Generering van recombinant humaan IgG Monoclonal Antibodies uit Onsterfelijk gesorteerde B Cells

* These authors contributed equally
JoVE Journal
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nogales-Gadea, G., Saxena, A., Hoffmann, C., Hounjet, J., Coenen, D., Molenaar, P., Losen, M., Martinez-Martinez, P. Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells. J. Vis. Exp. (100), e52830, doi:10.3791/52830 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Het doel van dit artikel is in detail te beschrijven een methode voor het genereren en karakteriseren van humane IgG monoklonale antilichamen verkregen uit humane perifere bloed mononucleaire cellen (PBMC).

De belangstelling voor de menselijke antilichamen studeren is gegroeid in veel verschillende gebieden van het onderzoek. Met name veel onderzoeksgroepen zijn geïnteresseerd in de pathologie veroorzaakt door auto-antilichamen 1-3. We hebben gekloneerd en gekarakteriseerd pathogene autoantilichamen 1. De studie van autoantilichamen kunnen helpen om hun doelen te identificeren en therapeutische strategieën te ontwikkelen, bijvoorbeeld door het gebruik deelnemer 4 antilichamen. Bovendien kan de studie van humane antilichamen ook interesse in andere onderzoeksgebieden, dat wil zeggen, om de immuunreactie na vaccinatie te evalueren 5, het antilichaamprofiel van individuen die werden blootgesteld en werd resistent tegen specifieke pathogenen 6 of een studie karakteriseren welke antilichamen inde natuurlijke repertoire 7,12.

Verscheidene technieken zijn ontwikkeld om recombinante humane monoklonale antilichamen 8-12 genereren; de meeste van deze te gebruiken faagdisplay en B-cel immortalisatie. Het gebruik van faagdisplay is uitgebreid toegepast voor de ontdekking van nieuwe antilichamen 13. Zij heeft echter een groot nadeel, namelijk dat de zware en lichte keten paren van de humane immunoglobuline wordt gedissocieerd in het proces. Productie van hybridoma's met humane B cellen of EBV transformatie ondervangt dit bezwaar.

We gebruiken infectie van thymus B-cellen met EBV in combinatie met polyklonale B-cel stimulatie via Toll-like receptor 9 (TLR-9) 6,12.

In dit artikel beschrijven we in detail de technologie die we gebruiken voor de ontwikkeling van IgG humane antilichamen, met een compleet overzicht van alle stappen van PBMC isolatie om de in vitro antilichaam generatie. Dezeprotocol kan worden gebruikt voor de analyse van elk type humaan IgG profiel. In ons laboratorium hebben B cellen die IgG antilichamen met succes gescheiden van de rest van PBMCs na sortering. Vijftig gesorteerd 8 B-cellen kunnen vervolgens worden uitgeplaat in multi-well platen en geïmmortaliseerd door EBV en TLR-9 activering gedurende de klonale expansie van afzonderlijke B-cellen. Zoals voedingscellen zijn fibroblasten van humane embryonale longweefsel gebruikt, cellijn WI38, waarbij de visualisatie van de geïmmortaliseerde B-cellen vergemakkelijkt. Uit deze B-cellen, kunnen de sequenties van de zware en lichte ketens van het immunoglobuline worden verkregen door PCR, en genen de antilichamen "immunoglobuline G gekloneerd in expressievectoren en in vitro geproduceerd. Met deze techniek kan enige antilichamen met dezelfde antilichaamsequentie in de donor worden bestudeerd.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Geïnformeerde toestemming is verkregen van de deelnemers van het onderzoek. Het onderzoek werd goedgekeurd door de institutionele ethische commissie.

1. Isolatie van perifere bloed mononucleaire cellen (PBMCs)

  1. Centrifugeer 25 ml gehepariniseerd bloed van de deelnemers bij 900 xg gedurende 15 min, zo spoedig mogelijk na de bloedextractie. Als er minder bloed, de schaal van de reagentia dienovereenkomstig. Voer alle volgende stappen in een kap.
  2. Breng het serum een ​​schone buis. Het kan gebruikt worden in latere stappen voor het invriezen PBMC of bij autoimmune patiënten met autoantilichamen te testen.
  3. Verdun het bloed met 10 ml RPMI 1640 medium en resuspendeer de cellen door en neer te pipetteren.
  4. Voeg 15 ml van een oplossing die polysucrose en natrium diatrizoaat (1.077 g / ml) om een ​​nieuwe 50 ml buis.
  5. Voorzichtig laag het bloed boven de in stap 1.4 doordat zij de twee openingen van de buizen close togethaar tot de twee vloeistoffen komen heel langzaam in contact en decanteer de PBMC suspensie langzaam bovenop de 50 ml buis. Deze stap is essentieel voor een goede scheiding van PBMC's hebben.
  6. Centrifugeer de buis verkregen in stap 1,5 bij 400 xg zonder rem bij kamertemperatuur gedurende 20 min.
  7. Na het centrifugeren, herstellen met de pipet witte ring die in het middendeel van de buis, die de PBMC bevat weergegeven.
  8. Was de cellen met 25 ml RPMI 1640 medium.
  9. Centrifugeer 300 x g bij kamertemperatuur gedurende 10 min.
  10. Verwijder het supernatant en was de cellen met 10 ml RPMI 1640. Centrifuge weer zoals in stap 1.9.
  11. Tel de PBMC's met een Neubauer geplaatst zoals eerder beschreven 14.
  12. Verwerk de PBMCs als in deel 2 of op te slaan voor later gebruik als volgt: 10 miljoen PBMC's voor het invriezen per Cryovial buis verdund in 1 ml van 10% dimethylsulfoxide (DMSO) en 90% serum verkregen in stap 1.2. Freeze geleidelijk en voor de lange storage in vloeibare stikstof.

2. kleuring PBMCs te sorteren CD22 + en IgG + door Cell Cytometry

  1. Plate de PBMC's in een 25 cm 2 celkweek kolf met 6 ml compleet RPMI 1640 medium (gesupplementeerd met L-glutamine, 10 mM HEPES buffer, 50 U / ml penicilline, 50 ug / ml streptomycine en 10% foetaal runderserum) en laat ze herstellen O / N in de incubator bij 37 ° C in 5% CO 2.
  2. Blokkeer steriele FACS buizen met 4% albumine steriele fosfaat gebufferde zoutoplossing (PBS) oplossing O / N. Was de buizen tweemaal met PBS en vullen met 500 ul volledig RPMI 1640 medium. Gebruik deze buizen voor het herstellen van de cellen na sortering.
  3. Verzamel de PBMC's in een buis en centrifugeer bij 400 xg bij kamertemperatuur gedurende 5 min.
  4. Resuspendeer de cellen in de etikettering buffer (zie stap 2.5 en 2.6) en tellen 14. De labeling buffer steriel 2% foetaal runderserum en 1 mM ethyleendiaminetetraazijnzuur (EDTA) in PBS.
  5. Bereid 3-fluorescentie-geactiveerde celsortering (FACS) buizen met 10 5 cellen per en resuspendeer ze in 100 pl labeling buffer. Deze buizen zullen dienen ter bepaling van de poorten van de sortering.
    1. In de eerste buis voeg 5 ul van anti CD22 antilichaam PerCP (aanbevolen datasheet fabrikant) in de tweede buis 20 pl anti IgG PE (aanbevolen datasheet fabrikant) en niets in de derde buis. Incubeer op ijs en in het donker gedurende 30 min.
  6. Resuspendeer 5.000.000 cellen in 200 gl labeling buffer in een FACS buis en voeg 10 ul anti CD22 PerCP en 40 pl anti IgG PE. Incubeer de cellen op ijs en donkere gedurende 30 min. Bij het sorteren van een groter aantal cellen wordt gewenst, opschalen alle reagentia.
  7. Centrifugeer cellen bij 400 xg met een lage rem gedurende 5 minuten bij kamertemperatuur.
  8. Giet zachtjes de bovenstaande vloeistof.
  9. Resuspendeer de cellen in 500 μl voor de etikettering buffer. Centrifugeer cellen bij 400 xg met een lage rem gedurende 5 minuten bij kamertemperatuur. Herhaal de stappen 2.7 en 2.8
  10. Decanteer het supernatant zacht en resuspendeer de cellen in 300 ul RPMI compleet medium.
  11. Laat de cellen door een 0,45 urn filter. Cellen zijn klaar om te sorteren.

3. Het sorteren van de CD22 + B-cellen en IgG +

  1. Gebruik 3 controlebuizen de levensvatbaarheid van de cellen vast te stellen. In de controlegroep zonder vlekken, gebruik maken van de forward en grootte scatterplot aan de lymfocyten gating definiëren. De besturing van de CD22 PerCP en anti-IgG PE dienen voor de poorten en de sortering hek vast. Voer volgende eerder gerapporteerde gegevens 15.
    Opmerking: Een poort is een reeks limieten waarde (grenzen), die dienen om een ​​specifieke groep cytometrische gebeurtenissen te isoleren, in ons geval de cellen, uit een grote set. Bij een sorteerinrichting poort de grenswaarden maakt het herstel van de cytometrische gebeurtenissen, cellen, die binneninde grenzen gedefinieerd: CD22 + en IgG +.
  2. Als verzamelbuis aan de verwerking, met de geblokkeerde buizen met 500 ul volledig RPMI 1640 medium, verkregen bij stap 2.2.
  3. Ga verder met dubbele positieve 15 afstand: CD22 + IgG +. Noteer het uiteindelijke aantal cellen per conditie. Plaat gesorteerde cellen bovenop voedingscellen zo spoedig mogelijk.

4. Bestraling van Feeder Cells

Opmerking: Voer de bereiding van de voedingscellen tussen 1-3 dagen vóór sortering. Tenminste 5000 WI38 cellen nodig per putje in een 96 ronde opening plaat. Voer stappen 4.1, 4.2 en 4.4 in een kap.

  1. Cultiveren WI38 cellen bij 37 ° C en 5% CO 2 in volledig RPMI 1640 medium (hetzelfde als voor PBMC's) tot het gewenste aantal cellen is bereikt.
  2. Bestralen ze op 50 Grays, na een protocol vóór 16 beschreven. Voer bestraling zodra de WI38-cellen werden getrypsiniseerd en opnieuw gesuspendeerd in complete RPMI medium, of WI38 bevestigd aan de kweekkolf en trypsine na de bestraling. Volg de werkwijze van behandeling met trypsine aangegeven door de leverancier van WI38-cellen. Bestraal het aantal cellen noodzakelijk om de benodigde bronnen voor plateren IgG + B-cellen (1% van het totale PBMC meegeteld in stap 1.11) te dekken.
  3. Plate 90 gl bevattende 5.000 bestraalde WI38-cellen in elke well van de 96 ronde opening plaat. Laat de putten in de buitenste rij van de lege plaat (omdat zij sneller verdampen), en alleen de 60 putten in het midden van het dienblad plating cellen. Vul de buitenste putjes die het bepalen van de plaat met 200 pl PBS.
  4. Plaats ze in een incubator bij 37 ° C in 5% CO 2, totdat het nodig is.

5. Plating Gesorteerd PBMCs, EBV-infectie en Growing

  1. Verdun de gesorteerde PBMCs, tot 50 cellen plaat in 50 ul van RPMI 1640 compleet medium per putje in de 96 round well plaat (voorheen vergulde with WI38 bestraalde cellen). Voer de stappen in een kap uitgerust voor EBV werk.
    Opmerking: het infecteren van 50 cellen per putje geoptimaliseerd en verhoogt de likehood een monoklonaal antilichaam 8 produceren echter aanbevolen om dit te controleren door middel van PCR zoals eerder beschreven 1,6.
  2. Voeg 60 ul van EBV supernatant (bevattende 3-4 x 10 8 virale kopieën / ml) aan elk putje in de 96 ronde opening plaat 17. Voorzichtigheid moet worden genomen tijdens EBV werk.
  3. Voeg 1 ug / ml CpG (ODN2006) per putje.
  4. Laat de cellen in een incubator bij 37 ° C in 5% CO 2.
  5. Visueel beeldscherm kloon groeien onder de microscoop na één week.
    Opmerking: Enkele voorbeelden van B-cel groei kan onder in de sectie resultaten te zien. Merk op dat de groei van de klonen kan variëren en extra tijd zou nodig zijn om ziet dat de celmassa groeien in het midden van de put.
  6. Na de 1 ste twee wekens-monitor kloon groeien onder de lichtmicroscoop en ga naar de eerste media-uitwisseling. Langzaam Pipetteer 90 ul van medium uit het bovenste gedeelte van de put en het verzamelen in een schone 96-wells plaat. (B-cellen liggen in de bodem van de put, zodat er geen risico om ze te zuigen).
    1. Voeg aan elk putje 100 gl volledig RPMI 1640 medium aangevuld met 1 ug / ml CpG (ODN2006) en 50 U / ml van IL2. Als klonen groeien, analyseren deze eerste media-uitwisseling met ELISA als in stap 6.
  7. Monitor kloon groeien en media veranderen na de 3de en 4de week opnieuw te groeien door middel van 90 pl medium en toevoegen van 100 ul volledig RPMI 1640 medium aangevuld met 1 ug / ml CpG (ODN2006) en 50 U / ml IL2. Met de verzamelde supernatant te controleren IgG door middel van ELISA zoals in stap 6.
    Opmerking: Na een maand kloon groeit duidelijk zou moeten zijn door het observeren van aggregaten ronde cellen that algemeen liggen in het midden van de ronde bodem ook.
  8. In deze stap verandert media op dezelfde manier dat de vorige week maar alleen met volledige RPMI 1640 medium. Een goede indicator om te weten het juiste moment om de media te veranderen is de media kleur, als het wordt steeds geelachtige cellen nodig hebben een media-uitwisseling.
  9. Wanneer 96-well platen met grote klonen (ongeveer 5 x 10 5 cellen), overbrengen naar een vlakke putje van een 24-wells plaat. Voeg 300 ul volledig RPMI 1640 medium om de nieuwe put. Resuspendeer de 96 putjes groeien kloon door en neer te pipetteren meerdere malen, en overdracht cellen om de nieuwe put, homogeen verdelen. Voeg nieuwe media als dat nodig is.
    1. Wanneer putjes van de 24-well plaat vol cellen (ongeveer 5 x 10 6 cellen), over te dragen aan een platte putje van een 6-wells plaat. Voeg 2 ml compleet RPMI 1640 medium om de nieuwe put. Resuspendeer de cellen in de 24-well plaat op en neer te pipetteren meerdere malen en verspreiden homogekertijd in de nieuwe put.
  10. Media toevoegen wanneer nodig. Indien cellen niet te worden in kweek gehouden, pellet de cellen bij 400 g gedurende 5 minuten bij kamertemperatuur. Bewaar de supernatanten voor ELISA testen. Was de pellet van de cellen eenmaal met 1 x PBS, opnieuw centrifugeren bij 400 g gedurende 5 min en bewaard droog bij -80 ° C tot RNA-extractie.
    1. Wanneer de cellen in 6-well platen confluent (ongeveer 20 x 10 6 cellen), transfer naar een 60 mm kweekplaat. Voeg 4 ml compleet RPMI 1640 medium om de nieuwe plaat. Resuspendeer de cellen in 6-well plaat en overbrengen volbracht is stap 5.9 en 5.10.
  11. Voeg nieuwe media als dat nodig is. Bij deze stap bevriezen cellen op 10-30000000 / ml in 90% foetaal kalfsserum en 10% DMSO. Indien grotere hoeveelheden cellen gewenst zijn, verder uitbreiding van de klonen in grotere oppervlakplaten.

6. ELISA voor IgG Antibody Detection

  1. Verdeel 50 ul / putje in een ELISA-plaat of geiten F (ab) 2 anti-humaan Fc antilichaam verdund 1 200 in coating buffer. Coating buffer bevat 50 mM Na 2 CO 3 pH 9,6.
  2. Sluit de platen met plastic sticker en incubeer 1 uur bij 37 ° C. Als alternatief, incuberen bij 4 ° CO / N.
  3. Was elk putje 6 maal met 200 ui wasbuffer. Wassen buffer bevat 0,05% Tween-20 in 1 x PBS. Niet aanraken of krassen op de goed oppervlak waar het antilichaam is gebonden.
  4. Blok met blokkerende buffer, 100 ul / putje. Blokkerende buffer bevat 4% niet-vette droge melk in PBS. Sluit de plaat en incubeer 1 uur bij 37 ° C.
  5. Niet wassen. Gooi blokkerende buffer en klap de plaat 3 keer ondersteboven op een papieren handdoek om resterende vloeistof te verwijderen.
  6. Incubeer supernatanten en normen klonen '.
    1. Bij een eerste proef verdund kloon supernatanten verkregen bij stap 5,6 of 5,7 1/3 in RPMI. Voor de normen te verdunnen met RPMI medium humaan IgG oplossing te krijgen: 1.000 ng /ml, 500 ng / ml, 250 ng / ml, 125 ng / ml, 62,5 ng / ml, 31,25 ng / ml, 15,6 ng / ml en blanco. Gebruik 50 ul / putje en incubeer bij 37 ° C gedurende 60 min. Analyseer verdere verdunningen van de kloon "supernatant aan het antilichaam affiniteit testen, zoals 1/10 of 1/100.
  7. Was zoals gedaan in stap 6.3.
  8. Gebruik 50 ul / putje geiten F (ab) 2 anti-humaan IgG Fc geconjugeerd peroxidase verdund 1: 20.000 in incubatiebuffer. Incubatiebuffer bevat 1% BSA en 0,02% Tween 20 in 1x PBS. Incubeer bij 37 ° C gedurende 60 min.
  9. Was zoals gedaan in stap 6.3.
  10. Voeg 100 ul / putje substraatoplossing bevattende 0,1% 3,3 ', 5,5'-tetramethylbenzidine (TMB). Incubeer 10 min tot een stabiele blauwe kleur formulieren in de putten. Wees voorzichtig; niet te lang wachten!
  11. Stop de reactie door toevoeging van 50 ui 2 MH 2 SO 4. Meet de absorptie bij 450 nm, binnen 30 minuten na het stoppen van de reactie.
    Opmerking: Alle klonen 'supernatants met 3 standaarddeviaties over de blanco zal positief worden beschouwd voor IgG humane antilichamen. Ter bevestiging van de positieve klonen deze ELISA ten minste driemaal worden herhaald in verschillende supernatanten van dezelfde kloon. Om de mogelijkheid van niet-specifieke kruisreactiviteit ontdoen wordt aanbevolen om te verzekeren dat er geen signaal wanneer supernatanten geïncubeerd in onbeklede maar geblokkeerde putjes. Bij deze stap een detectie-assay voor het screenen op de antigene specificiteit van de antilichamen van belang uit te gaan naar punt 7 kunnen worden uitgevoerd.

7. RNA isolatie en First Strand cDNA Synthese van de producerende IgG Clones

  1. Zodra de productie van IgG wordt bevestigd door ELISA, extract het RNA van de kloon.
  2. Voor het extraheren van RNA uit cellen groeien in stappen 5.7 of 5.9, gebruik de superscript III cellen directe cDNA synthese kit, die het mogelijk maakt het verkrijgen van DNA uit 10.000 cellen tot één cel.
  3. Voor het extraheren van RNA uit LARger hoeveelheden cellen of uit de pellet opgeslagen in stap 5.11 Met de uiterst zuivere RNA isolatie kit. Andere systemen voor RNA extractie kan ook geschikt zijn bij deze stap. Volg de instructies van de fabrikant.
  4. Voor cel aantallen tussen 1 x 10 6 en 1 x 10 4 gebruik van de reverse transcriptie systeem, volgens de instructies van de fabrikant. Andere systemen voor de eerste streng cDNA-synthese kan ook worden gebruikt.

8 1 e en 2e PCR voor amplificatie van de zware en lichte ketens van het IgG-producerende B-celklonen

  1. Met het cDNA van de celklonen, verkregen in stap 5.6 en 5.7 en positief in de ELISA IgG in stap 6, PCR uitgevoerd met de in tabel 1 vermelde primers.
  2. Opzetten onafhankelijke PCR's voor elk IgG zware, kappa en lambda-keten. Maak een voorraad oplossing met voorwaartse en achterwaartse primers in gelijke concentraties. Voeg ze toe aan de reactie bij 0,4 uM uiteindelijke concentratie. </ Li>
  3. Gebruik 1 pi van de cDNA-synthese met de 1 ST PCR uitgevoerd. Hier, voeren 20 ui reacties met Takara Taq instructies van de fabrikant. Als alternatief gebruik maken van andere polymerasen.
  4. Plaats de 1 ste PCR onder de volgende cyclusomstandigheden: 94 ° C gedurende 5 min; (50 cycli van: 94 ° C gedurende 30 seconden; 58 ° C gedurende 30 seconden en 72 ° C gedurende 45 seconden; 72 ° C gedurende 7 min, laat het afkoelen bij 4 ° C.Include een leeg in de reactie, eventuele contaminaties te detecteren.
  5. Bereid 1x TBE (89 mM Tris-boraat en 2 mM EDTA). In een volume van 100 ml 1x TBE voeg 1 g agarose (1% agarose gel). Verwarm de oplossing in de magnetron gedurende ongeveer 1 minuut totdat de agarose wordt opgelost. Voeg vervolgens 4 pl van 10 mg / ml ethidiumbromide (of gelijkwaardige DNA kleurstof) en meng.
    1. Giet de inhoud in een lade en wacht tot wordt gepolymeriseerd. Run 5 ul van het PCR mengsel in de gel op de banden zichtbaar. Zware ketenfragments moet rond de 400-550 bp, terwijl de lichte keten van ongeveer 300 zou moeten zijn - 400 bp. Als de banden niet gedetecteerd, gaat eveneens naar 2 nd PCR.
  6. Met 1 pl van het eerste PCR-mix de 2e PCR uitgevoerd. Gebruik dezelfde reagentia die in stap 8.2, maar met de geschikte combinatie van primers (zie Tabel 1). Voor de 2e PCR de volgende omstandigheden: 94 ° C gedurende 5 min; (50 cycli van: 94 ° C gedurende 30 seconden; 56,5 ° C gedurende 30 seconden en 72 ° C gedurende 55 sec); 72 ° C gedurende 7 min; laat het afkoelen bij 4 ° C. Neem een ​​leeg in de reactie, om mogelijke PCR contaminaties te detecteren.
  7. Bereid een agarose gel zoals beschreven in 8.5. Voer de gel om het PCR-product te visualiseren als in 8.5.1 Gebruik de versterkingen die de juiste grootte fragmenten bevatten voor het klonen in stap 9 en produceren van de antilichamen in stap 10.
  8. Sequentie het DNA, met behulp van 10 pl reactiemengsel bevattende: 100 ng van het PCR 2 nd, 0.2 pM van de primer of primer mix, 1 ui van de terminator en 1 ul van de buffer. Voer de sequentie reactie onder de volgende voorwaarden: (25 cycli van: 96 ° C gedurende 10 seconden; 50 ° C gedurende 5 seconden, en 60 ° C gedurende 4 min); 60 ° C gedurende 7 min; laat het afkoelen bij 4 ° C.
  9. Zuiver het sequencing reacties met microspin G50 kolommen volgens de instructies van de fabrikant. Evalueer de sequenties van de ligatie in een automatische sequentie analyse zoals eerder beschreven 18. Elektroferogrammen moet schoon zijn en corresponderen met een enkele immunoglobulinesequentie.
    Opmerking: Als de PCR-producten zien onduidelijk of gemengde immunoglobuline sequenties, kunt u overwegen om ze te klonen met behulp van het TopoTA systeem, geïsoleerde sequenties te verkrijgen en dan verder met stap 9.

9. Klonering en sequentiebepaling van de zware en lichte ketens van het IgG-producerende klonen

  1. Bereid 1 ug DNA van vectoren pFUSE2ss-CLIg-hk, pFUSE2ss-CLIg-HL2 en pFUSEss-Chig-HG1.
  2. Digest deze vectoren met de geschikte restrictie-enzymen. Gebruik Eco RI en Bsi WI voor pFUSE2ss-CLIg-hk, Eco RI en Avr II voor pFUSE2ss-CLIg-HL2 en Eco RI en Nhel voor pFUSEss-Chig-HG1. Gebruik 3 eenheden van elk restrictie-enzym 1 ug DNA van vector.
    1. Digereer met één enzym en zuiver het product gedigereerd met PCR Purification Kit. Digereer met het tweede enzym en zuiveren met Gel Extraction Kit (volgens het protocol van de fabrikant). Snijd het fragment van interesse van de agarosegel. Bereid agarose gel zoals in stap 8.5.
  3. Verteren de 2 e PCR-producten van de productie van IgG-kloon: Eco RI en Bsi WI voor kappa-keten versterking, Eco RI en Avr II voor lambda-keten versterking, en Eco RI en Nhel voor de zware keten van versterking. Digereer met één enzym en zuivering het verteerde product met een PCR Purification Kit. Digereer met het tweede enzym en zuiver het product gedigereerd met PCR Purification Kit. Gebruik dezelfde eenheden van enzymen en DNA bedrag als in stap 9.2.
  4. Afbinden de PCR-fragmenten in de vectoren met aanbevelingen T4 DNA ligase 16 ° CO / N na de fabrikant. De verhouding gebruikt zou moeten zijn 1: 2 (vector: insert).
  5. Met 1 pl van het ligatiemengsel DH5a om bacteriën te transformeren. Volg de voorwaarden DH5a fabrikant voor transformatie. Verspreid bacteriën in blasticidine of zeocine platen, afhankelijk van het type gebruikte vector. Incubeer de platen O / N bij 37 ° C.
  6. Groeien enkele kolonies en extract DNA met een miniprep kit, volgens de fabrikant instructies. Gebruik voor enkele kolonie groei en DNA extractie, aanbevelingen van de fabrikant van de DNA miniprep kit. Analyseren door knippen met de enzymen die worden gebruikt voor het bereiden van vectoren en inserts zoals in de stappen 9.2 en 9.3.
  7. Sequence het DNA, door using 100 ng van de vector als in stappen 8,8 en 8,9.

10. De productie van antilichamen in HEK cellen

  1. Groeien HEK cellen in Dulbecco's Gemodificeerd Eagle Medium (DMEM) gesupplementeerd met 10% foetaal kalfserum, 1% L-glucose, 1% penicilline / streptavidine (DMEM +) om een ​​confluentie van 75% in een 150 mm celcultuurplaat. Voer in een kap stappen 10,1-10,7.
  2. Voor transfectie, wisselen het medium tot medium als voorheen, maar zonder foetaal kalfsserum.
  3. Voor elke zware, lichte keten transfectie bereid een transfectie mix met 2,5 ml van DMEM (zonder serum), 9 pg van de vector met de zware keten, 6 ug van de vector met lichte keten, en 100 pl polyethyleenimine (PEI ) oplossing (van een 1 ug / ul voorraad). Incubeer bij kamertemperatuur gedurende 15 min.
  4. Voeg voorzichtig 2,5 ml van het transfectie mengsel bereid in stap 10.3 aan de HEK cellen in de plaat. Rock de plaat homogeen verdelen.
  5. Incubate de cellen in de incubator bij 37 ° C met 5% CO2 gedurende 24 uur.
  6. Verander het kweekmedium aan medium zonder foetaal kalfsserum.
  7. Verzamel het medium van de platen 4 dagen later.
    Opmerking: De antilichamen in de media kan worden gebruikt om de reactiviteit te karakteriseren in vitro en in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Het sorteren gating na kleuren CD22- en IgG positieve cellen wordt getoond in figuur 1 In dit beeld het gebied van de dubbele positieve cellen -. B cellen die IgG antilichamen - is geselecteerd om al deze cellen in een afzonderlijke buis sorteren. In de analyse, ongeveer 1% van de totale PBMC's overeenkomen met deze dubbele positieve populatie. Het aantal gesorteerde cellen verkregen hangt af van het aantal cellen verkregen in deel 1.

De verschillende resultaten na 5 weken EBV immortalisatie en CpG (ODN2006) stimuli worden getoond in Figuur 2 Detectie van de groeiende klonen gemakkelijk.; WI38 voedingscellen een meer langwerpige vorm fibroblast, en de B-celklonen worden als zeer kleine ronde cellen groeien gegroepeerd in het midden van de ronde bodem multiwell-plaat. In dit stadium is het duidelijk dat sommige klonen gaan groeien. Echter, de groeisnelheid variabele en natuurlijk sommige putjes containing geïmmortaliseerde cellen niet alle cellen groeien at all.

De supernatant van de groeiende klonen getest in een ELISA voor het detecteren van IgG zoals getoond in Tabel 2. In een ELISA standaardkromme voor IgG getest, samen met de supernatant van de klonen en de plano. Een positieve kloon wordt beschouwd als de waarde van de ELISA 3 standaardafwijkingen boven de blanco waarde. Waarden negatieve klonen 'onder de 3 standaarddeviaties van de blanco. Ter bevestiging dat positieve klonen positief in de ELISA ten minste driemaal in verschillende supernatanten van dezelfde kloon en eventueel gecontroleerd door een aanvullende screening methode.

De volledige sequentie van een humaan IgG antilichaam dat is verkregen door de stappen in dit manuscript beschreven in figuur 3. Dit sequentie werd verkregen na kloneren van de immuunglobuline zware en lambda ketenpaar van een klonaal geëxpandeerde B-cel. Variabele eennd constante gebieden van de zware en lichte keten kunnen worden gekarakteriseerd met deze techniek. Na het verkrijgen van de sequenties kunnen antilichamen sequenties worden gekloneerd en geproduceerd in vitro in HEK celkweken.

Figuur 1
Figuur 1. Flow cytometrische analyse van CD22 + en IgG + cellen uit humane perifere bloed mononucleaire cellen. (A) Keuze van de bevolking van levende cellen wordt weergegeven in P1. (B) Forward scatter plot. (C) Size scatter plot. (D) De Y-as toont cellen gescheiden door anti-CD22-PerCP en op de X-as gescheiden door IgG-PE. P4 plein geeft de cel fractie die is gesorteerd (CD22 +, IgG +) en teruggewonnen voor cultuur. Klik hier om een grotere versie van deze fi bekijkenguur.

Figuur 2
Figuur 2. representatief beeld van de B-cel klonen vereeuwigd in een 96 goed plaat na 5 weken van de cultuur. (A) In dit vormt geen onsterfelijk werd waargenomen na 5 weken, maar WI38 bestraalde voedingscellen worden waargenomen. (B) een langzaam groeiende kloon werd waargenomen in dit goed, met kleine aggregaten door het midden. (C) Snel groeiende clone tonen round aggregaten van vereeuwigd B-cellen. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3. Menselijk antilichaam sequenties van zware en lichte keten paar van een humane geïmmortaliseerde B-celkloon, F50,2, wat aangeeft V CDR1, CDR2 en CDR3 sequenties. Klik hier om een grotere versie van deze figuur te bekijken.

"> Λ
1 st PCR primers
Forward (5'-3 ') Reverse (3'-5 ')
IgG 5 'L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 3 'Cy CH1 GGAAGGTGTGCACGCCGCTGGTC
5 'L-VH 3 AAGGTGTCCAGTGTGARGTGCAG
5 'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG
5 'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG
κ 5 'L VK-1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 3 'CK 543 GTTTCTCGTAGTCTGCTTTGCTCA
5 'L VK-3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 3 'CK 494 GTGCTGTCCTTGCTGTCCTGCT
5 'L VK-4 ATTTCTCTGTTGCTCTGGATCTCTG
5 'Pan VK-ATGACCCAGWCTCCABYCWCCCTG
λ 5 'L VX 1 GGTCCTGGGCCCAGTCTGTGCTG 3 'Cλ CACCAGTGTGGCCTTGTTGGCTTG
5 'L VX 2 GGTCCTGGGCCCAGTCTGCCCTG
5 'L VA-3 GCTCTGTGACCTCCTATGAGCTG
5 'L VX 4/5 GGTCTCTCTCSCAGCYTGTGCTG
5 'L VX 6 GTTCTTGGGCCAATTTTATGCTG
5 'L VA-7 GGTCCAATTCYCAGGCTGTGGTG
5'L VA-8 GAGTGGATTCTCAGACTGTGGTG
2 nd PCR primers
Forward (5'-3 ') Reverse (3'-5 ')
IgH 5 'EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG
TGCAG
3 'NheI JH 1,2,4,5 CTGCTAGCTAGCTGAGGAGACGGT
GACCAG
5 'EcoRI VH1 tot 5 CAACCGGAATTCAGAGGTGCAGCTG
GTGCAG
3 'NheI JH 3 CTGCTAGCTAGCTGAGAGACGGTGA
CCATTG
5 'EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG
GTGGAG
3 'NheI JH 6 CTGCTAGCTAGCTGAGGAGACGGTG
ACCGTG
5 'EcoRI VH3 23 CAACCGGAATTCAGAGGTGCAGCT
GTTGGAG
5 'EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT
GCAGGAG
5 'EcoRI VH 4 34 CAACCGGAATTCACAGGTGCAGCTAC
AGCAGTG
5 'EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT
GGTGCAG
5 'EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT
GGTACAG
5 'EcoRI VH3 33 CTTCCGGAATTCACAGGTGCAGCT
GGTGGAG
5 '3 9 EcoRIVH GATCCGGAATTCAGAAGTGCAGCT
GGTGGAG
5 'EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT
GCAGGAG
5 'EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT
GCAGCAG
κ 5 'EcoRI VK-1 5 CAACCGGAATTCAGACATCCAGATGA
CCCAGTC
3 'BsiWI JK 1-4 GCCACCGTACGTTTGATYTCCACCTTGGTC
5 'EcoR1 VK-1 9 CTTCCGGAATTCAGACATCCAGTTGAC
CCAGTCT
3 'BsiWI JK 2 GCCACCGTACG TTTGATCTCCAG
CTTGGTC
5 'EcoR1 VK-1D 43 CTTGGCGAATTCAGCCATCCGGATGA
CCCAGTC
3 'BsiWI JK 3 GCCACCGTACGTTTGATATCCACT
TTGGTC
5 'EcoR1 VK-2 24 CTTCCGGAATTCAGATATTGTGATGA
CCCAGAC
5 'EcoR1 VK-2 28 CTTCCGGAATTCAGATATTGTGATG
ACTCAGTC
5 'EcoR1 VK-2 30 CTTCCGGAATTCAGATGTTGTGATGA
CTCAGTC
5 'EcoR1 VK-3 11 CTTCCGGAATTCAGAAATTGTGTTG
ACACAGTC
5 'EcoR1 VK-3 15 CTTCCGGAATTCAGAAATAGTGATG
ACGCAGTC
5 'EcoR1 VK-3 20 CTTCCGGAATTCAGAAATTGTGTTGA
CGCAGTCT
5 'EcoR1 VK-4 1 CTTCCGGAATTCAGACATCGTGATG
ACCCAGTC
5 'EcoR1 VX 1 CTTCCGGAATTCACAGTCTGTGCT
GACKCAG
3 'Avril Jλ 1-3 CTGGTTACCTAGGAGGACGGTSACCT
TGGTCCC
5 'EcoR1 VX 2 CTTCCGGAATTCACAGTCTGCCC
TGACTCAG
3 'Avril Jλ 4 CTGGTTACCTAGGAAAATGATCAGC
TGGGTTCC
5 'EcoR1 VX 3 CTTCCGGAATTCATCCTATGAGC
TGACWCAG
3 'Avril Jλ 5 CTGGTTACCTAGGAGGACGGTCAGC
TCGGTCCC
5 'EcoR1 VX 4-5 CTTCCGGAATTCACAGCYTGTG
CTGACTCA
3 'Avril Jλ 6 CTGGTTACCTAGGAGGACGGTCAGCT
GGGTGCC
5 'EcoR1 VX 6 CTTCCGGAATTCAAATTTTATGC
TGACTCAG
3 'Avril Jλ 7 CTGGTTACCTAGGAGGACGGTCAC
TTGGTCCAT
5 'EcoR1 VX 7-8 CTTCCGGAATTCACAGRCTGTG
GTGACYCAG
"> Tabel 1. Primers gebruikt.

eft "> 0.080
1 2 3 4 5 6 7 8 9 10 11 12
EEN 0,076 0,077 2.003 0.080 0,138 0,102 0,188 0.338 0,040 2.041 0,051 0.081
B 2.011 0,085 0,074 0,069 0.081 0,122 0.372 2.133 0,119 0,097 0,072 0,072
C 0,068 0.179 0,091 0,073 0,077 0,097 0,606 1.882 0.081 2,071 0,094 0,075
D 0,063 0,070 0,065 0,071 0,082 2,071 0,339 2.089 0,076 0,086 0,066 0,069
E 1.921 0,077 0,065 0,085 0,095 1.968 1.910 0,122 0,072 0,070 0,065 0,066
F 0,113 0,068 0,066 0,082 0,088 0.090 0.460 0,070 0,079 0,952 0,098 0,065
G 2.041 2.108 1.472 0,665 0,331 0,194 0,123 0,094 0,072 0,070 0,072
H 2.146 2.132 1.634 0,665 0,341 0,178 0,132 0,094 0,082 0.080 0,074 0,068
Normen ng / ul 1000 500 250 125 62.5 31.25 15.6 7.8 3.9 1.95 0.975 0

Tabel 2. Representatieve resultaten van IgG screening door middel van ELISA. Kloon supernatanten zijn in A1-A10, B1-B10, C1-C10, D1-D10, E1-E10, F1-F10. Blanks zijn in A11, B11, C11, D11, E11, F11, A12, B12, C12, D12, E12, F12.Standard curve wordt gedupliceerd: G1-G12 en H1-H12. De bijbehorende concentratie van immunoglobulinen in elke duplo weergegeven below.Positive of IgG producerende klonen worden getoond in donkergrijs. Negatieve of non-IgG producerende klonen worden getoond in lichtgrijs

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In dit manuscript worden alle stappen voor het genereren van IgG-antilichamen uit humane PBMCs gedetailleerd besproken. Dit protocol bevat een aantal voordelen ten opzichte van eerder gepubliceerde technieken. Eén van de voordelen is dat de aanwezigheid van antilichamen houdt de zware en lichte ketens die overeenkomen met de oorspronkelijke pair in de B-cel kloon. De identificatie van IgG-antilichamen kan worden uitgevoerd in elk type van menselijke donor, en er is geen behoefte aan verergering van de immuunrespons door vaccinatie 5. Het gebruik van de fibroblastcellijn WI38 als feeder-cel, kan een snellere detectie van de groeiende klonen, omdat ze morfologisch verschillende en zeer gemakkelijk te onderscheiden ten opzichte van de PBMC als feeder cel eerder beschreven werkt 1,6- 8. Bovendien is het gebruik van WI38 als feeder cel bevordert het invriezen van grote hoeveelheden cellen hoeveelheden die gemakkelijk kunnen worden ontdooid en gekweekt voor elk experiment.

Eén van de critical stappen in dit protocol is het uitgangsmateriaal: de PBMC. Wanneer het bloed te lang gewacht centrifugeren of na de extractie van de PBMC's, ze worden niet in de juiste vorst; als zodanig het aantal levensvatbare cellen wordt verminderd, met het aantal van de B-cel IgG producerende klonen verkregen. Daarom vroeg extractie en een goede conservering van de PBMC's worden aanbevolen voor een succesvol resultaat. Het aantal IgG producerende klonen zal worden beperkt tot het aantal PBMCs aan het begin van het experiment. Hogere aantallen PBMC hoger aantal IgG producerende klonen en diverse antilichaamproductie geven. Een andere belangrijke stap is de klonering van het PCR-fragmenten van de lichte en zware ketens van het antilichaam. Indien de ligatie niet succesvol na verschillende pogingen, is een extra stap van het kloneren van het PCR product 2 e in een TopoTA systeem aanbevolen. De digestie van het insert met de geschikte enzymen kan makkelijkerin de TopoTA vector, voor een volgende ligatie in de pFUSEss expressievectoren.

Deze techniek kan worden overgedragen naar een soorten menselijke weefsels waarbij humane B-cellen zijn verrijkt 3. Het kan ook worden toegepast op de studie van andere immunoglobulinen, alleen door verandering van de gemerkte antilichamen voor het sorteren (antilichamen tegen IgM, IgE, IgA en IgD), de primer ontwerp voor de PCR, en de expressie vectoren. De studies van deze immunoglobulinen kunnen van belang te begrijpen, aanvankelijk immuunreacties mucosa antilichaamuitscheiding en allergie profielen, onder anderen.

Concluderend hebben we een techniek om menselijke recombinant monoklonale IgG-antilichamen die de zware en lichte ketens paren van het humane immunoglobuline intact laat produceren beschreven. De techniek is nuttig en gemakkelijk uit te voeren uitgaande van een bloedmonster. De monoklonale antilichamen verkregen door middel van deze werkwijze mogelijk bruikbaar in studies naar menselijk immuunsysteemresponsen. Bovendien kunnen monoklonale antilichamen met deze methode een goed uitgangspunt voor het ontwikkelen van immuno-therapeutica voor verschillende pathologische omstandigheden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat ze geen concurrerende financiële belangen.

Acknowledgments

Onderzoek contract Miguel Servet (ISCIII CD14 / 00032) naar (GN-G.). Fellowship uit Nederland Organisatie voor Wetenschappelijk Onderzoek "Graduate School Translationele Neurowetenschappen Program" (022005019) tot (CH).

Subsidies van het Prinses Beatrix Fonds (Project WAR08-12) en de Association Française contre les Myopathies naar (PM-M.); alsmede door een Veni Fellowship van Nederland Organisatie voor Wetenschappelijk Onderzoek (916.10.148) een gemeenschap van de Hersenstichting Nederland (FS2008 (1) -28) en het Prinses Beatrix Fonds (Project WAR08-12) (ML ).

Wij danken Jozien Jaspers voor haar hulp in de B-celsortering door middel van flowcytometrie.

Materials

Name Company Catalog Number Comments
Histopaque-1077  Sigma-Aldrich 10771 solution containing polysucrose and sodium diatrizoate
FACSAria II cell sorter  BD Biosciences 
96 U-bottom micro well plates  Costar 3799
Advanced Roswell Park Memorial Institute (RPMI) 1640 medium  Gibco, Life Technologies 12633-020
30% v/v EBV-containing supernatant of the B95-8 cell line   ATCC CRL-1612 3.4 x 108 copies/ml
CpG2006  Invivogen ODN 7909
Wi38 cells  Sigma-Aldrich 90020107
Interleukin-2 Roche  10799068001
ELISA plates Greiner Bio-One, Microlon 655092
AffiniPure F(ab')2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific (unconjugated) Jackson ImmunoResearch 109-006-008
4% non-fat dry milk (Blotting Grade Blocker)  Biorad 170-6404
Human IgG  Sigma I 2511 HUMAN IgG purified Immunoglobulin, 5.6 mg/ml
Goat F(ab)2 antihuman IgG Fcγ (conjugated with peroxidase (PO)) Jackson ImmunoResearch 109-036-008
ELISA reader (Perkin Elmer 2030)  Perkin Elmer  2030-0050
Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc5µ  Jackson ImmunoResearch 309-035-095
SuperScript III Cells Direct cDNA Synthesis System  Invitrogen  18080-200
Applied Biosystems (ABI) GeneAm PCR System 2700 Applied Biosystems
High Pure RNA Isolation Kit  Roche 11828665001
Reverse transcription system kit  Promega A3500
Recombinant Taq DNA Polymerase TAKARA R001A
Primers (2 μl) Sigma
Ultrapure Agarose  Invitrogen 16500-500
100 bp ladder Invitrogen 15628-019
Quantity One 4.5.2 (Gel Doc 2000) Biorad 170-8100
QIAquick PCR purification kit QIAGEN 28106
BigDye Terminator v3.1 cycle sequencing kit  Applied Biosystems 4337455
0.1 ml reaction plate (MicroAMP Optical 96-well) Applied Biosystems 4346906
Genetic analyser ABI300  Applied Biosystems 4346906
DH5α competent cells (E. coli) Invitrogen 18263-012
pFUSEss-CHIg-hG1 (4,493 bp) Invivogen pfusess-hchg1
pFUSEss-CHIg-hG4 (4,484 bp)  Invivogen pfusess-hchg4
pFUSE2ss-CLIg-hk (3,875 bp) Invivogen pfuse2ss-hclk
pFUSE2ss-CLIg-hl2 (3,883 bp)  Invivogen pfuse2ss-hcll2
SOC medium Invitrogen 15544-034
LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar) Invivogen fas-zn-s
Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB) Invivogen fas-zn-l
DNA Miniprep kit  Omega Bio Technology D6942-02
Nanodrop (ND1000 Spectrophotometer) Nanodrop
LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar) Invivogen fas-bl-s
Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB) Invivogen fas-bl-l
EcoRI New England Biolabs R0101S 20,000 U/ml, in 10x NEBuffer EcoRI
NheI New England Biolabs R0131S 10,000 U/ml, in 10x NEBuffer 2.1
2-Log DNA ladder New England Biolabs N3200S 0.1-10.0 kb, 1,000 μg/ml
XmaI New England Biolabs R0180S 10,000 U/ml, in 10x CutSmart Buffer 
BsiWI New England Biolabs R0553S 10,000 U/ml, in 10x NEBuffer 3.1
AvrII New England Biolabs R0174S 5,000 U/ml, in 10x CutSmart Buffer 
FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 1 U/µl, in 10x FastAP Buffer
DH5α competent cells  Invitrogen 18263-012
PE Mouse Anti-Human IgG BD Pharmingen 555787
anti-CD22, PerCP-Cy5.5, Clone: HIB22 Fisher scientific BDB563942
QIAprep Spin Miniprep Kit  QIAGEN 27106
BigDye Terminator v3.1 Applied Biosystems 4337455

DOWNLOAD MATERIALS LIST

References

  1. Vrolix, K., et al. Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor. J Autoimmun. 52, 101-112 (2014).
  2. Yamashita, M., Katakura, Y., Shirahata, S. Recent advances in the generation of human monoclonal antibody. Cytotechnology. 55, (2-3), 55-60 (2007).
  3. Pereira, K. M., Dellavance, A., Andrade, L. E. The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies. Clin Chim Acta. 437, 403-410 (2014).
  4. Losen, M., et al. Treatment of myasthenia gravis by preventing acetylcholine receptor modulation. Ann N Y Acad Sci. 1132, 174-179 (2008).
  5. Smith, K., et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen. Nat Protoc. 4, (3), 372-384 (2009).
  6. Fraussen, J., et al. A novel method for making human monoclonal antibodies. J Autoimmun. 35, (2), 130-134 (2010).
  7. Traggiai, E., et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 10, (8), 871-875 (2004).
  8. Fraussen, J., et al. Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients. J Neuroimmunol. 261, (1-2), 98-107 (2013).
  9. Yamashita, M., et al. Different individual immune responses elicited by in vitro immunization. Cytotechnology. 40, (1-3), 161-165 (2002).
  10. Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. Human B cell immortalization for monoclonal antibody production. Methods Mol Biol. 1131, 183-189 (2014).
  11. Tiller, T., et al. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 329, (1-2), 112-124 (2008).
  12. Lanzavecchia, A., Corti, D., Sallusto, F. Human monoclonal antibodies by immortalization of memory B cells. Curr Opin Biotechnol. 18, (6), 523-528 (2007).
  13. Traggiai, E. Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies. Methods Mol Biol. 901, 161-170 (2012).
  14. Strober, W., et al. Monitoring cell growth. Curr Protoc Immunol / edited by. John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).
  15. Ibrahim, S. F., van den Engh, G. Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol. 106, 19-39 (2007).
  16. Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. Effects of feeder cells on the X-ray sensitivity of human colon cancer cells. Radiother Oncol. 21, (1), 53-59 (1991).
  17. Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines. J Vis Exp. (57), 3321 (2011).
  18. Smith, L. M., et al. Fluorescence detection in automated DNA sequence analysis. Nature. 321, (6071), 674-679 (1986).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics