שיטות כדי לחקור את תפקיד הרגולציה של RNA הקטן וריבוזומלי תפוסה של * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

הווריאציה הגנטית אחראית לאלל חרמשית (HBS) מאפשרת אריתרוציטים להתנגד זיהום על ידי טפיל המלריה, פ falciparum. הבסיס המולקולרי של התנגדות זו, אשר ידועה להיות גורמים מרובים, נשאר הבין באופן חלקי. מחקרים שנעשה לאחרונה מצאו כי ביטוי ההפרש של מיקרו RNA כדורית אדומה, translocated פעם לטפילי מלריה, להשפיע הן ויסות הגנים וצמיחת טפיל. miRNAs אלה מאוחר יותר הוצג לעכב תרגום mRNA על ידי יצירת תעתיקי הרנ"א chimeric באמצעות 5 היתוך 'RNA עם תת דיסקרטי של mRNAs טפיל. כאן, בטכניקות ששמשו כדי ללמוד את התפקיד הפונקציונלי ומייקרו-רנ"א כדורית אדומה המשוער מנגנון הבסיסי על ויסות הגנים ופוטנציאל translational של פ falciparum, כולל transfection של מיקרו RNA הסינתטי שונה לאריתרוציטים מארח, שיפורט. לבסוף, שיטת שיפוע polysome משמשת כדי לקבוע את מידת translation של תמלילים אלה. יחד, טכניקות אלה אפשרו לנו להוכיח כי רמות dysregulated של מיקרו RNA כדורית אדומה תורמות להתנגדות מלריה תא הפנימי של אריתרוציטים מגל.

Introduction

מלריה, הנגרמת על ידי טפילי apicomplexan של הסוג Plasmodium, היא המחלה טפילית האנושית הנפוצה ביותר, בעולם מדביק כ -200 מיליון אנשים בכל שנה וגורם למותם סביב 600,000 1. של חמישה מיני Plasmodium שלהדביק בני אדם, הרלוונטי ביותר למחלות של בני אדם הוא פ falciparum ופ vivax, בשל ההפצות שלהם נרחבות ופוטנציאל לסיבוכי מלריה חמורים. מחזור החיים של טפיל המלריה דורש זיהום של שני יתושים ובני אדם. כאשר יתוש נגוע נושך אדם, הטפילים לנסוע דרך מחזור הדם אל הכבד, שבו עגול של שכפול ראשוני מתרחש. לאחר merozoites קרע מhepatocyte המארח, הם להדביק תאי דם אדומים סמוכים, ייזום שכפול או מיני או מיני. השלב מיני של שכפול, שנמשך 48 שעות בפ falciparum, הוא המוקד של מחקר זה מאחר שהוא גם המקור של רוב malסימפטומים ואריה הוא סכמו בקלות במבחנה.

בעוד מספר יוזמות בריאות ציבור, לרבות טיפולים נגד מלריה השתפרו, יש מעט הפחית את הנטל של המלריה בעולם, את הופעתה המתמשכת של טפילים עמידים סמים מהווה בעיה עבור מאמצי שליטת מלריה. תחום אחד שיכול להציע גישות טיפוליות חדשות הוא המחקר על איך שונים וריאנטים גנטיים להקנות עמידות למלריה. באזורים נגועים מלריה, מגוון רחב של פולימורפיזם האריתרוציטים הם די נפוץ 2,3. מוטציות אלה, עם חרמשית להיות אולי הבולטים ביותר, הקשורים לעתים קרובות עם התנגדות משמעותית להתפרצות של זיהום המלריה סימפטומטי 4. המנגנונים שבאמצעותם הם גורמים אריתרוציטים להתנגד זיהום מלריה הם הבינו באופן חלקי. אריתרוציטים parasitized עם מוטציות המוגלובין כפופים להרס עצמי משופר באמצעות קשיחות משופרת סלולרית והתייבשות, שמזוהה עם פלישת ירד ב פ falciparum 5. אלל HBC משפיע גם על ביטוי חלבון על פני השטח כדורית אדומה ועם שיפוץ של שלד התא, עיכוב התפתחות טפילה 6,7 נוסף. לבסוף, פ falciparum גדל היטב במגל הומוזיגוטים (HBSS) אריתרוציטים 8,9 במבחנה, המצביעים על גורמי האריתרוציטים פנימיים של התנגדות מלריה. עם זאת, בעוד שכל מנגנונים אלה מופיעים לתפקיד, הם לא מסבירים באופן מלא את המנגנונים מאחורי התנגדות חרמשית למלריה.

סט פוטנציאלי אחד גורמי האריתרוציטים שיישארו הבין היטב הוא המאגר הגדול של הווה מירנה בתוך אריתרוציטים בוגרים. מיקרו RNA הוא RNA קטן קידוד-עישון, 19-25 NT בגודל, אשר מתווך תרגום ו / או יציבות של mRNAs היעד על ידי זיווג בסיס ב'UTR 3. הם היו מעורבים בשליטה של ​​תגובות חיסוניים של יונקים, כוללים הדיכוי oו וירוס שכפול 10, והוצגו להקנות עמידות לוירוסים בצמחים הם גם הוכחו להסדיר כמה תהליכי האריתרוציטים, כוללים כדוריות דם אדום 11,12 וחילוף חומרי ברזל 13. מחקרים קודמים זיהו אוכלוסייה עשירה ומגוונת של miRNAs האריתרוציטים, ביטוי שהיה שינה באופן דרמטי בHBSS אריתרוציטים 14,15. מאז אריתרוציטים בוגרים חסרי שעתוק ותרגום פעילים, התפקיד הפונקציונלי של miRNAs כדורית אדומה אלה עדיין לא ברור. כתמורה חומרית משמעותית מתרחשת בין התא המארח ופ falciparum במהלך המחזור ההתפתחותי intraerythrocytic (IDC) 16, שהעריך כי פרופיל מירנה שינה בתוך אריתרוציטים HBS עשוי תורם ישירות להתנגדות מלריה תא פנימי.

מחקרים אלה הובילו בסופו לפיתוח של צינור לבודד, לזהות ותפקודי ללמוד את התפקיד של מירנה אדם בתוך מ 'טפיל alaria, פ falciparum, אשר ציין כי miRNAs אדם המארח / אלה סופו של דבר קוולנטית נתיך ולאחר מכן translationally להדחיק תעתיקי mRNA טפיל 17. זה סיפק דוגמא של התמלילים הראשונים בין מיני chimeric נוצרו על ידי טרנס שחבור ומפליל שהיתוך מירנה-mRNA זה יכול להיות מתרחש במינים אחרים, כוללים טפילים אחרים. כל mRNAs trypanosome הם עם אחוי-מנהיג (SL)-שחבור טרנס להסדיר את ההפרדה של תמלילי polycistronic 18. מאז פ falciparum חסר orthologs לדייסר / לפני 19,20, זה אפשרי, כי miRNAs כדורית אדומה לחטוף מכונות SL דומות בפ falciparum להשתלב גני המטרה. מחקרים שנעשה לאחרונה בפ falciparum יש למעשה הצביע על הנוכחות של 5 רצפים 'מנהיג אחוי 21. מחקר זה מפרט את השיטות שהובילו לגילוי של תמלילי היתוך אנושי-טפיל מירנה-mRNA, כולל שני transcriptomic ותרגומיםטכניקות רגולציה tional. המטרות הכללית של שיטות אלה הן לחקור את ההשפעות של RNA הקטן בפוטנציאל ויסות הגנים, פנוטיפים ותרגום של פ תמלילי falciparum.

זיהוי הראשוני של תמלילי chimeric אדם טפיל לסמוך על שימוש בטכניקות ניתוח RNA, כמו בזמן אמת PCR, רצף transcriptome ולכידת ספריית EST, שכלל שני RNAs כולל וקטן, ולא תוך שימוש בטכניקות שרק מבודדת RNA קטן. בידוד כל RNA יחד בבריכה אחת גדולה, ולא בנפרד, אפשר זיהוי של שני RNA הקטן אדם translocated בטפיל, כמו גם נוכחות של רצפי RNA הקטנים אלה כחלק מרצף גדול יותר. אז זה נדרש ניתוח של מצב התרגום של mRNAs ההיתוך אלה כדי לקבוע את ההשלכות התפקודיות של שילובים אלה.

בעוד מאמצים רבים באפיון הגנום של הטפילtranscriptome ד הוסיפה להבנת הביולוגיה של הטפיל 22-25, הרבה פחות ידוע על תקנת translational של transcriptome mRNA על פני מחזור החיים של פ falciparum 26. הבנה מוגבלת זו של proteome של הטפיל הפריעה שתי הבנה של הביולוגיה של הטפיל ואת היכולת לזהות מטרות חדשות עבור הדור הבא של תרופות נגד מלריה. פער בהבנה של הביולוגיה התאית של הטפיל זה נמשך במידה רבה בשל חוסר טכניקות נאותות לחקור רגולציה translational בפ falciparum. נייר האחרון אחד תאר את השימוש בfootprinting ריבוזומלי של פ falciparum כדי לקבוע את מצב התרגום העולמי 21. אחת מדידה מבוססת היטב של פוטנציאל translational של תמלילים היא מספר הריבוזומים קשורים נקבעים על ידי polysome פרופיל. עם זאת, כאשר טכניקה זו מיושמת לפ falciparum </ Em>, זה לא יכול לשחזר את רוב polysomes ולוכד בעיקר monosomes. לאחרונה, מספר קבוצות 27,28 אופטימיזציה פ טכניקות polysome falciparum ידי lysing כדורית אדומה וטפיל בו זמנית לשמור על polysomes ולאפיין את תפוסת ריבוזומלי ופוטנציאל translational של טפילי מלריה אלה במהלך ההתפתחות מינית שלהם בתאים אדומים מארח 28.

באופן קולקטיבי, שיטות אלה להוכיח כי ההיתוך הנצפה של mRNAs מירנה והטפיל האנושי מודולציה תרגום חלבון טפיל של mRNAs ההיתוך אלה, שהודגם בשיטות שדווחו בעבר 27, והוא הקובע עיקרי של התנגדות מלריה בHBAs וHBSS אריתרוציטים 17. שיטות אלה יהיו שימושיות בכל מערכת מחפשת לזהות ופונקציונלי לחקור אירועי שחבור רנ"א, אם RNAs ההיתוך אלה נמצאים בפ falciparum או מערכות אחרות אוקריוטים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: בידוד של RNAs הקטן בגודל מפ falciparum במהלך IDC

  1. להשיג טפילי מלריה בתרבות מינית 29.
    הערה: גודל התרבות הנדרשת ישתנה מבוסס על היישום הרצוי; עם זאת, תרבות 10 מיליליטר בהמטוקריט 3-5 parasitemia% ו -5% מספקת RNA בשפע בזמן אמת PCR (RT-PCR). הטכניקה תחילה מותאמת לתרבויות אסינכרוני, אך כאשר נקודות זמן מסוימות במהלך מחזור הזיהום הן רצויים, ניתן לסנכרן טפילי טבעת שלב-ידי סנכרון סורביטול לא יאוחרו מהפוסט-10-12 שעות פלישה. סנכרון יש לחזור אחרי מחזור אחד (כ 48 שעות) 29.
  2. תאים נגועים בריכה יחד (~ 5 x 10 9 RBCs ב3-5% parasitemia) ולמלא את PBS הקר לחלק העליון של הצינור צנטריפוגות ב 800 XG במשך 5 דקות ללא בלם לגלולת התאים האדומים.
  3. לאחר צנטריפוגה, להסיר את supernatant באמצעות פיפטה aspirating בזהירות, מצורףלואקום, מאז גלולה האריתרוציטים קל לעקור. שטוף את הכדור פעם נוספת עם 1x הקר PBS.
  4. גלולה גלולה תא בsaponin 0.15% הקרים (ב1x PBS) ומניחים על קרח למשך 30 דקות.
  5. תאי צנטריפוגה ב 1500 XG דקות 12 ב 4 ° C, להסיר supernatant (אשר יהיה אדום כהה בצבע) וגלול גלול בPBS הקר. חזור על פעולה זו פעם נוספת.
    הערה: על מנת להבטיח שמייקרו RNA נכח רעיוני של מיקרו RNA בתוך טפילים, ולא זיהום האריתרוציטים, מספר תנאי בידוד הטפיל נבדק: 1) תמוגה saponin, 2) בשילוב עם טיפול תמוגה saponin RNaseA של miRNAs תא המארח ו -3 ) מתיל-ביתא-cyclodextrin טיפול כדי להסיר את הטפיל מכדורי האדום המארח. כל הטיפולים נתנו תוצאות דומות.
  6. Lyse גלולה הטפיל המבודד באמצעות 600 μl המומלץ של מאגר תמוגה. נפח זה של מאגר תמוגה מספיק לתרבויות עד ~ 30 מיליליטר בהמטוקריט 2% וparasitemia 5%.
    הערה: לתרבויות טפיל גדולות יותר, ניתן להגדיל נפח זה. חשוב להבטיח תמוגה של גלולה הטפיל מלאה על ידי vortexing היסודי דקות לפחות 1. כמו כן, על מנת להקל על חילוץ, ניתן להעביר דגימות lysed לצינור 1.7 מיליליטר microcentrifuge.
  7. הוסף 60 μl, או 1/10 נפח של מאגר תמוגה משמש בשלב 6, של תוסף homogenate (אצטט 2 M נתרן, pH 4).
  8. השאר על דגימות קרח למשך 10 דקות.
  9. להוסיף 600 μl, או נפח שווה לסכום של חיץ תמוגה הוסיף בשלב 6, של choloroform פנול חומצה לכל דגימה ומערבולת דקות 1.
  10. הפרד את השלבים מימיים ואורגניים על ידי צנטריפוגה הדגימות ב10,000 XG במשך 5 דקות. הספין הזה הוא יותר מזה שהוצע על ידי הערכה כדי להבטיח שכל המוגלובין / hemozoin הוא בשלב האורגני.
  11. אסוף את השכבה העליונה (המימית) ולהעביר אותו לצינור טרי. חזור על שלבים 9 ו -10, אם את השלב המימי הוא לבן או חום (סביר יותר) בצבע, אשר טוען פרוזיהום חלבון.
  12. לקבוע את עוצמת הקול של supernatant וכתוצאה מכך על ידי פיפטה ולאחר מכן להוסיף 1.25 כרכים של 100% אתנול (~ 800 μl) ומערבבים על ידי היפוך צינור microcentrifuge 1.7 מיליליטר 5 פעמים.
  13. להעביר בכל מדגם באמצעות מחסנית מסנן מחייב RNA סיפקה (כמה שונה מהם זמינים באופן מסחרי) או על ידי צנטריפוגה ב14,000 XG דקות 1 או באמצעות סעפת ואקום.
  14. לשטוף את מחסנית המסנן עם 700 μl של מירנה לשטוף חיץ 1 באמצעות microcentrifuge, מסתובב ב14,000 XG דקות 1.
  15. לשטוף את מחסנית המסנן עם חיץ לשטוף 500 μl 2/3 פעמיים על ידי צנטריפוגה ב14,000 XG דקות 1 כל אחד.
  16. Elute RNA עם 100 DEPC מים μl, שחומם מראש ל -95 מעלות צלזיוס, בשתי שטיפות של 50 μl, צנטריפוגה ב14,000 XG דקות 1 כל אחד. למדוד את הריכוז של RNA באמצעות ספיגת UV ב 260nm.
    הערה: ג'ל RNA (או acrylamide TBE-אוריאה או ג'ל agarose פורמלדהיד denaturing) יכול בהדואר משמש כדי להעריך את התפלגות הגודל של RNAs המבודד.
    הערה: RNA זה מתאים לניתוח על ידי microarray, RNA-רצף, כתם צפוני וassay הגנת ribonuclease.

2: Quantitation של RNAs הקטן בגודל מפ falciparum במהלך IDC

  1. קבע את הריכוז של דגימות בודדות מבודדות בשלב 1 באמצעות ספקטרופוטומטריה UV ב 260 ננומטר.
  2. צור פריימרים PCR בזמן אמת למיני RNA הרצויים. למירנה לבד, השתמשנו מבחני מירנה qPCR premade, ואילו עבור mRNAs או היתוך מירנה-mRNA עיצבנו פריימרים לSYBR ירוק. לRNAs ההיתוך, פריימר קדימה היה רצף מירנה עצמו (miR-451: AAACCGTTACCATTACTGAGTT), בעוד שההפך היה פריימר ~ 100 נ"ב גן ספציפי במורד זרם של מירנה ברצף ה- mRNA (PKA-R: ATCGAACATGCTGTGAACAT).
  3. הפוך cDNA מדגימות RNA או באמצעות סיכת ראש פריימר לmiRNAs (להשתמש 20-40 ng של RNA) לבד או hexamers האקראית לmRNA ו / או מירנהמיני היתוך -mRNA (באמצעות 1 מיקרוגרם של רנ"א). מערבבים RNA ופריימרים במשך 5 דקות על 65 מעלות צלזיוס, אז להתקרר לטמפרטורת חדר. לאחר מכן, להוסיף תערובת טרנסקריפטאז (0.5 μl הפוך transcriptase, 0.5 מעכב RNase μl, dNTPs 1 μl (2.5 מ"מ כל אחד), 4 μl 5x חיץ, 0.1M DTT 2 μl, 1 μl H 2 O).
    1. דגימות לרוץ על thermocycler מסוגל לאתר או בדיקות ירוקות או TaqMan SYBR. SYBR הירוק כמותי 30 PCR לגנים ספציפיים לרוץ כמו 3 שלבים PCR, 95 מעלות צלזיוס למשך 15 שניות, חישול בטמפרטורה הנמוכה ביותר פריימר מינוס 5 מעלות צלזיוס למשך 30 שניות, ו -68 מעלות צלזיוס למשך 30 שניות, 40 מחזורים, באמצעות SYBR המסחרי תערובת הורים ירוקה. מירנה PCR בזמן אמת היה לרוץ כמו PCR שני שלבים, 95 מעלות צלזיוס למשך 15 שניות ו 60 מעלות צלזיוס במשך 1 דקות, במשך 40 מחזורים.
    2. לכמת מבחני בשיטת ΔΔCt ולנרמל אותם נגד שני ראב GTPase (PF08_0110) או 18S rRNA 31.

3: מבואשל RNA הקטן לטפילי מלריה

  1. גלולה 300 μl של תאי דם אדומים לכל transfection (250 μl של תאי דם אדום, כ 1.5 x 10 9 תאים, סופו של דבר לשמש) בתקשורת מלריה מלאה על ידי צנטריפוגה ב 800 XG במשך 5 דקות בבלם 1.
  2. שטוף את אריתרוציטים פעמיים עם RPMI וגלול בcytomix המלא (120 מ"מ KCl; 0.15 מ"מ CaCl 2; 10 מ"מ K 2 HPO 4 / KH 2 PO 4, pH 7.6; 25 מ"מ HEPES, pH 7.6; 2 מ"מ EGTA, pH 7.6; 5 מ"מ MgCl 2; pH מותאם עם KOH) בהמטוקריט של 50% לאחר צנטריפוגה ב 800 XG במשך 5 דקות בבלם 1.
  3. להעביר את תאי קובט electroporation 0.2 סנטימטר.
  4. להוסיף 10 מיקרוגרם, או מתאים סכום, של oligonucleotides הסינתטי מותאם אישית לcuvettes וresuspend התרבויות.
  5. התאם את electroporator 310 V / 950 μF ולספק דופק לכל קובט.
  6. Resuspend 300 μl של תאי דם אדומים בתוך קובט בטרום חימם mal המלאותקשורת אריה צלחת אותם ב 24 צלחות גם ולדגור על 37 מעלות צלזיוס בכלי אטום עם תערובת גז דם מלריה (3% O 2, 5% CO 2).
  7. לאחר 4 שעות, להדביק RBCs transfected עם trophozoites מאוחר המסונכרן לparasitemia הסופי משוער של 1%.
  8. להוסיף RBCs הטרי transfected כל 4-6 ימים לתרבויות נגועות ולקבוע את parasitemia% על ידי FACS באמצעות מכתים YoYo-1, כפי שצוין בסעיף 4.

קביעת כדורית אדומה מיקרו RNA ההשפעה על שיעור זיהום טפיל: 4

  1. קח תרבות המושעית 100 μl ידי micropipettor ומקום בצינור 1.7 מיליליטר microcentrifuge. לשטוף פעמיים עם 1 מיליליטר של 1x PBS ו צנטריפוגות בmicrocentrifuge שולחן על ידי צנטריפוגה ב 800 XG במשך 5 דקות.
  2. Resuspend גלולה ב 1 מיליליטר של glutaraldehyde 0.025%. דגירה דגימות עבור 20 דקות ב RT.
    ניתן לאחסן דגימות כאן במשך כמה שבועות ב 4 ° C: הערה. לאחר מכן, גלולה R הנגועBCS ידי צנטריפוגה ב 800 XG במשך 5 דקות. לשטוף פעמיים עם 1 מיליליטר של 1x PBS.
  3. Resuspend גלולה ב 1 מיליליטר של saponin 0.015%. דגירה על 4 מעלות צלזיוס במשך 15 דקות. גלולה נגועה RBCs ידי צנטריפוגה ב 800 XG במשך 5 דקות. לשטוף פעמיים עם 1 מיליליטר של 1x PBS. Repeat.4.3. תאי Resuspend ב 1 מיליליטר של 1x PBS המכיל 1 μl כתם DNA (1,000X).
  4. לקבוע את מעלות של parasitemia על cytometer זרימה, ב 488 ננומטר עירור ו~ 530 ננומטר פליטה (FL-1).
  5. ראשית, שער cytometer הזרימה המבוסס על FSC וSSC להתמקד בתאי דם אדומים. אז למדוד את מעלות של parasitemia (RBCs הנגוע) בRBC המגודר על ידי הקרינה בערוץ FL-1.
    הערה: טפילי שלב מאוחר יותר הם 10X יותר מאשר ניאון טפילי שלב מוקדם יותר, ו~ 100X מעל RBCs נגוע. כמו כן, איסוף במהירות נמוכה נוטה להפחית את הרעש. לבסוף, גישה זו כבר לעומת 3 התאגדות H-hypoxanthine וצביעת Giemsa, שניהם כפי שדווחו בעבר 13, וכל גב הטכניקותדואר תוצאות דומות.

5: ביוטין התיוג וElution של mRNA-מירנה מוצרי היתוך

  1. ישירות להזמין oligonucleotides הסינתטי מותאם אישית RNA עם desthiobiotin (Db-) קוולנטית צמודה עד סוף '5.
  2. Transfect RBCs נגוע עם מצומדות-Desthiobiotin (Db-) מירנה ומירנה ללא שינוי (שליטה שלילית), כפי שצוין בשלב 3.
  3. להדביק RBCs transfected עם פ falciparum הטפיל לparasitemia מתחיל של 0.5% (שלב 1.1).
  4. לחלץ RNA טפיל 4 ימים (96 שעות) מאוחר יותר, כמתואר לעיל בשלב 1.
  5. דגירה 10 מיקרוגרם של רנ"א טפיל עם 50 μl ארוז חרוזים streptavidin, הוסיף באמצעות micropipette, ולסובב על הכתף צינור microcentrifuge במשך שעה 1 ב 4 מעלות צלזיוס.
  6. גלולה חרוזים ב 800 XG במשך 30 שניות ולשטוף עם 20 מ"מ KCl ו 1/1000 RNase מונעי.
  7. Elute RNAs מהחרוזים על ידי תחרות עם ביוטין 2 מ"מ ועם 200 מאגר elution לכידת RNA μl (20 מ"מ KCl, 1/1, ביוטין 000 RNase מונעי ו -2 מ"מ) בשעת 4 מעלות צלזיוס לילה עם רוטציה.
  8. לקבוע את מידת ההעשרה של פ הצביע תמלילי falciparum באמצעות SYBR qRT-PCR ירוק, והעשרת microRNA (ביקורת חיובית) על ידי TaqMan qPCR כפי שצוין בשלב 2.

6: הפרדת Polysome לקביעת תפוסה ריבוזומלי של פ falciparum

  1. מקום 5 מיליליטר של 15% תמיסת סוכרוז (400 מ"מ אצטט אשלגן, HEPES אשלגן 25 מ"מ, pH 7.2, אצטט מגנזיום 15 מ"מ, 200 מיקרומטר cycloheximide, 1 מ"מ DTT, 1 מ"מ PMSF, 40 U / ml RNase מונעי, וסוכרוז 15% ) לתוך צינור SW41 ultracentrifuge (14 x 89 מ"מ).
  2. באמצעות מזרק 5 מיליליטר, להוסיף 5 מיליליטר של 50% תמיסת סוכרוז (400 מ"מ אצטט אשלגן, HEPES אשלגן 25 מ"מ, pH 7.2, אצטט מגנזיום 15 מ"מ, 200 מיקרומטר cycloheximide, 1 מ"מ DTT, 1 מ"מ PMSF, 40 U / RNase מיליליטר מעכב, ו -50% סוכרוז) מתחת לסוכרוז 15% באמצעות מחט פלדה ארוכה, ולאחר מכן להסיר את המחט.
  3. לאחר 2 שעות, להטות לאט הצינור בחזרה זקופה ולהעביר את הצינור לקרח, המאפשר לה להתקרר במשך לפחות 15 דקות לפני לטעום טעינה (שלב 14).
  4. לאסוף מספיק תרבות שלב דם -infected Plasmodium לייצר 100-500 מיקרוגרם של רנ"א הכל, או בערך תרבות אסינכרוני 100 מיליליטר בparasitemia 3-5%. להוסיף 1/10 ה נפח של מדיום התרבות המכיל 10x (2 מ"מ) cycloheximide (chx) ולדגור על 37 מעלות צלזיוס למשך 10 דקות.
    1. תרבויות גלולה על ידי צנטריפוגה XG ב 500 דקות 7 עם צנטריפוגות (בלם 1), ולאחר מכן לשטוף פעמיים עם טמפרטורת חדר 1x PBS המכיל 200 chx מיקרומטר. Resuspend תרבויות הטפיל ב1x PBS המכילות 200 chx מיקרומטר ולאחסן על קרח.
    להעריך את הנפח של גלולה RBC. הוסף חוצץ תמוגה (400 אצטט אשלגן מ"מ, 25 מ"מ HEPES אשלגן, pH 7.2, אצטט מגנזיום 15 מ"מ, 200 chx מיקרומטר, 1 מ"מ DTT, 1 מ"מ PMSF, 40 U / RNase מונעי מיליליטר, 1% (V / V) IGEPAL CA -630, ו -0.5% (w / v) DOC) לגלולת RBC לנפח סופי של 4.25 מיליליטר. דגירה lysate ב 4 ° C במשך 10 דקות תוך סיבוב.
  5. העבר את lysate לצינורות microcentrifuge, ואז צנטריפוגות הדגימות בmicrocentrifuge ב16,000 XG ו -4 ° C במשך 10 דקות.
  6. הכן כריות סוכרוז על ידי pipetting 1.25 מיליליטר של תמיסת סוכרוז כרית הקרה 0.5 M (400 מ"מ אצטט אשלגן, HEPES אשלגן 25 מ"מ, pH 7.2, אצטט מגנזיום 15 מ"מ, 200 מיקרומטר cycloheximide, 1 מ"מ DTT, 1 מ"מ PMSF, 40 U / RNase מיליליטר מעכב, ו 0.5 M סוכרוז) לתוך צינור SW55 ultracentrifuge (13 x 51 מ"מ).
  7. שכבה בזהירות 3.75 מיליליטר של supernatant lysate (מצעד 7) על גבי כרית סוכרוז באמצעות מזרק וקטן (~ 27) מחט מד. Storדואר lysate הנותר (~ 500 μl) ב -80 ° C כדי לחלץ רמות RNA מוחלטת, כפי שצוין בסעיף 1.
  8. טען את הדגימות לתוך הרוטור ultracentrifuge, טרום צונן עד 4 מעלות צלזיוס, אשר יכול להכיל 13.2 מיליליטר צינורות. צנטריפוגה דגימות ב366,000 XG ו -4 מעלות צלזיוס במשך 146 דקות.
  9. בעזרת פיפטה, להעביר את supernatant לתוך צינור חרוטי 15 מ"ל. אחסן את supernatant ב -80 ° C לבידוד RNA של חופשי RNAs (מאוגד על ידי הריבוזומים).
  10. Resuspend גלולה הריבוזום ב500 μl של חיץ resuspension הריבוזום (400 מ"מ אצטט אשלגן, HEPES אשלגן 25 מ"מ, pH 7.2, אצטט מגנזיום 15 מ"מ, 200 מיקרומטר cycloheximide, 1 מ"מ DTT, 1 מ"מ PMSF, ו -40 U / RNase מונעי מיליליטר) על ידי pipetting במשך 5 דקות.
  11. צנטריפוגה הדגימות בmicrocentrifuge ב16,000 XG ו -4   ° C במשך 10 דקות.
  12. תוך שמירה על שיפוע צעד המס '4 על קרח, להסיר את Parafilm, אז שכבה בזהירות ההשעיה הריבוזום על גבי USI השיפועng מזרק וקטן (~ 27) מחט מד.
  13. טען את הצינור לתוך הרוטור ultracentrifuge טרום צונן צנטריפוגות הדרגתיים העמוס ב 200,000 XG ו -4 מעלות צלזיוס במשך 180 דקות. כאשר הספין הושלם, חנות centrifuged הדרגתיים על 4 מעלות צלזיוס עד מוכן לטעון על fractionator.
  14. לטעון צינור ultracentrifuge ריק לfractionator השיפוע (זה יכול להיות צינור המשמש בריצה קודמת), ולאחר מכן לשטוף עם מים RNase חינם למשך 5 דקות ב 100 x 10 מהירות.
  15. במהלך השטיפה בשלב 6.16, לקבוע את רמת הרגישות של הגלאי ספיגה UV. רגישות התחלה טובה היא 0.2, אבל זה עשוי להיות מותאם בהמשך נגמר בהתאם לאות 254 (שמשתנית בהתאם למספר טפיל, וכו ').
  16. ברגע שרגישות הגלאי מוגדרת, להגדיר את אות הבסיס לאפס ואילו מים זורמים דרך הגלאים.
  17. לאחר שטיפת אספן החלק, להפוך את זרימת הנוזל עד הקווים ריקים ולאחר מכן remאובה צינור ultracentrifuge הריק.
  18. הפעל 60% תמיסת סוכרוז דרך fractionator עד יציאתו ממנגנון המחט.
  19. הכנס את הצינור המכיל את השיפוע הראשון בחלק העליון של תא הטעינה ולהדק את החותם, נזהר שלא להדק יותר. לאחר מכן, לנקב את החלק התחתון של הצינור עם המחט.
  20. איפוס מהירות זרימת נוזל ל12.5 x 10 (הנשלטים על ידי כפתור בקרת מהירות זרימה בחלק הקדמי של המשאבה), לאחר מכן קבע את אספן החלק האוטומטי לאיסוף שברים 18 שניות (~ 330 μl / חלק) בצינורות microcentrifuge.
  21. התחל קדימה זרימה של תמיסת סוכרוז 60%.
  22. כאשר הירידה הראשונה של פתרון השיפוע יורדת לתוך צינור microcentrifuge, להתחיל מייד שניהם אוסף חלק והקלטת חיה של אות 254.
  23. ברגע שירידה חדה נצפתה באות 254, מתאימה לממשק בין פתרונות סוכרוז 50% ו -60%, לעצור שתי זרימת הנוזל ו254
  24. אחסן את השברים השיפוע ב -80   ° C לשימוש מאוחר יותר.
  25. הפוך את זרימת הנוזל ב100 x 10 מהירות עד פתרון סוכרוז 60% מתרוקן של צינור ultracentrifuge.
  26. אם יש מילויים נוספים לfractionate, להסיר את צינור ultracentrifuge הריק מתא הטעינה ולהפעיל מחדש מצעד 6.21. אם כל הדגימות הושלמו, לשטוף את המנגנון כפי שבוצע בשלבים 6.16 ו6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

פרופיל עולמי של microRNA האנושי בפ falciparum

הטכניקות שהוצגו כאן שמשו כדי לחלץ מיקרו-רנ"א מטפילים במגוון רחב של מצבים. דבר אחד שיש לציין הוא כי עקירות RNA לRBCs נגוע בוצעו כפי שצוינה ב -32, אשר לעתים קרובות שימשו כנקודת התייחסות לנתונים שהוצגו בשני microRNA מאמר זה והמחקר המקורי 29. אלה מחקרים הקודמים הראו גם כי אריתרוציטים HBSS דיבוק רמות הרבה יותר של miRNAs מסוים, miR-451 בפרט. הטכניקות שצוינו לעיל היו מספיק כדי להדגים את השינויים בשפע מירנה בHBS (HBA של או HBSS) טפילי הדבקה. דגימות RNA חולצו כפי שצוינה לעיל ומנורמל נגד rRNA 18S. דגימות מטפיל HBSS RBCs, למשל, מראות עלייה משמעותית ברמות של כמה מיקרו-רנ"א, כולל miR-451 (איור 1). הספיגה של מירנה מerythr המארחocyte הוא גם עולה בקנה אחד עם מחקרים קודמים 34,35.

Transfection של אריתרוציטים HbAA עם miR-451 עלה HbAA miR-451 לרמות דומות לאריתרוציטים HBSS (איור 1). Cytometry זרימה אז שימש למדידת זיהום טפיל, על מנת להעריך את ההשפעה של טרנסלוקציה מירנה על צמיחת טפיל. בהתבסס על כך, אריתרוציטים HbAA transfected עם miR-451, miR-223 וmiR-181a, יחד עם אוליגו ssDNA, נבחנו את ההשפעות של מיקרו RNA על צמיחת טפיל. Transfection של ssDNA או miR-181a לא היה השפעה על parasitemia (איור 2 א - ד) בזמן transfection עם parasitemia miR-451 המופחת במידה ניכרת, שאפשר למתן רק על ידי שיתוף transfecting אוליגו miR-451 antisense.

חסימה של מיקרו RNA על ידי transfection של מיקרו RNA antisense 2'-O-הפגינה השפעה הדדית. אריתרוציטים HBSS, עם-451 miR רמות גבוהות יותר באופן טבעי, היו transfected עם antisense miR-451 או oligonucleotides 2'-O-מתיל (איור 3). עיכוב של miR-451 עלה צמיחת טפיל בשני אריתרוציטים HBSS (איור 3 ג - F). אחוזי טפיל חושבו מלפחות 3 transfections העצמאי, אז בממוצע ומוצג כפי שינוי ביחס לצמיחת HBSS (איור 3F).

לכידתו של RNAs היתוך מירנה-mRNA על ידי assay ללכוד ביוטין

לאחר transfection של 5'-desthiobiotin-miR-451 (5'Db-miR-451) ו5'Db-miR-181, כפי שצוין בסעיף 5 שיטות, נקבע כי רצף מירנה נצפה מקור עם מיקרו-רנ"א האנושי. ניתוח qRT-PCR ציין כי transfection של 5'Db-miR-451 גרם בהעשרה של תמלילי היתוך PKA-R (איור 4).

הפרדת Polysome כדי לקבוע את תפוסת ריבוזומלי של פ falciparum

אוהל "> 254 עקבות טיפוסיות מוצגת באיור 5 א '(עם אישור צפוני של תוכן rRNA באיור 5), עם הצפיפות גוברת החלק משמאל לימין בגרף (כלומר שברים קלים לשמאל). הראשוני 254 הוא גבוה למדי עקב הספיגה של המוגלובין שבברים מוקדם, אבל במהירות יורד ל הבסיס. השיא הקטן הראשון מתאים למקטע הקטן ריבוזומלי (40S), ומייד אחריה השיא השני, שהוא קצת יותר גדול ומתאים לגדול מקטע ריבוזומלי (60S). השיא השלישי, שהוא בדרך כלל גדול לפ falciparum, תואם את שיא monosome (80S). בשל גובהו, יש להשתמש 80S כמדריך כדי להתאים את הרגישות של גלאי UV לריצות הבאות (שלב 6.17). כמו כן, בשל גודלו של שיא 80S, זה משותף ל60S לאותת לטשטש כמו "כתף" לתחילת שיא monosome, אם שני 60S 80S ואותות הם גדולים.

בעקבות שיא monosome הם הפסגות המתאימות polysomes. שיא כל רצוף מייצג חלק polysome מייצג מספרים בהדרגה גדולים יותר של הריבוזומים (2, 3, 4, וכו '). שיא כל polysome הוא קטן יותר גם מהשיא הקודם, ירידה בגובה של 2-3 לקפל עם כל מספר polysome רצוף. ריצות טיפוסיות תאפשר הרזולוציה של polysomes המורכב של 5-7 הריבוזומים, אם כי רזולוציה של עד polysome 9-Mer נצפה בכמה ריצות עם כמות גדולה של חומר מוצא. polysomes סדר גבוה יותר להלחין את שארית העקבות, ולא ניתן לפתור בתנאי שיפוע אלה.

איור 1
איור 1: מיר-451 הם גבוהים באריתרוציטים HBSS רמות Intraparasitic miR-451, כפי שנקבעו על ידי בזמן אמת PCR ומנורמל נגד 18S rRNA, מטפילים המבודדים ממצוין.סוגים כדורית אדומה. ערכים הם ממוצעים ± SE.

איור 2
איור 2: יתר של miR-451 באריתרוציטים נורמלים מעכב צמיחת טפיל (- C) מגרשי FACS נציג המצביעים על שיעורי זיהום, כאחוז מסך RBC, מסומן על ידי M1, לסוגים הראו כדורית אדומה.. שיעורים (ד) Composite זיהום נובעים מFACS ומנורמל נגד untransfected HbAA RBCs. ערכים בAC פנל חלקות FACS נציג בעוד D הוא ממוצע ± SE.

איור 3
איור 3:. עיכוב של miR-451 באריתרוציטים חרמשית מרומם צמיחת טפיל (- E) מגרשי FACS נציג המצביעים על שיעורי זיהום, כאחוז מסך RBC, מסומנים על ידי M1, לאה מוצגסוגי ythrocyte. שיעורים (F) Composite זיהום נובעים מFACS ולהתוות כערך מנורמל נגד untransfected HbAA RBCs. ערכים בלוח AE הם חלקות FACS נציג, F הוא ממוצע ± SE.

איור 4
איור 4: Transfection של miR-451 מעשיר לתמלילי היתוך PKA-R ומראה כי מירנה התמזגה היא האריתרוציטים במקור ההעשרה של תמלילים מצויינים desthiobiotin מצומדות- מירנה-mRNA ההיתוך שכבר נתפסו על ידי streptavidin.. הערכים נמדדו באמצעות PCR בזמן אמת ולהתוות כערך יחסי לעומת טפילים-transfected שאינם. ערכים הם ממוצעים ± SE.

איור 5
איור 5:. יכולים להיות מבודדים ריבוזומים טפיל באמצעות שיפוע סוכרוז (- B) Example עקבות של פרופיל polysome מופק falciparum Plasmodium. () עקבות של פרופיל polysome מופק Plasmodium falciparum, עם 40S, 60S, 80S ופסגות Polysome (עם #s המציין את מספר הריבוזומים הקשורים) מוצג. כתם צפוני של 18S rRNA 28S ומעבר לשברי ריבוזומלי (B). ערכים הם ממוצעים ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HBS הוא אחד גרסאות המוגלובין הנפוצות ביותר באזורים אנדמיים למלריה, במידה רבה משום שהוא מספק הגנה מפני מלריה חמורה שנגרמה על ידי פ ' falciparum. הטכניקות דרושות כדי לאפיין את התפקיד של microRNA האנושי בויסות הגנים של פ falciparum מפורטים בכל כתב היד הזה. על ידי מיצוי RNA הכולל באופן שיכלול את כל RNA הקטן כזה, ועל ידי ביצוע הליך תמוגה הטפיל פשוט יחסית, RNAs ההיתוך אלה היו יכולים להיות מזוהים באמצעות מגוון רחב של טכניקות עצמאיות.

צעדים אלה הם יחסית פשוטים אבל רגישים לבעיות של זיהום ואם לא בעקבות כראוי. במהלך החילוץ הטפיל, זה קריטי לבצע תמוגה saponin להסיר זיהום אריתרוציטים מארח. זה נכון במיוחד בשלב תמוגה saponin של בידוד RNA. רכיב מירנה של תאי דם אדום הוא מארח כמה סדרי הגודל greater מזה של הטפיל, בין שאר בשל רוב תאי דם האדומים נגוע להיות, אז זה הוא חיוני כדי להסיר כמה שיותר זיהום האריתרוציטים ככל האפשר. כמו כן, חשוב לשמור על תרבות המלריה בשלב בריא ונכון (אם נדרש נקודה מסוימת במחזור הזיהום) כדי להשיג פרופיל מירנה מדויק. כמו כן, במהלך חילוץ פנול, כלורופורם, זה חשוב וחיוני לוודא השלבים מימיים ברורים, ואם לא, חזרו על מיצוי פנול, כלורופורם, כדי למנוע כל זיהום שנותר.

כמו כן, בניסוי לכידת desthiobiotin, זה קריטי לelute עם עודף של ביוטין ולהשתמש המינימאלי של חרוזים streptavidin, כדי להבטיח elution הספציפי המתאים. Elution של RNAs המאוגד באמצעות תחרות עם ביוטין, ולא denaturation המלא של חרוזים עצמם, שימש כדי לצמצם את העשרת RNA הרקע באופן דרמטי. לבסוף, ניסוי לכידת desthiobiotin הודגשזה דרך חשובה אחת כדי להדגים כיצד miRNAs אלה נתפסו, אבל כמה טכניקות אחרות שמשו גם במחקרים הקודמים להפגין RNAs ההיתוך אלה, כגון כתמים הצפוניים ומבחני הגנת ribonuclease 29. שיטות כגון שימוש במייקרו-רנ"א transfected כדי לאחזר את התמלילים שונה עשויים להיות יישום רחב יותר, כגון הטיהור של קומפלקסי חלבונים הקשורים שעשויה לתווך התחבורה ועיבוד של miRNAs transfected.

בעוד גישות הגנום שונות שימשו ללמוד proteome המלריה וtranscriptome 22-25, יש כמה שיטות בעולם לבחון רגולציה translational בפ falciparum 21,26. מגבלה מתודולוגית זו מונעת הניתוח הגלובלי של הרגולציה translational בפ falciparum. אחת הגישות הניסיוניות הנפוצות ביותר ללמוד רגולציה translational הוא polysome פרופיל, אשר מעריך תרגום כלליפעילות אל מבוסס על הריבוזומים הועמסו על mRNAs הספציפי של עניין. מפורט בכתב היד הזה הוא שיטת אפיון polysome מותאמת לשימוש בטפילי מלריה שlyses שני כדורית אדומה הנגועים וטפילה בתוך. שיטות קודמות לא התאוששו רוב polysomes ועשו את זה נראה כאילו טפילי מלריה לא היו אוכלוסיות משמעותיות של polysomes. השימוש במאגר תמוגה עם ריכוז גבוה של אצטט אשלגן ומגנזיום איפשר lyse שני תאי דם אדומים וטפילים תוך solubilizing ריבוזומים קרום הנכנס כדי לאפשר הלכידה של polysomes שלם.

שיטה זו חסכונית של טיהור ופרופיל ריבוזומלי תעזור לגשר על הפער בידע הקיים בין transcriptome המלריה וproteome ולאפשר ניתוח הגנום של מדינת translational של פ falciparum. גישה זו נעשתה שימוש כדי להשוות את מצב התרגום של ב השלב מוקדם ומאוחרשלב את מזון טפילי 28, אשר בחוזקה תאמו ביטוי גנים. ניתן להשיג בקלות נתונים על טעינת ריבוזומלי של תמלילים וניתחו כדי לקבוע את הצפיפות של ריבוזומים על mRNAs הספציפי. יתר על כן, בשילוב עם סנכרון סורביטול, שינויים בצפיפות ריבוזומלי יכולים לשמש כדי לקבוע כיצד תרגום מוסדר לאורך כל מחזור החיים של הטפיל. בידוד של הריבוזומים שימוש בגישה זו דורש כמות גדולה של תרבות, שלמרבה הצער מגבילה את השלבים של מחזור החיים מלריה שבניתן לבצע אותו. הכמות הגדולה של חומר הזנה גם תגביל את השימוש בו הן במבחנה במעבדה זנים של Plasmodium falciparum, ועלולה להגביל את תחולתה לזיהומים אחרים. כל מי שמשתמש בהליך זה גם יהיה מסוגל להקרין לגנים המציגים פרופילי תרגום יוצא דופן, בתמלילים מסוימים שאינם קשורים לריבוזומים, המשקפים מצבים חלופיים של ויסות הגנים. לבסוף,גישה זו תאפשר לנו להעריך כיצד סוכנים נגד מלריה רומן להשפיע תרגום חלבון ולזהות מנגנונים מבוססי תרגום של עמידות לתרופות. יש צינור זה כלי נהדר בזיהוי וקביעת הרגולציה לאחר התעתיק בהרבה מערכות ניסיוניות.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics