (2011).
  18. Smith, L. M., et al. Fluorescence detection in automated DNA sequence analysis. Nature. 321, (6071), 674-679 (1986).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics