طرق بالتحقيق في الدور التنظيمي للالرنا الصغيرة وخاص بالريبوسوم إشغال * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

التباين الوراثي المسؤول عن أليل المنجلي (HBS) يمكن الكريات الحمراء أن تقاوم العدوى عن طريق طفيلي الملاريا، P. المنجلية. الأساس الجزيئي لهذه المقاومة، والذي يعرف لتكون سياقاتها، لا تزال غير مفهومة. وجدت الدراسات الحديثة أن التعبير التفاضلية من microRNAs كرات الدم الحمراء، translocated مرة واحدة في طفيليات الملاريا، تؤثر على كل من تنظيم الجينات والنمو الطفيلي. وقد أظهرت هذه miRNAs في وقت لاحق لمنع الترجمة مرنا من خلال تشكيل نسخة RNA خيالية عبر 5 "الانصهار RNA مع مجموعات فرعية سرية للمن mRNAs الطفيلي. هنا، والتقنيات التي استخدمت لدراسة دور وظيفي والمفترضة آلية microRNAs كرات الدم الحمراء الكامنة على تنظيم الجينات وإمكانات متعدية من P. المنجلية، بما في ذلك ترنسفكأيشن من microRNAs الاصطناعية تعديل في كريات الدم الحمراء المضيف، سيتم تفصيله. وأخيرا، يتم استخدام طريقة polysome التدرج لتحديد مدى هيئة تنظيم الاتصالاتnslation من هذه النصوص. معا، سمحت هذه التقنيات لنا لإثبات أن مستويات dysregulated من microRNAs كرات الدم الحمراء تساهم في مقاومة الملاريا خلايا كريات الدم الحمراء المنجلية الجوهرية.

Introduction

الملاريا، التي تسببها الطفيليات apicomplexan من جنس المتصورة، هو مرض طفيلي البشري الأكثر شيوعا، وتصيب عالميا ما يقرب من 200 مليون شخص كل عام، وتسبب حوالي 600،000 حالة وفاة 1. من الأنواع المتصورة الخمسة التي تصيب البشر، والأكثر صلة الأمراض التي تصيب البشر هي P. المنجلية وP. النشيطة، ويرجع ذلك إلى توزيع واسعة النطاق واحتمال حصول مضاعفات حادة بالملاريا. دورة حياة طفيل الملاريا تتطلب إصابة كل من البعوض والبشر. عندما تلدغ بعوضة مصابة الإنسان، والطفيليات السفر عبر مجرى الدم إلى الكبد، حيث تحدث في الجولة الأولى من النسخ المتماثل. بعد merozoites تمزق من الكبدية المضيفة، فإنها تصيب خلايا الدم الحمراء القريبة، بدء النسخ المتماثل إما اللاجنسي والجنسي. المرحلة اجنسي النسخ المتماثل، الذي يستمر 48 ساعة في P. المنجلية، هو محور هذه الدراسة لأنه على حد سواء مصدر معظم المالأعراض الأغنية ولخص بسهولة في المختبر.

في حين أن عددا من المبادرات الصحية العامة، بما في ذلك تحسين العلاجات المضادة للملاريا، قد قللت إلى حد ما من عبء الملاريا على الصعيد العالمي، واستمرار ظهور الطفيليات المقاومة للأدوية يمثل مشكلة لجهود مكافحة الملاريا. منطقة واحدة والتي قد تشير إلى طرق علاجية جديدة هي دراسة عن كيفية مختلف المتغيرات الجينية تمنح المقاومة للملاريا. في المناطق التي تتوطن فيها الملاريا، ومجموعة متنوعة من الأشكال الكريات الحمراء شائعة جدا 2،3. هذه الطفرات، مع خلية المنجل يجري لعل أبرز، غالبا ما ترتبط مع المقاومة كبيرة لظهور أعراض الإصابة بالملاريا 4. وغير مفهومة الآليات الكامنة التي كانت تسبب الكريات الحمراء أن تقاوم الإصابة بالملاريا. الكريات الحمراء مطفول مع الطفرات الهيموجلوبين تخضع لتعزيز البلعمة من خلال تعزيز صلابة الخلوية والجفاف، والتيويرتبط مع غزو بنسبة P. المتصورات المنجلية 5. يؤثر على أليل HBC أيضا تعبير البروتين على سطح كرات الدم الحمراء ومع إعادة تشكيل الهيكل الخلوي، مما يزيد من إعاقة التنمية الطفيلي 6،7. وأخيرا، P. المنجلية ينمو بشكل سيئ داخل المنجل متماثل (HBSS) الكريات الحمراء 8،9 في المختبر، مما يشير إلى العوامل الكريات الحمراء الجوهرية للمقاومة الملاريا. ومع ذلك، في حين أن جميع هذه الآليات يبدو أن تلعب دورا، لكنها لا تفسر تماما الآليات وراء مقاومة الخلايا المنجلية للملاريا.

مجموعة واحدة محتمل من العوامل الكريات الحمراء التي لا تزال غير مفهومة هو مجموعة كبيرة من ميرنا موجودة في كرات الدم الحمراء الناضجة. MicroRNAs هي الرنا غير المكودة صغيرة، 19-25 الإقليم الشمالي في الحجم، الذي توسط الترجمة و / أو استقرار من mRNAs الهدف عن طريق الاقتران قاعدة داخل 'UTR 3. قد تورطت أنهم في السيطرة على الاستجابات المناعية الثدييات، بما في ذلك قمع سو تكاثر الفيروس 10، وعرضت للتشاور المقاومة للفيروسات في النباتات كما تم أظهروا لتنظيم العديد من العمليات الكريات الحمراء، بما في ذلك الكريات الحمر 11،12 واستقلاب الحديد 13. حددت دراسات سابقة السكان وفيرة ومتنوعة من miRNAs الكريات الحمراء، الذي التعبير تم تغيير بشكل كبير في HBSS الكريات الحمراء 14،15. منذ كريات الدم الحمراء الناضجة تفتقر النسخ النشط والترجمة، ودور وظيفي من هذه miRNAs كرات الدم الحمراء لا يزال غير واضح. كما يحدث تبادل مادي كبير بين الخلية المضيفة وP. المنجلية خلال دورة التنموية داخل الكريات الحمر (IDC) 16، وكانت هناك تكهنات بأن الملف الشخصي ميرنا غيرت داخل كريات الدم الحمراء HBS قد تسهم بشكل مباشر في مقاومة الملاريا الخلايا الذاتية.

هذه الدراسات أدى في النهاية إلى تطوير خط أنابيب لعزل وتحديد وظيفيا دراسة دور ميرنا البشري داخل مالجناحية الطفيلي، P. المنجلية، التي أشارت إلى أن تلك المضيف / miRNAs الإنسان في نهاية المطاف تساهميا فتيل ثم تقمع translationally النصوص الطفيلي مرنا 17. قدمت هذا مثال من أول عبر أنواع النصوص خيالية شكلتها العابر للالربط وتورط أن هذا الانصهار ميرنا-مرنا يمكن أن تحدث في الأنواع الأخرى، بما في ذلك الطفيليات الأخرى. كل من mRNAs المثقبيات هي العابرة تقسم مع لصق زعيم (SL) لتنظيم الفصل بين النصوص متعدد المقارين 18. منذ P. المنجلية يفتقر orthologs لالمقامر / منذ 19،20، فمن الممكن أن miRNAs كرات الدم الحمراء يخطفون الآلات SL مماثلة في P. المنجلية للاندماج الجينات المستهدفة. الدراسات التي أجريت مؤخرا في P. المنجلية يكون في الواقع أشارت إلى وجود 5 'تسلسل زعيم لصق 21. تفاصيل هذه الدراسة الأساليب التي أدت إلى اكتشاف للطفيليات الإنسان ميرنا-مرنا النصوص الانصهار، بما في ذلك transcriptomic وtranslaتقنيات تنظيم tional. الأهداف العامة لهذه الأساليب هي للتحقيق في آثار الرنا صغيرة في تنظيم الجينات، الظواهر والترجمة إمكانات P. النصوص المنجلية.

تحديد الأولي من النصوص خيالية-الطفيليات البشرية الاعتماد على استخدام تقنيات تحليل الحمض النووي الريبي، مثل الوقت الحقيقي PCR، والتسلسل Transcriptome على وEST القبض على المكتبة، والتي شملت كل من إجمالي والصغيرة الرنا، بدلا من استخدام التقنيات التي معزولة فقط الرنا الصغيرة. عزل جميع RNA معا في تجمع واحد كبير، وليس بشكل منفصل، يسمح بتحديد كل من الرنا صغيرة الإنسان translocated في الطفيليات وكذلك وجود هذه تسلسل الحمض النووي الريبي الصغيرة كجزء من سلسلة أكبر. هذا ثم يطلب تحليلا للدولة ترجمة هذه من mRNAs الانصهار لتحديد العواقب الوظيفية لهذه اندماج.

في حين جهود واسعة النطاق على توصيف الجينوم والطفيليوأضافت د Transcriptome على لفهم البيولوجيا الطفيلي 22-25، كما هو معروف أقل بكثير عن تنظيم متعدية من Transcriptome على مرنا عبر دورة حياة P. المنجلية 26. هذا الفهم المحدود للبروتيوم الطفيلي أعاق على حد سواء فهم البيولوجيا الطفيلي والقدرة على تحديد أهداف جديدة للجيل القادم من العلاجات المضادة للملاريا. وقد استمرت هذه الفجوة في فهم بيولوجيا الخلية الطفيلي يرجع إلى حد كبير إلى عدم وجود تقنيات كافية للتحقيق في تنظيم متعدية في P. المنجلية. ووصفت ورقة واحدة الأخيرة استخدام البصمة الريباسي من P. المنجلية لتحديد حالة الترجمة العالمي 21. واحدة قياس راسخة من إمكانات متعدية من النصوص هو عدد ريبوسوم المرتبطة يحددها polysome التنميط. ومع ذلك، عندما يتم تطبيق هذه التقنية لP. المنجلية </ م>، فإنه غير قادر على استعادة معظم polysomes ويلتقط الغالب monosomes. في الآونة الأخيرة، عدة مجموعات 27،28 وقد الأمثل P. تقنيات polysome المنجلية من قبل الناشر لكرات الدم الحمراء والطفيليات في وقت واحد للحفاظ على polysomes وتميز الإشغال الريباسي وإمكانات متعدية هذه طفيليات الملاريا خلال تطوير اللاجنسي في المضيف خلايا الدم الحمراء (28).

بشكل جماعي، وهذه الأساليب تدل على أن الانصهار الملحوظ من الإنسان ميرنا والطفيليات من mRNAs ينظم ترجمة البروتين الطفيلي تلك من mRNAs الانصهار، والذي تجلى باستخدام أساليب ذكرت سابقا 27، و هي المحدد الرئيسي لمقاومة الملاريا في مهايئات الناقل المضيف وHBSS الكريات الحمراء (17). أن هذه الأساليب تكون مفيدة في أي نظام تتطلع لتحديد وظيفيا استكشاف الأحداث RNA الربط، سواء كانت تلك الرنا الانصهار ضمن P. المنجلية أو أنظمة حقيقيات النوى الأخرى.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: عزل الرنا صغيرة الحجم من P. المنجلية خلال IDC

  1. الحصول على طفيليات الملاريا في الثقافة اللاجنسي 29.
    ملاحظة: تختلف حجم الثقافة المطلوبة استنادا إلى التطبيق المطلوب. ومع ذلك، ثقافة 10 مل في 3-5٪ الطفيل و 5٪ الهيماتوكريت توفر RNA وافرة في الوقت الحقيقي PCR (RT-PCR). تم تحسين تقنية في البداية للثقافات غير متزامن، ولكن عندما يتم المطلوب نقطة زمنية محددة خلال دورة العدوى والطفيليات مرحلة الحلقة يمكن أن تكون متزامنة من قبل تزامن السوربيتول في موعد لا يتجاوز 10-12 ساعة بعد الغزو. وينبغي تكرار التزامن بعد دورة واحدة (حوالي 48 ساعة) 29.
  2. الخلايا المصابة تجمع معا (~ 5 × 10 9 كرات الدم الحمراء في الطفيل 3-5٪) وملء PBS الباردة إلى الجزء العلوي من الأنبوب وأجهزة الطرد المركزي في 800 x ج لمدة 5 دقائق من دون فرامل لتكوير خلايا الدم الحمراء.
  3. بعد الطرد المركزي، وإزالة طاف بعناية باستخدام ماصة الشفط، وتعلقإلى فراغ، لأن بيليه كريات الدم الحمراء من السهل طرد. يغسل بيليه مرة أخرى مع 1X PBS الباردة.
  4. Resuspend بيليه خلية في البارد 0.15٪ سابونين (في برنامج تلفزيوني 1X) ومكان على الجليد لمدة 30 دقيقة.
  5. خلايا الطرد المركزي في 1500 x ج لمدة 12 دقيقة في 4 درجات مئوية، وإزالة طاف (والتي سوف تكون حمراء داكنة اللون) و resuspend بيليه في برنامج تلفزيوني الباردة. كرر هذه الخطوة مرة أخرى.
    ملاحظة: من أجل ضمان أن microRNAs الحالية كانت عاكسة من microRNAs داخل الطفيليات، وليس التلوث كريات الدم الحمراء، تم اختبار عدد من الشروط العزلة الطفيلي: 1) سابونين تحلل، 2) سابونين تحلل جنبا إلى جنب مع العلاج RNaseA من miRNAs الخلية المضيفة و3 ) ميثيل-بيتا-سيكلودكسترين العلاج لإزالة الطفيليات من كرات الدم الحمراء المضيف. أعطت كل العلاجات نتائج مماثلة.
  6. ليز بيليه الطفيلي معزولة باستخدام أوصى 600 ميكرولتر من تحلل العازلة. هذا الحجم من تحلل العازلة كافية للثقافات يصل إلى ~ 30 مل في 2٪ الهيماتوكريت و 5٪ الطفيل.
    ملاحظة: للحصول على الثقافات الطفيلي أكبر، ويمكن زيادة هذا الحجم. من المهم لضمان تحلل كامل للبيليه الطفيلي من قبل vortexing شامل ل1 دقيقة على الأقل. أيضا، لسهولة استخراج والعينات هي lysed يمكن نقلها إلى أنبوب 1.7 مل microcentrifuge ل.
  7. إضافة 60 ميكرولتر، أو 10/01 حجم المخزن المؤقت تحلل المستخدمة في الخطوة 6 من جناسة المضافة (خلات 2 M الصوديوم، ودرجة الحموضة 4).
  8. ترك العينات في الثلج لمدة 10 دقيقة.
  9. إضافة 600 ميكرولتر، أو حجم مساو لكمية من تحلل العازلة وأضاف في الخطوة 6، حامض الفينول choloroform لكل عينة ودوامة لمدة 1 دقيقة.
  10. فصل المراحل المائية والعضوية بواسطة الطرد المركزي العينات في 10000 x ج لمدة 5 دقائق. هذا الدوران هو أطول من ذلك الذي اقترحته عدة لضمان أن جميع الهيموجلوبين / هيموزوين في المرحلة العضوية.
  11. جمع العليا (مائي) طبقة ونقلها إلى أنبوب جديد. كرر الخطوات من 9 و 10 إذا كانت المرحلة المائية بيضاء أو (على الأرجح) في اللون البني، الأمر الذي يوحي للمحترفينتلوث البروتين.
  12. تحديد حجم طاف الناتجة بواسطة ماصة ثم قم بإضافة 1.25 حجم الإيثانول بنسبة 100٪ (~ 800 ميكرولتر) وتخلط بواسطة قلب من 1.7 مل أنبوب microcentrifuge 5 مرات.
  13. تمرير كل عينة من خلال ملزم RNA خرطوشة فلتر المقدمة (تتوفر عدة مختلفة منها تجاريا) إما عن طريق الطرد المركزي في 14000 x ج لمدة 1 دقيقة أو باستخدام مشعب فراغ.
  14. غسل فلتر خرطوشة مع 700 ميكرولتر من ميرنا غسل العازلة 1 يستخدم microcentrifuge ل، والغزل في 14000 x ج لمدة 1 دقيقة.
  15. غسل فلتر خرطوشة مع 500 ميكرولتر غسل العازلة 2/3 مرتين من قبل الطرد المركزي في 14000 x ج لمدة 1 دقيقة لكل منهما.
  16. أزل RNA مع 100 المياه DEPC ميكرولتر، والتي تم تسخينها إلى 95 درجة مئوية، في اثنين من يغسل من 50 ميكرولتر، الطرد المركزي في 14000 x ج لمدة 1 دقيقة لكل منهما. قياس تركيز الحمض النووي الريبي عن طريق امتصاص الأشعة فوق البنفسجية في 260nm.
    ملاحظة: هلام RNA (إما TBE اليوريا مادة الأكريلاميد أو تغيير طبيعة هلام الفورمالديهايد الاغاروز) يمكن بالبريد المستخدمة لتقييم حجم التوزيع من الرنا المعزولة.
    ملاحظة: هذا RNA هو مناسبة لتحليلها من قبل ميكروأري، RNA التسلسل، وصمة عار الشمالية وفحص حماية ريبونوكلياز.

2: الكميات من الرنا صغيرة الحجم من P. المنجلية خلال IDC

  1. تحديد تركيز عينات فردية معزولة في الخطوة 1 باستخدام القياس الطيفي للأشعة فوق البنفسجية في 260 نانومتر.
  2. تولد في الوقت الحقيقي الاشعال PCR للأنواع RNA المطلوب. لميرنا وحده، وكنا ولم يضف المقايسات ميرنا QPCR، في حين أن من mRNAs أو الانصهار ميرنا-مرنا قمنا بتصميم الاشعال لSYBR الأخضر. لالرنا الانصهار، كان التمهيدي إلى الأمام تسلسل ميرنا نفسها (مير-451: AAACCGTTACCATTACTGAGTT)، في حين كان العكس جينة محددة التمهيدي ~ 100 شركة بريتيش بتروليوم المصب من ميرنا في تسلسل مرنا (PKA-R: ATCGAACATGCTGTGAACAT).
  3. جعل كدنا] من عينات الحمض النووي الريبي باستخدام إما التمهيدي القاسي لmiRNAs (استخدم 20-40 نانوغرام من RNA) وحده أو hexamers عشوائي لمرنا و / أو ميرناالأنواع -mRNA الانصهار (باستخدام 1 ميكروغرام من RNA). مزيج RNA والاشعال لمدة 5 دقائق عند 65 درجة مئوية، ثم تبرد إلى درجة حرارة الغرفة. بعد ذلك، إضافة مزيج الناسخ العكسي (0.5 ميكرولتر عكس الناسخ، 0.5 ميكرولتر ريبونوكلياز المانع، 1 dNTPs ميكرولتر (2.5 ملم لكل منهما)، 4 ميكرولتر 5X العازلة، 2 ميكرولتر 0.1M DTT، 1 ميكرولتر H 2 O).
    1. عينات تعمل على thermocycler قادرة على اكتشاف أي تحقيقات SYBR الخضراء أو TAQMAN. تم تشغيل SYBR الأخضر الكمي PCR 30 لجينات معينة باعتبارها خطوة 3 PCR، 95 درجة مئوية لمدة 15 ثانية، وأدنى التمهيدي درجة الحرارة الصلب ناقص 5 درجات مئوية لمدة 30 ثانية، و 68 درجة مئوية لمدة 30 ثانية، لمدة 40 دورات، وذلك باستخدام SYBR التجاري الرئيسي مزيج الأخضر. تم تشغيل ميرنا الوقت الحقيقي PCR باعتباره من خطوتين PCR، 95 درجة مئوية لمدة 15 ثانية و 60 درجة مئوية لمدة 1 دقيقة، 40 دورات.
    2. تحديد فحوصات باستخدام طريقة ΔΔCt وتطبيع لهم ضد أي رب GTPase (PF08_0110) أو 18S الريباسي 31.

3: مقدمةمن الرنا الصغيرة إلى الملاريا طفيليات

  1. بيليه 300 ميكرولتر من خلايا الدم الحمراء في ترنسفكأيشن (250 ميكرولتر من كرات الدم الحمراء، ما يقرب من 1.5 × 10 9 خلايا، وسوف تستخدم في نهاية المطاف) في وسائل الإعلام الملاريا الكامل بواسطة الطرد المركزي في 800 x ج لمدة 5 دقائق على الفرامل 1.
  2. غسل الكريات الحمراء مرتين مع RPMI وresuspend في cytomix كاملة (120 ملي بوكل، 0.15 ملي CaCl 2 و 10 ملي K 2 هبو 4 / KH 2 PO ودرجة الحموضة 7.6 و 25 ملي HEPES، ودرجة الحموضة 7.6، 2 ملي EGTA، ودرجة الحموضة 7.6. 5 ملي MgCl ودرجة الحموضة تعديلها مع KOH) في 50٪ الهيماتوكريت بعد الطرد المركزي في 800 x ج لمدة 5 دقائق على الفرامل 1.
  3. نقل الخلايا إلى 0.2 سم كفيت electroporation.
  4. إضافة 10 ميكروغرام، أو مناسبة كمية من [أليغنوكليوتيد الاصطناعية المخصصة للcuvettes و resuspend الثقافات.
  5. ضبط electroporator إلى 310 V / 950 μF وتقديم النبض إلى كل كفيت.
  6. Resuspend و300 ميكرولتر من كرات الدم الحمراء داخل كفيت في مرحلة ما قبل تحسنت سوء الكاملوسائل الإعلام والأغنية لوحة منها في 24 لوحات جيدة واحتضان عند 37 درجة مئوية في وعاء محكم مع مزيج غازات الدم الملاريا (3٪ O 5٪ CO 2).
  7. بعد 4 ساعات، ويصيب كرات الدم الحمراء مع transfected النواشط أواخر متزامنة إلى الطفيل النهائي تقريبي من 1٪.
  8. إضافة كرات الدم الحمراء transfected طازجة كل 4-6 أيام على الثقافات المصابين وتحديد الطفيل٪ بحلول FACS باستخدام يويو-1 تلوين، كما هو مبين في الفقرة 4.

4: تحديد كرات الدم الحمراء microRNAs تأثير على الطفيلي معدل الاصابة

  1. أخذ 100 ميكرولتر من ثقافة معلق بواسطة micropipettor ومكان في أنبوب 1.7 مل microcentrifuge ل. يغسل مرتين مع 1 مل من برنامج تلفزيوني 1X وأجهزة الطرد المركزي في microcentrifuge الطاولة بواسطة الطرد المركزي في 800 x ج لمدة 5 دقائق.
  2. بيليه resuspend في 1 مل من 0.025٪ غلوتارالدهيد. احتضان العينات لمدة 20 دقيقة في RT.
    ملاحظة: عينات يمكن تخزينها هنا لعدة أسابيع في 4 درجات مئوية. بعد ذلك، بيليه المصاب RBCS بواسطة الطرد المركزي في 800 x ج لمدة 5 دقائق. يغسل مرتين مع 1 مل من برنامج تلفزيوني 1X.
  3. بيليه resuspend في 1 مل من 0.015٪ سابونين. احتضان عند 4 درجة مئوية لمدة 15 دقيقة. إصابة بيليه كرات الدم الحمراء عن طريق الطرد المركزي في 800 x ج لمدة 5 دقائق. يغسل مرتين مع 1 مل من برنامج تلفزيوني 1X. Repeat.4.3. Resuspend الخلايا في 1 مل من برنامج تلفزيوني 1X تحتوي على 1 ميكرولتر (1،000X) وصمة عار DNA.
  4. تحديد درجات الطفيل على تدفق عداد الكريات، في 488 نانومتر الإثارة و~ 530 نانومتر (FL-1) الانبعاثات.
  5. أولا، بوابة قياس التدفق الخلوي على أساس FSC وSSC للتركيز على كرات الدم الحمراء. ثم قياس درجات الطفيل (كرات الدم الحمراء المصابة) في RBC بوابات كتبها مضان في القناة FL-1.
    ملاحظة: لاحقة الطفيليات المرحلة هي 10X أكثر الفلورسنت من الطفيليات مرحلة سابقة، و~ 100X فوق كرات الدم الحمراء غير المصابة. أيضا، وجمع على سرعة منخفضة يميل للحد من الضوضاء. وأخيرا، فقد تم مقارنة هذا النهج ل3-H هيبوزانتين التأسيس وتلطيخ بالغيمزا، على حد سواء كما ذكرت سابقا 13، وجميع التقنيات غافالبريد نتائج مماثلة.

5: البيوتين وضع العلامات وشطف من ميرنا-مرنا فيوجن المنتجات

  1. من أجل مباشرة أليغنوكليوتيد الاصطناعية المخصصة RNA مع desthiobiotin (DB-) مرتبطة تساهميا إلى نهاية 5 '.
  2. Transfect كرات الدم الحمراء غير المصابة مع Desthiobiotin مترافق (DB-) ميرنا ومعدلة ميرنا (المراقبة السلبية)، كما هو مبين في الخطوة 3.
  3. يصيب كرات الدم الحمراء مع transfected P. المنجلية الطفيليات إلى الطفيل تبدأ من 0.5٪ (الخطوة 1.1).
  4. استخراج الحمض النووي الريبي الطفيلي 4 أيام (96 ساعة) في وقت لاحق كما هو موضح أعلاه في الخطوة 1.
  5. احتضان 10 ميكروغرام من الطفيليات RNA مع 50 ميكرولتر معبأة حبات streptavidin وأضاف عبر micropipette، وتناوب على محور دوار أنبوب microcentrifuge لمدة 1 ساعة على 4 درجات مئوية.
  6. بيليه الخرز في 800 x ج لمدة 30 ثانية، ويغسل مع 20 ملي بوكل و1/1000 ريبونوكلياز المانع.
  7. أزل الرنا من الخرز المنافسة مع 2 مم البيوتين ومع 200 ميكرولتر العازلة RNA القبض على شطف (20 ملي بوكل، 1/1، 000 ريبونوكلياز المانع و 2 ملي البيوتين) في 4 درجة مئوية خلال الليل مع التناوب.
  8. تحديد درجة تخصيب أشار P. النصوص المنجلية باستخدام SYBR الأخضر QRT-PCR، والرنا الميكروي تخصيب (مراقبة إيجابية) من خلال TAQMAN QPCR كما هو مبين في الخطوة 2.

6: فصل Polysome تحديد الريباسي إشغال P. المنجلية

  1. وضع 5 مل من 15٪ محلول السكروز (400 ملي خلات البوتاسيوم، 25 ملي HEPES البوتاسيوم، ودرجة الحموضة 7.2، 15 ملي خلات المغنيسيوم، و 200 ميكرومتر سيكلوهيكسيميد، 1 ملم DTT، 1 ملم PMSF، 40 U / مل ريبونوكلياز المانع، و 15٪ سكروز ) إلى نابذة أنبوب SW41 (14 × 89 ملم).
  2. باستخدام حقنة 5 مل، إضافة 5 مل من 50٪ محلول السكروز (400 ملي خلات البوتاسيوم، 25 ملي HEPES البوتاسيوم، ودرجة الحموضة 7.2، 15 ملي خلات المغنيسيوم، و 200 ميكرومتر سيكلوهيكسيميد، 1 ملم DTT، 1 ملم PMSF، 40 U / مل ريبونوكلياز المانع، و 50٪ سكروز) تحت السكروز 15٪ باستخدام إبرة الصلب الطويلة، ثم قم بإزالة الإبرة.
  3. بعد 2 ساعة، والميل ببطء الأنبوب مرة أخرى في وضع مستقيم ونقل أنبوب إلى جليد، والسماح لتبرد لمدة 15 دقيقة على الأقل قبل تحميل عينة (الخطوة 14).
  4. جمع ما يكفي من المتصورة ثقافة مرحلة الدم -infected لتوليد 100-500 ميكروغرام من الحمض النووي الريبي مجموع، أو ما يقرب من 100 مل الثقافة متزامنة في 3-5٪ الطفيل. إضافة 1/10 عشر أن حجم مستنبت يحتوي 10X (2 ملم) سيكلوهيكسيميد (فروج)، واحتضان عند 37 درجة مئوية لمدة 10 دقيقة.
    1. ثقافات بيليه بواسطة الطرد المركزي في 500 x ج لمدة 7 دقائق مع أجهزة الطرد المركزي (الفرامل 1)، ثم يغسل مرتين مع درجة حرارة الغرفة 1X PBS تحتوي على 200 ميكرومتر فروج. Resuspend والثقافات الطفيلي في برنامج تلفزيوني 1X تحتوي على 200 ميكرومتر فروج وتخزينها على الجليد.
    تقدير حجم الكرية RBC. إضافة تحلل العازلة (400 ملي خلات البوتاسيوم، 25 ملي HEPES البوتاسيوم، ودرجة الحموضة 7.2، 15 ملي خلات المغنيسيوم، و 200 ميكرومتر فروج، 1 ملم DTT، 1 ملم PMSF، 40 U / مل ريبونوكلياز المانع، 1٪ (ت / ت) IGEPAL CA -630، و 0.5٪ (ث / ت) DOC) إلى بيليه RBC إلى الحجم النهائي من 4.25 مل. احتضان المحللة في 4 ° C لمدة 10 دقيقة في حين تناوب.
  5. نقل المحللة إلى أنابيب microcentrifuge، ثم الطرد المركزي العينات في microcentrifuge في 16000 x ج و 4 ° C لمدة 10 دقيقة.
  6. إعداد وسائد السكروز بواسطة pipetting 1.25 مل من البرد 0.5 M الحل سادة السكروز (400 ملي خلات البوتاسيوم، 25 ملي HEPES البوتاسيوم، ودرجة الحموضة 7.2، 15 ملي خلات المغنيسيوم، و 200 ميكرومتر سيكلوهيكسيميد، 1 ملم DTT، 1 ملم PMSF، 40 U / مل ريبونوكلياز المانع، و 0.5 M السكروز) إلى نابذة أنبوب SW55 (13 × 51 ملم).
  7. طبقة بعناية 3.75 مل من طاف المحللة (من الخطوة 7) على رأس وسادة السكروز باستخدام حقنة والصغيرة (~ 27) إبرة قياس. ستورالبريد المحللة المتبقية (~ 500 ميكرولتر) في -80 ° C لاستخراج مجموع مستويات RNA، كما هو مبين في القسم 1.
  8. تحميل العينات إلى الدوار نابذة، قبل المبردة إلى 4 ° C، التي يمكن أن تعقد 13.2 مل أنابيب. الطرد المركزي العينات في 366،000 x ج و 4 درجة مئوية لمدة 146 دقيقة.
  9. باستخدام ماصة، ونقل طاف في أنبوب 15ML المخروطية. تخزين طاف في -80 درجة مئوية لعزل الحمض النووي الريبي من حرة (غير منضم من قبل ريبوسوم) الرنا.
  10. resuspend الكرية الريبوسوم في 500 ميكرولتر من العازلة إعادة تعليق الريبوسوم (400 ملي خلات البوتاسيوم، 25 ملي HEPES البوتاسيوم، ودرجة الحموضة 7.2، 15 ملي خلات المغنيسيوم، و 200 ميكرومتر سيكلوهيكسيميد، 1 ملم DTT، 1 ملم PMSF، و 40 U / مل ريبونوكلياز المانع) قبل pipetting لمدة 5 دقائق.
  11. الطرد المركزي العينات في microcentrifuge في 16000 x ج و 4   ° C لمدة 10 دقيقة.
  12. مع الحفاظ على التدرج من الخطوة رقم 4 على الجليد، وإزالة Parafilm، ثم طبقة بعناية تعليق الريبوسوم على رأس باليود التدرجنانوغرام حقنة والصغيرة (~ 27) إبرة قياس.
  13. تحميل الأنبوب في نابذة فائقة السرعة الدوار قبل المبردة وأجهزة الطرد المركزي التدرجات تحميلها في 200،000 x ج و 4 درجة مئوية لمدة 180 دقيقة. عندما يتم الانتهاء من زيادة ونقصان، طرد تخزين التدرجات في 4 ° C حتى جاهزة للتحميل على المجزئ.
  14. تحميل أنبوب نابذة فارغة في المجزئ التدرج (هذا يمكن أن يكون أنبوب المستخدمة في تشغيل السابق)، ثم يغسل بالماء ريبونوكلياز خالية لمدة 5 دقائق في 100 × 10 السرعة.
  15. أثناء غسل في الخطوة 6.16، تعيين حساسية كاشف امتصاص الأشعة فوق البنفسجية. A حساسية انطلاق جيدة هي 0.2، ولكن هذا قد يكون من الضروري تعديل في يدير في وقت لاحق بناء على إشارة A 254 (التي تختلف بناء على عدد الطفيليات، وما إلى ذلك).
  16. مرة واحدة يتم تعيين حساسية كاشف، تعيين إشارة خط الأساس إلى الصفر بينما المياه تتدفق من خلال كاشف.
  17. بعد غسل جامع جزء، عكس تدفق السوائل حتى خطوط فارغة ثم عينياوفه أنبوب نابذة فارغة.
  18. تشغيل 60٪ محلول السكروز من خلال المجزئ حتى خروجها من الجهاز إبرة.
  19. أدخل الأنبوب الذي يحتوي على التدرج الأول في الجزء العلوي من غرفة التحميل وتشديد الختم، مع الحرص على عدم الإفراط في تشديد. ثم، يخترق قاع الأنبوب مع الإبرة.
  20. إعادة تعيين سرعة تدفق السائل إلى 12.5 × 10 (التي يسيطر عليها التحكم مقبض سرعة تدفق على الجزء الأمامي من المضخة)، ثم قم بتعيين جامع جزء الآلي لجمع 18 كسور ثانية (~ 330 ميكرولتر / جزء) في أنابيب microcentrifuge.
  21. بدء الأمام تدفق محلول السكروز 60٪.
  22. عندما يسقط أول قطرة من الحل التدرج في أنبوب microcentrifuge، والبدء فورا كل من جمع جزء وتسجيلا حيا للإشارة A 254.
  23. مرة واحدة لوحظ انخفاض حاد في إشارة A 254، المقابلة لواجهة بين 50٪ و 60٪ على حلول السكروز، ووقف كل من تدفق السوائل وA 254
  24. تخزين الكسور التدرج في -80   ° C لاستخدامها لاحقا.
  25. عكس تدفق السوائل في 100 × 10 السرعة حتى يصب محلول السكروز 60٪ من الأنبوب نابذة فائقة السرعة.
  26. إذا كان هناك تدرجات إضافية ليجزئ، وإزالة أنبوب نابذة فارغة من غرفة التحميل وإعادة تشغيل من الخطوة 6.21. إذا تم الانتهاء من جميع العينات، وغسل الجهاز كما كان يؤديها في الخطوات 6.16 و 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

التنميط العالمي من الرنا الميكروي البشري في P. المنجلية

استخدمت التقنيات المعروضة هنا لاستخراج microRNAs من الطفيليات في مجموعة متنوعة من الظروف. شيء واحد هو أن نلاحظ أن أجريت عمليات الاستخراج RNA لكرات الدم الحمراء غير المصابة كما هو مبين في 32، والتي غالبا ما كان بمثابة نقطة مرجعية للبيانات الرنا الميكروي المقدمة في كل من هذه المادة والدراسة الأصلية 29. أثبتت تلك الدراسات السابقة أيضا أن كريات الدم الحمراء HBSS تمتلك مستويات أعلى بكثير من بعض miRNAs، مير-451 على وجه الخصوص. كانت التقنيات المشار إليها أعلاه كافية لإظهار التغيرات في وفرة ميرنا في مسح ميزانية الأسرة (مهايئات الناقل المضيف أو HBSS) الطفيليات التي تصيب. تم استخراج عينات الحمض النووي الريبي كما هو مبين أعلاه وتطبيع ضد 18S الريباسي. عينات الطفيليات من HBSS كرات الدم الحمراء، على سبيل المثال، لا تظهر زيادة كبيرة في مستويات عدة microRNAs، بما في ذلك مير-451 (الشكل 1). امتصاص ميرنا من erythr المضيفocyte يتسق أيضا مع دراسات سابقة 34،35.

ترنسفكأيشن من الكريات الحمراء HbAA مع مير-451 ارتفع HbAA مير 451 إلى مستويات مماثلة لكريات الدم الحمراء HBSS (الشكل 1). التدفق الخلوي وتستخدم بعد ذلك لقياس العدوى الطفيلية، من أجل تقييم أثر ميرنا النبات على النمو الطفيلي. وبناء على ذلك، الكريات الحمراء HbAA مع transfected مير-451، مير-223 ومير 181a، جنبا إلى جنب مع جزئية ssDNA تم فحص، عن الآثار من microRNAs على نمو الطفيليات. كان ترنسفكأيشن من ssDNA أو مير 181a أي تأثير على الطفيل (الشكل 2A - D)، في حين ترنسفكأيشن مع مير 451 انخفاض ملحوظ الطفيل، والتي يمكن تخفيفها فقط من المشاركين في transfecting والعقاقير مير-451 بنسبة ضئيلة.

أظهر حجب من microRNAs قبل ترنسفكأيشن من 2'-O-عني microRNAs العقاقير لها تأثير متبادل. الكريات الحمراء HBSS، مع ارتفاع طبيعي مير 451 المستويات و transfected، مع العقاقير مير-451 أو [أليغنوكليوتيد 2'-O-الميثيل (الشكل 3). زيادة تثبيط مير 451 نمو الطفيل في كل من الكريات الحمراء HBSS (الشكل 3C - F). تم حساب النسب المئوية الطفيليات من لا يقل عن 3 transfections مستقل، ثم بلغ متوسط ​​وقدم مثل تغير أضعاف نسبة إلى نمو HBSS (الشكل 3F).

القبض على ميرنا-مرنا الرنا الانصهار التي كتبها البيوتين القبض على الفحص

بعد ترنسفكأيشن من 5'-desthiobiotin-مير-451 (5'Db-مير-451) و5'Db-مير 181، كما هو مبين في القسم أساليب 5، تقرر أن تتابع ميرنا احظ نشأت مع الرنا الميكروي البشري. وأشار تحليل QRT-PCR أن ترنسفكأيشن من 5'Db-مير-451 أدى إلى إثراء PKA-R النصوص الانصهار (الشكل 4).

الفصل Polysome لتحديد الإشغال الريباسي من P. المنجلية

خيمة "> ويرد نموذجي A 254 أثر في الشكل 5A (مع تأكيد الشمالي من محتوى الريباسي في الشكل 5B)، مع كثافة جزء متزايدة من اليسار إلى اليمين على الرسم البياني (أي كسور أخف وزنا إلى اليسار). والأولي A 254 عالية جدا بسبب الامتصاصية بواسطة الهيموغلوبين في الكسور في وقت مبكر، ولكن سرعان ما يسقط على خط الأساس. أول ذروة صغيرة يتوافق مع الوحيدات الريباسي صغيرة (40S)، سرعان ما تبع ذلك من الذروة الثانية، وهو أكبر قليلا ويتوافق مع كبير الوحيدات الريباسي (60S). ذروة الثالثة، والتي هي عموما أكبر لالمتصورة المنجلية، يتوافق مع ذروة صبغي جنسي أحادي (80S)، ونظرا لارتفاعه، و80S ينبغي أن تستخدم كدليل لضبط حساسية كاشف الأشعة فوق البنفسجية لتشغيل اللاحقة (الخطوة 6.17). أيضا، نظرا لحجم ذروة 80S، فإنه من الشائع لل60S إشارة إلى طمس مثل "الكتف" في بداية الذروة صبغي جنسي أحادي، إذا كان كل من 60S 80S وإشارات كبيرة.

بعد الذروة صبغي جنسي أحادي هي قمم المقابلة لpolysomes. تمثل كل قمة متتالية جزء polysome تمثل أعداد أكبر تدريجيا من ريبوسوم (2، 3، 4، الخ). كل الذروة polysome هي أيضا أصغر من الذروة السابقة، وخفض في الارتفاع بنسبة 2-3 أضعاف مع كل عدد polysome التوالي. سوف يعمل نموذجية تسمح حل polysomes تتألف من 5-7 ريبوسوم، على الرغم من قرار تصل إلى polysome 9 مير وقد لوحظ في بعض أشواط مع كمية كبيرة من المواد ابتداء. polysomes العليا يؤلف ما تبقى من أثر، ولا يمكن حلها في ظل هذه الظروف التدرج.

الشكل 1
الشكل 1: يتم رفع مير-451 في كريات الدم الحمراء HBSS Intraparasitic مستويات مير-451، على النحو الذي يحدده في الوقت الحقيقي PCR وتطبيع ضد 18S الريباسي، من الطفيليات معزولة عن المشار إليها.أنواع كرات الدم الحمراء. القيم يعني ± SE.

الرقم 2
الشكل 2: overexpression من مير-451 في كريات الدم الحمراء العادية يمنع نمو الطفيليات (A - C) المؤامرات FACS التمثيلية تشير معدلات الإصابة، كنسبة مئوية من إجمالي RBC بالرمز M1، لأنواع كرات الدم الحمراء هو موضح. (D) معدلات الإصابة مركب مشتق من FACS وتطبيع ضد untransfected HbAA كرات الدم الحمراء. القيم في لوحة AC هي FACS المؤامرات تمثيلية بينما D هو متوسط ​​± SE.

الشكل (3)
الرقم 3: تثبيط مير-451 في كريات الدم الحمراء فقر الدم المنجلي يرفع النمو الطفيلي (A - E) FACS المؤامرات التمثيلية تشير معدلات الإصابة، كنسبة مئوية من إجمالي RBC بالرمز M1، لإيه هو موضحأنواع ythrocyte. (F) معدلات الإصابة مركب مشتق من FACS وتآمر كقيمة طبيعية ضد untransfected HbAA كرات الدم الحمراء. القيم في لوحة AE هي FACS المؤامرات التمثيلية، F هو يعني ± SE.

الرقم 4
الرقم 4: ترنسفكأيشن من مير-451 يثري للPKA-R النصوص الانصهار وتبين أن ميرنا تنصهر هو كريات الدم الحمراء في الأصل إثراء وأشار desthiobiotin، مترافق ميرنا-مرنا النصوص الانصهار التي تم التقاطها بواسطة streptavidin. تم قياس القيم في الوقت الحقيقي باستخدام PCR وتآمر بوصفها والقيمة النسبية مقابل الطفيليات غير transfected. القيم يعني ± SE.

الرقم 5
الرقم 5: ريبوسوم الطفيلي يمكن عزلها عن طريق التدرج السكروز (A - B) أمثللو يتتبع من التشكيل الجانبي polysome المستخرجة من المتصورة المنجلية. (A) تتبع من التشكيل الجانبي polysome المستخرجة من المتصورة المنجلية، مع 40S، 60S، 80S وقمم Polysome (مع # ثوان تشير إلى عدد من ريبوسوم المرتبطة بها) المعروضة. (B) لطخة الشمالية من 18S 28S الريباسي وعبر الكسور الريباسي. القيم يعني ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

مسح ميزانية الأسرة هي واحدة من المتغيرات الهيموجلوبين الأكثر شيوعا في المناطق الموبوءة الملاريا، إلى حد كبير لأن ذلك يوفر الحماية ضد الملاريا الحادة التي تسببها P. المنجلية. التقنيات اللازمة لتوصيف دور الرنا الميكروي البشري في تنظيم الجينات من P. وترد تفاصيل المنجلية طوال هذه المخطوطة. عن طريق استخراج الحمض النووي الريبي مجموع في مثل هذه الطريقة لتشمل جميع الرنا صغيرة، وقبل تنفيذ إجراء الطفيلي تحلل بسيط نسبيا، وكانت قادرة على أن يتم تحديدها من خلال مجموعة متنوعة من التقنيات مستقلة هذه الرنا الانصهار.

هذه الخطوات هي بسيطة نسبيا ولكنها حساسة للمشاكل والتلوث إذا لم تتبع بشكل صحيح. خلال استخراج الطفيلي، فمن الأهمية بمكان لأداء سابونين تحلل لإزالة تلويث الكريات الحمراء المضيفة. هذا صحيح بشكل خاص خلال الخطوة سابونين تحلل من العزلة RNA هذا. المكون ميرنا للمضيف الحمراء خلايا الدم عدة أوامر من حجم زreater من ذلك من الطفيليات، ويرجع ذلك جزئيا إلى معظم خلايا الدم الحمراء كونه غير مصاب، لذلك من المهم جدا لإزالة أكبر قدر من التلوث كريات الدم الحمراء ممكن. ومن المهم أيضا للحفاظ على الثقافة الملاريا في مرحلة صحية وسليمة (إذا كان مطلوبا أو نقطة معينة في دورة العدوى) للحصول على البيانات الشخصية ميرنا دقيقة. وبالمثل، خلال استخراج الفينول كلوروفورم، فمن المهم للغاية للتأكد من المراحل المائية واضحة، وإذا لم يكن، كرر استخراج الفينول كلوروفورم لتجنب أي تلوث المتبقية.

أيضا، في تجربة التقاط desthiobiotin، فمن الأهمية بمكان أن أزل مع وجود فائض من البيوتين واستخدام الحد الأدنى من الخرز streptavidin، وذلك لضمان شطف محددة السليم. شطف من الرنا المربوطة من خلال المنافسة مع البيوتين، بدلا من تمسخ كامل من الخرز أنفسهم والتي ساهمت في الحد بشكل كبير من تخصيب RNA الخلفية. وأخيرا، تم تسليط الضوء على تجربة التقاط desthiobiotin لق واحد سيلة مهمة لإظهار كيف تم القبض على هذه miRNAs، ولكن كانت تستخدم عدة تقنيات أخرى أيضا في الدراسات السابقة لإثبات هذه الرنا الانصهار، مثل البقع الشمالية والمقايسات حماية ريبونوكلياز 29. مثل هذه الأساليب من استخدام microRNAs transfected لاسترداد النصوص المعدلة قد يكون تطبيقها على نطاق أوسع، مثل تنقية البروتين المجمعات المرتبطة بها والتي قد تلعب دور الوسيط في نقل وتجهيز miRNAs transfected.

بينما مختلف النهج الجينوم على نطاق استخدمت لدراسة بروتيوم الملاريا وTranscriptome على 22-25، وهناك عدد قليل من الطرق لعالميا دراسة تنظيم متعدية في P. المنجلية 21،26. هذا التحديد المنهجي يحول دون تحليل عالمي للتنظيم متعدية في P. المنجلية. واحدة من الطرق التجريبية الأكثر شيوعا لدراسة تنظيم متعدية غير polysome التنميط، الذي يقيم الإجمالية للترجمةالنشاط آل استنادا إلى ريبوسوم تحميلها من mRNAs محددة من الفائدة. تفصيلا في هذا المخطوط هو polysome طريقة التنميط الأمثل للاستخدام في طفيليات الملاريا التي lyses كل من كرات الدم الحمراء المصابة والطفيليات داخل. لم الأساليب السابقة لا يتعافى معظم polysomes وجعل الأمر يبدو كما لو أن طفيليات الملاريا لم يكن لديها أعداد غفيرة من polysomes. جعل استخدام تحلل العازلة مع تركيز عال من خلات البوتاسيوم والمغنيسيوم من الممكن ليز كل من خلايا الدم الحمراء والطفيليات بينما الانحلال ريبوسوم بغشاء للسماح للأسر polysomes سليمة.

وهذه الطريقة فعالة من حيث التكلفة لتنقية الريباسي والتنميط يساعد على سد الفجوة في المعرفة القائمة بين Transcriptome على الملاريا وبروتيوم وتمكين تحليل الجينوم على نطاق الدولة متعدية من P. المنجلية. وقد استخدم هذا النهج لمقارنة حالة الترجمة من أوائل وأواخر المرحلة بالمرحلة lood الطفيليات 28، التي نسقت بإحكام التعبير الجيني. بيانات عن تحميل الريباسي النصوص يمكن الحصول بسهولة وتحليلها لتحديد كثافة ريبوسوم على من mRNAs محددة. وعلاوة على ذلك، عندما يقترن مع تزامن السوربيتول، يمكن استخدام التغيرات في كثافة الريباسي لتأسيس كيف يتم تنظيم ترجمة طوال دورة حياة الطفيلي. عزل ريبوسوم باستخدام هذا النهج يتطلب قدرا كبيرا من الثقافة، الأمر الذي يحد من سوء الحظ مراحل دورة حياة الملاريا الذي لا يمكن أن يؤديها. فإن كمية كبيرة من المواد المدخلات أيضا تحد من استخدامها على حد سواء لسلالات مختبر في المختبر المتصورة المنجلية، ويمكن أن يقيد تطبيقها على الكائنات المعدية الأخرى. وأي شخص يستخدم هذا الإجراء تكون قادرة على كشف عن الجينات التي تظهر ملامح ترجمة غير عادية، في محاضر الخاصة التي لا ترتبط مع ريبوسوم، والتي تعكس وسائط بديلة للتنظيم الجينات أيضا. أخيرا،وهذا النهج تمكننا من تقييم كيف تؤثر العوامل المضادة للملاريا رواية ترجمة البروتين وتحديد الآليات المستندة إلى ترجمة المقاومة للأدوية. هذا الخط له فائدة كبيرة في تحديد وتحديد التنظيم بعد النسخي في العديد من النظم التجريبية.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics