방법은 작은 RNA를과의 리보솜 점유 규제 역할을 조사하기 위해 * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

겸상 적혈구 대립 유전자에 대한 책임 유전 적 변이 (HBS)은 말라리아 기생충, 경찰에 의한 감염에 저항하는 적혈구 수 열대열. 다 요인으로 알려져있다이 저항의 분자 기초는 완전히 이해되지 못하고있다 유지. 최근의 연구는 한 번 말라리아 기생충에 전좌 적혈구 마이크로 RNA의 발현 차이는 유전자 조절 및 기생충 성장 모두에 영향을 미치는 것으로 나타났다. 이러한 miRNA가 나중에 기생충의 mRNA의 은밀한 부분 집합 5 'RNA 융합을 통해 키메라 RNA 전 사체를 형성하여 mRNA의 번역을 억제하는 것으로 나타났다. 여기에서 사용 된 기술은 유전자 조절 및 P.의 병진 ​​전위에 기능적 역할 및 추정 메커니즘 기본 적혈구 마이크로 RNA 공부 원충, 호스트 적혈구에 수정 합성 마이크로 RNA의 형질을 포함하여 상세하게 설명한다. 마지막 polysom​​e 그라데이션 방법 TRA의 범위를 결정하는 데 사용되는이러한 성적 증명서의 nslation. 함께, 이러한 기술은 우리가 적혈구 마이크로 RNA의 조절 이상 수준이 겸상 적혈구 세포 고유 말라리아 저항에 기여 함을 입증 할 수 있었다.

Introduction

변형체의 apicomplexan 기생충에 의한 말라리아는 전 세계적으로 매년 약 200 만 명이 감염과 주변 60 만 명이 사망 한 원인이 가장 일반적인 인간의 기생 질환이다. 인간을 감염 다섯 변형체 종의 인간의 질병에 가장 관련성이 피입니다 열대열P. 심한 말라리아 합병증에 대한 그들의 널리 분포하고 잠재적으로 인해 삼일 열,. 말라리아 기생충의 라이프 사이클은 모기와 인간 모두의 감염을 필요로한다. 감염된 모기에 물린 인간 때 기생충 복제의 초기 라운드가 발생 간 혈류를 통해 이동한다. 호스트로부터 간세포 merozoites 파열 후에, 그들은 무성 성적 어느 복제를 개시 근처 적혈구 세포를 감염. P. 48 시간 지속 복제의 무성 단계, 그것은 대부분의 말의 소스를 모두이기 때문에 원충이 연구의 초점이다아리아 증상과 쉽게 체외에서 효과적으로 요약된다.

개선 말라리아 치료 포함한 공중 보건 사업의 수가 다소 세계적 말라리아의 부담을 감소되었지만, 약제 내성 기생충 계속 출현 말라리아 제어 노력에 문제가있다. 새로운 치료 방법을 제안 할 수 있습니다 하나의 영역은 유전 적 변이가 말라리아에 대한 저항성을 부여하는 방법을 여러 가지의 연구이다. 말라리아 발병 지역에서는 적혈구 다형성의 다양한 2,3 아주 일반적이다. 겸상 적혈구 아마도 가장 눈에 띄는되는 이러한 돌연변이는 종종 증상이 말라리아 감염 4의 발병에 상당한 저항과 연결되어 있습니다. 그들은 말라리아 감염에 저항하는 적혈구의 원인이되는 기본 메커니즘은 불완전하게 이해된다. 헤모글로빈 돌연변이와 기생 적혈구 향상 세포 강성과 탈수를 통해 향상된 식균 작용의 대상이되는P.에 의해 감소 침략과 연관되어 5 원충. HBC 대립 유전자는 적혈구 표면과 세포 골격의 리모델링, 추가 기생충 개발 6,7 억제와 단백질 발현에 영향을 미친다. 마지막으로, P. 원충은 동형 접합 낫 내에서 제대로 성장 (HBSS)는 말라리아 저항의 고유 적혈구 요인을 제안, 체외에서 8,9 적혈구. 이러한 메커니즘은 모두 역할을하는 것으로 나타나는 반면 그러나, 이들은 완전히 말라리아 겸상 적혈구 성 뒤에 메커니즘을 설명하지 않는다.

제대로 이해 남아 적혈구 요인 중 하나 잠재적 인 세트는 성숙한 적혈구 내에서 miRNA의 존재의 큰 풀입니다. 마이크로 RNA는 3 'UTR 내 염기쌍에 의해 번역 및 / 또는 대상의 mRNA의 안정성을 중재 19-25 NT 크기가 작은 비 코딩 RNA를,이다. 이들은 억제 O 포함한 포유 동물 면역 반응의 조절에 연루되어왔다F 바이러스 복제 10 및 식물에서 바이러스에 대한 내성을 부여하는 것으로 나타났다는 그들은 또한 적혈구 11,12 철 대사 (13)를 포함한 여러 적혈구 프로세스를 조절하는 것으로 나타났다. 이전의 연구는 식 극적으로 HBSS에 변경된 14, 15를 적혈구 적혈구의 miRNAs의 풍부하고 다양한 인구를 확인했다. 성숙한 적혈구가 활성화 전사 및 번역이 부족하기 때문에,이 적혈구의 miRNA의 기능 역할은 확실하지 않다. 중요한 물질 교환이 숙주 세포 및 P.간에 발생로서 intraerythrocytic 발달주기 (IDC) 16시 원충, 그것은 HBS의 적혈구 내에서 변경 miRNA의 프로파일이 직접 세포 고유 말라리아 저항에 기여할 수 있음을 추측했다.

이러한 연구는 궁극적으로, 기능적으로 분리 식별 m 이내에 인간의 miRNA의 역할을 연구하기 위해 파이프 라인의 개발을 주도alaria 기생충, P. 그 호스트 / 인간의 miRNAs는 궁극적으로 공유 퓨즈 다음 병진 기생충 mRNA의 성적 증명서 (17)를 억제 것으로 나타났다 원충. 이는 트랜스 - 스 플라이 싱에 의해 형성된 제 1 단면 종 키메라 사체의 예를 제공하고 본의 miRNA-mRNA의 융합 다른 기생충을 포함하는 다른 종에서 발생 될 수 있음을 연루. 모든 trypanosome의 mRNA는 트랜스 - 스 플라이 싱 스플 라이스 리더 (SL)과 폴리 시스 트론 성적 증명서 (18)의 분리를 조절한다. P. 이후 원충이 다이 서 (Dicer) / 전 (19, 20)에 대한 orthologs 부족, 그것은 적혈구의 miRNAs는 P. 유사한 SL 기계를 공중 납치 가능성이있다 원충은 표적 유전자에 통합합니다. (P)의 최근 연구 원충은 사실 5 '스플 라이스 리더 시퀀스 (21)의 존재를 표시합니다. 이 연구는 transcriptomic 및 transla 모두를 포함하여, 인간 기생충의 miRNA-mRNA의 융합 성적 증명서의 발견에지도 방법의 자세한 사항조절적인 기법. 이러한 방법의 전체 목표는 P.의 유전자 조절, 표현형 및 번역 가능한 소형의 RNA의 효과를 조사한다 원충의 성적 증명서.

인간 기생충 키메라 사체의 초기 식별은 오히려 단지 작은 RNA를 격리 기술을 이용하여보다 총과 작은 양의 RNA를 포함 실시간 PCR, 전 사체의 서열 및 EST 라이브러리 캡처 같은 RNA 분석 기법의 사용에 의존. 하나의 큰 풀에 함께 모든 RNA를 분리, 별도로보다 오히려, 기생충 모두 전좌 작은 RNA를 인간의 식별뿐만 아니라 더 큰 서열의 일부로서 이러한 작은 RNA 서열의 존재를 허용했다. 이것은 이들 융합체의 작용 결과를 결정하기 위해 이러한 융합 된 mRNA의 번역 상태의 분석을 요구했다.

기생충의 게놈의 특성에 대한 광범위한 노력하는 동안D의 사체는 기생충의 생물학 22-25의 이해에 추가 한, 훨씬 덜은 경찰의 수명주기에 걸쳐 mRNA의 사체의 번역 규제에 대해 알려진 원충 (26). 기생충의 프로테옴이 제한된 이해는 기생충의 생물학의 이해와 항 말라리아 치료제의 다음 세대를위한 새로운 목표를 식별 할 수있는 능력을 모두 방해했다. 기생충의 세포 생물학의 이해에이 격차는 경찰에서 번역 규제를 조사하기 위해 적절한 기술의 부족으로 주로 인해 지속하고있다 열대열. 최근의 논문은 P.의 리보솜 배출량 측정의 사용을 설명 원충은 글로벌 번역 상태 (21)를 결정합니다. 성적 증명서의 번역 가능성 중 하나가 튼튼한 측정 polysom​​e 프로파일에 의해 결정 관련 리보솜의 수입니다. 그러나,이 기술은 적용된다 P. 원충 </ EM>, 대부분의 polysom​​es를 복구 할 수 없으며 주로 monosomes을 캡처합니다. 최근 여러 그룹 27, 28은 최적화 된 polysomes을 보존하고 호스트 적혈구 (28)에서의 무성 개발 과정이 말라리아 기생충의 리보솜 점유 및 번역 가능성의 특성을 동시에 적혈구 및 기생충을 용균하여 원충 polysome 기술.

종합적으로,이 방법은 인간의 miRNA와 기생충의 mRNA의 관찰 융합은 이전에보고 된 방법 (27)를 사용하여 증명되었다 그 융합의 mRNA의 기생충 단백질 번역을 조절하고, HBA가 말라리아 저항의 주요 결정 요인이며, HBSS 17 적혈구 것을 보여줍니다. 이러한 방법은 그 융합의 RNA가 (P) 내에 있는지, RNA 접합 이벤트를 식별하고 기능적으로 탐구하고자하는 모든 시스템에 유용 할 것이다 원충 또는 다른 진핵 시스템.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1 : P.에서 작은 크기의 RNA의 분리 IDC 중 열대열

  1. 무성 문화 29 말라리아 기생충을 얻습니다.
    참고 : 필요한 문화의 크기가 원하는 응용 프로그램에 따라 다릅니다; 그러나 3 ~ 5 %의 기생충 5 % 적혈구 용적률에 10 ml의 문화는 실시간 PCR (RT-PCR)에 대한 충분한 RNA를 제공합니다. 기법은 초기에 최적화 배양 비동기되었지만 감염 사이클 동안 특정 시점이 요구되는 경우에는, 링 단계 기생충은 늦어도 10-12 시간 후 - 소르비톨 내습보다 동기화에 의해 동기화 될 수 없다. 동기화는 한주기 (약 48 시간) 29 일 후 반복해야합니다.
  2. 풀 감염된 세포는 함께 (~ 5 × 10 9 적혈구 ~ 5 % 기생충에) 및 적혈구를 펠렛 브레이크없이 5 분 동안 800 XG에 튜브와 원심 분리기의 상단에 차가운 PBS를 입력합니다.
  3. 원심 분리 후, 첨부,주의 깊게 흡입 피펫을 사용하여 상층 액을 제거진공로, 적혈구 펠렛 이후시키다하기 쉽습니다. 차가운 1X PBS로 한 번 더 펠렛을 씻으십시오.
  4. 30 분 동안 얼음에 재현 탁 세포 (1X PBS)에 차가운 0.15 % 사포닌의 펠릿과 장소.
  5. 4 ° C에서 12 분 동안 1,500 XG에 원심 분리기 세포, 차가운 PBS에 뜨는 (색상 어두운 빨간색이 될 것이다)과에 resuspend 펠렛을 제거합니다. 다시 한 번이 단계를 반복합니다.
    참고 : 본 마이크로 RNA 기생충 내의 마이크로 RNA의 반사, 그리고 적혈구 오염되었는지 확인하기 위해, 기생충 분리 조건의 수는 시험 하였다 : 1) 사포닌 분해, 2) 사포닌 분해 RNaseA의 숙주 세포의 miRNAs의 치료 및 3과 결합 ) 메틸 - 베타 - 사이클로 덱스트린 처리는 호스트 적혈구에서 기생충을 제거한다. 모든 치료는 비슷한 결과를 주었다.
  6. 를 Lyse 용해 완충액의 권장 600 μL를 사용하여 절연 기생충 펠릿. 용해 완충액의 부피는 1 ~ 2 %의 적혈구 용적 및 5 % 기생충에서 30 ㎖까지 배양 충분하다.
    참고 : 큰 기생충 배양의 경우,이 양이 증가 될 수있다. 적어도 1 분 동안 볼 텍싱하여 철저한 기생충 펠릿의 완전한 용해를 보장하는 것이 중요하다. 또한, 추출을 용이하게하기 위해, 용해 된 샘플은 1.7 ml의 마이크로 원심 튜브에 전달 될 수있다.
  7. 균질 첨가제 (2 M 아세트산 나트륨, pH를 4)의 60 μL, 또는 6 단계에서 사용되는 용해 완충액의 1/10 볼륨.
  8. 10 분 동안 얼음에 샘플을 남겨주세요.
  9. 600 μL, 또는 1 분 동안 각각의 샘플과 와류에 산 페놀 choloroform의 6 단계에서 첨가하여 용해 완충액의 양과 동일한 양을 추가한다.
  10. 5 분 동안 10,000 XG에서 샘플을 원심 분리하여 수용액 및 유기 상을 분리합니다. 이 스핀 모든 헤모글로빈 / hemozoin가 유기상에 있도록 이상 키트 제안한 것보다 길다.
  11. 상단 (수성) 층을 수집하고 새로운 튜브로 전송할 수 있습니다. 성상 프로 제시 색 (가능성이) 갈색, 흰색 또는 경우 반복 9, 10 단계TEIN 오염.
  12. 피펫으로 상층 액의 양을 결정하고 100 % 에탄올 (~ 800 μL)의 1.25 볼륨을 추가하고 1.7 ml의 마이크로 원심 튜브 5 번 반전 섞는다.
  13. 1 분 또는 진공 매니 폴드를 사용하여 14,000 XG에서 하나 원심 분리에 의해 제공 RNA 결합 필터 카트리지를 통해 각각의 샘플을 (상업적으로 사용할 수있는 여러 가지있는) 전달합니다.
  14. miRNA의 700 μL 버퍼 (1)가 1 분 동안 14,000 XG에서 회전, 마이크로 원심을 사용하여 세척과 필터 카트리지를 씻으십시오.
  15. 두 번 1 분마다 14,000 XG에 원심 분리하여 500 μL 세척 버퍼 2/3로 필터 카트리지를 씻으십시오.
  16. 1 분마다 14,000 XG에 원심 분리, 50 μL의 두 세척에서 95 ºC로 예열 된 100 μL DEPC 물과 용출 RNA. 260 나노 미터에서의 UV 흡광도를 통한 RNA의 농도를 측정한다.
    주 : RNA 겔 (TBE 우레아 또는 아크릴 변성 포름 알데히드 아가 로스 겔 어느) 수 bE는 고립의 RNA의 크기 분포를 평가하기 위해 사용된다.
    참고 :이 RNA는 마이크로 어레이, RNA 시퀀싱, 북부 오점과 리보 뉴 클레아 제 보호 분석에 의한 분석에 적합하다.

2 : P.에서 작은 크기의 RNA의 정량 IDC 중 열대열

  1. 260 nm의 자외선 분광 광도계를 사용하여 1 단계에서 고립 된 개인 샘플의 농도를 결정합니다.
  2. 원하는 RNA 종에 대한 실시간 PCR 프라이머를 생성합니다. 의 mRNA 또는 융합의 miRNA-mRNA를 위해 우리가 SYBR 녹색을 위해 프라이머를 설계하는 동안 miRNA의 혼자, 우리는 미리 만들어진 miRNA의 qPCR에 분석을 사용했다. 반대 mRNA의 서열 (: ATCGAACATGCTGTGAACAT PKA-R)에서 miRNA의 하류 유전자 특이 프라이머 ~ 100 BP는 동안, 상기 융합 RNA를 들어, 정방향 프라이머는 miRNA의 순서 자체 (AAACCGTTACCATTACTGAGTT은 miR-451)이었다.
  3. 사용하여 RNA 샘플 중 하나의 mRNA 및 / 또는 miRNA의 용의 miRNAs (RNA의 20 ~ 40 ng의 사용) 단독으로 또는 임의의 헥사에 대한 헤어핀 프라이머로부터 cDNA를 확인-mRNA 융합 종 (RNA 1 μg의 사용). 실내 온도로 냉각, 65 ℃에서 5 분 동안 RNA와 프라이머를 섞는다. 그 후, 역전사 효소를 추가 믹스 (0.5 μL 역전사, 0.5 μL의 RNase 억제제, 1 μL의 dNTPs의 (2.5 mM의 각각)을, 4 배 μL 완충액, 2 ㎕의 0.1 M DTT, 1 μL H 2 O).
    1. SYBR 녹색 또는의 TaqMan 프로브를 감지 할 수있는 열 순환기에 실행 샘플. 특정 유전자에 대한 PCR (30) 양적 녹색 SYBR은을 사용하여, 40 사이클, 3 단계 PCR, 15 초 동안 95 ° C, 가장 낮은 프라이머 어닐링 온도 영하 30 초 동안 5 ° C로 실행, 30 초 동안 68 ℃, 상업 SYBR 녹색 마스터 믹스. miRNA의 실시간 PCR은 40 사이클, 1 분 동안, 두 단계의 PCR로 15 초 동안 95 ° C에서 60 ° C를 실행 하였다.
    2. ΔΔCt 방법을 사용하여 분석을 정량화하거나 랩는 GTPase (PF08_0110) 또는 18S rRNA의 (31)에 대해 그들을 정상화.

3 : 소개말라리아 기생충에 작은 RNA를의

  1. 형질 당 적혈구의 300 μL 펠렛 브레이크 1에서 5 분 동안 800 XG에서 원심 분리하여 완전한 말라리아 매체 (적혈구의 250 μL, 1.5 × 109 세포를, 궁극적으로 사용된다).
  2. RPMI 완벽한 cytomix (120 밀리미터의 KCl에 재현 탁 회 적혈구를 씻으 0.15 mM의 CaCl2를 10 mM의 K 2 HPO 4 / KH 2 PO 4, 산도 7.6, 25 mM의 HEPES, pH가 7.6, 2 mM의 EGTA, pH가 7.6; 5 밀리미터의 MgCl 2, 브레이크 1에서 5 분 동안 800 XG에 원심 후 50 % 적혈구 용적률에서) KOH로 pH를 조정.
  3. 0.2 cm의 전기 큐벳에 세포를 전송합니다.
  4. 큐벳에 사용자 지정 합성 올리고 뉴클레오티드의 10 μg의 또는 해당하는 금액을 추가하고 문화를 재현 탁.
  5. 310 V / 950 μF에 electroporator을 조정하고 각각의 큐벳에 펄스를 제공합니다.
  6. 미리 예열 완전한 말에 큐벳 내 적혈구의 300 μl를 재현 탁아리아 미디어와 24 웰 플레이트에서 그들을 플레이트와 말라리아 혈액 가스 믹스 밀폐 용기에 37 ℃에서 부화 (3 % O 2, 5 % CO 2).
  7. 4 시간 후, 1 %의 대략적인 최종 기생충에 동기화 후반 trophozoites로 형질 적혈구를 감염.
  8. 감염 문화마다 4-6일 갓 형질 전환 된 적혈구를 추가하고 섹션 4에 나타낸 바와 같이, 유유-1 염색을 사용하여 FACS에 의해 %의 기생충을 결정합니다.

4 : 기생충 감염률시 적혈구 마이크로 RNA 효과의 결정

  1. 1.7 ml의 microcentrifuge 관에 micropipettor과 장소에 의해 재 부유 문화의 100 μl를 가져 가라. 5 분 동안 800 XG에서 원심 분리하여 탁상의 microcentrifuge 1 1X PBS ㎖의 원심 분리기로 두 번 씻으십시오.
  2. 0.025 %의 글루 타르 알데히드 1 ㎖에 재현 탁 펠렛. 실온에서 20 분 동안 샘플을 품어.
    참고 : 샘플은 4 ℃에서 몇 주 동안 여기에 저장 될 수있다. 그 후, 감염된 R 펠렛5 분 800 XG에서 원심 분리하여 수익 증권. 1X PBS 1 ㎖로 두 번 세척 하였다.
  3. 0.015 %의 사포닌 1 ㎖에 재현 탁 펠렛. 15 분 동안 4 ° C에서 품어. 펠렛을 5 분 동안 800 XG에서 원심 분리하여 적혈구를 감염. 1X PBS 1 ㎖로 두 번 세척 하였다. Repeat.4.3. 1X PBS 1 μL (1000 배)의 DNA 얼룩을 함유 한 용액에 재현 탁 세포.
  4. 488 nm의 여기에서, 사이토 흐름에 기생충의 정도를 결정하고 ~ 530 nm의 (FL-1) 방출.
  5. 첫째, 게이트 FSC와 SSC에 따라 흐름 cytometer는 적혈구에 초점을 맞 춥니 다. 그런 다음, FL-1 채널에서 형광에 의해 문이 적혈구에 기생충의도 (감염된 적혈구)를 측정한다.
    참고 : 나중에 기생충은 초기 단계 기생충보다 10 배 더 형광, 그리고 감염되지 않은 적혈구 위 ~ 100 배. 또한, 저속에서 수집하여 잡음을 감소시키는 경향이있다. 마지막으로,이 방법은 3-H 결합 및 하이포크 산틴 김사 염색, 이전에보고 된 양을 13으로하고, 모든 기법 GAV와 비교 한비슷한 결과를 전자.

5 :의 miRNA-mRNA의 퓨전 제품의 비오틴 태그 및 용출

  1. 직접 공유 5 '말단에 연결 desthiobiotin와 사용자 지정 합성 RNA 올리고 뉴클레오티드 (DB-)를 주문한다.
  2. 3 단계에 표시된대로, Desthiobiotin 접합 (DB-)의 miRNA 및 수정되지 않은 miRNA의 (음성 대조군)와 감염되지 않은 적혈구를 형질.
  3. 피와 형질 전환 된 적혈구를 감염 원충은 0.5 % (1.1 단계)의 시작 기생충에 기생충.
  4. 1 단계에서 설명한 바와 같이 기생충 RNA 나중에 사일 (96 시간)을 추출합니다.
  5. 스트렙 트 아비딘 비드 패킹 50 μL와 기생충의 10 μg의 RNA를 부화, 마이크로 피펫을 통해 첨가하고, 4 ℃에서 1 시간 동안 마이크로 원심 튜브에 회 회전한다.
  6. 30 초 동안 800 XG에 구슬을 펠렛 20 밀리미터의 KCl과 1 / 1,000의 RNase 억제제로 씻는다.
  7. 2 MM의 비오틴과 200 μL RNA 캡처 용출 버퍼 (20 mM의 KCl을, 1/1과의 경쟁에 의해 구슬에서 용출 RNA를4에서, 000의 RNase 억제제 및 2 mM의 비오틴) ° C 하룻밤 회전.
  8. 표시 (P)의 농축의 정도를 결정 2 단계에 표시된대로 SYBR 녹색 QRT-PCR과의 TaqMan qPCR에 의한 마이크로 RNA 농축 (양성 대조군)를 사용하여 원충 성적 증명서.

6 : P.의 리보솜 점유를 파악하기 위해 Polysome 분리 열대열

  1. 5 ml의 15 % 수 크로스 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 억제제, 및 15 % 수 크로즈를 배치 ) SW41의 초 원심 분리기 튜브 (14 X 89mm)로.
  2. 5 ㎖ 주사기를 사용하여 5 ml의 50 % 수 크로스 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase를 추가 억제제 및 긴 강철 바늘을 사용하여 15 %의 자당 아래 50 % 수크로오스)를 선택한 다음, 바늘을 제거한다.
  3. 2 시간 후, 천천히 수직 튜브를 기울여 전에 샘플 넣기 적어도 15 분 (14 단계)에 대한 냉각 할 수 있도록 얼음에 튜브를 전송합니다.
  4. 100 ~ 500 총 RNA의 μg의, 또는 ~ 5 %의 기생충 대략 100 ㎖ 비동기 문화를 생성하기에 충분한 변형체 -infected 혈액 단계 문화를 수집합니다. 10 배 (2 mM)을 사이클로 헥시 미드 (CHX)를 포함하는 배양 배지의 볼륨 번째 1/10을 추가하고 10 분 동안 37 ° C에서 품어.
    1. 원심 분리하여 펠렛의 문화는 원심 분리기와 7 분 (브레이크 1) 500 XG에, 다음 PBS 200 μM의 CHX을 포함 1X 실내 온도로 두 번 씻는다. 200 μM의 CHX을 포함 1X PBS에서 기생충 문화를 재현 탁하고 얼음에 저장합니다.
    RBC 펠렛의 양을 추정하고있다. 용해 완충액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM의 CHX, 1mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 억제제, 1 % (v / v)의 IGEPAL CA를 추가 -630, 0.5 ml의 4.25 %의 최종 부피 RBC 펠릿에 DOC) (/ V w). 4에서 해물을 품어 회전하면서 10 분 동안 C를 °.
  5. 마이크로 원심 튜브에 해물을 전송하고 16,000 XG 4에서의 microcentrifuge에서 원심 분리 10 분 동안 C를 °.
  6. M 0.5 차가운 수크로오스 쿠션 용액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF, 40 U / ㎖의 RNase 1.25 mL를 피펫 팅하여 크로스 쿠션을 제조 SW55의 초 원심 분리기 튜브 (13 X 51mm)로 억제하고, 0.5 M 자당).
  7. 조심스럽게 주사기 및 작은 (1-27) 게이지 바늘을 사용하여 수크로오스 쿠션의 상부에 (단계 7)에서 파쇄 상등액을 3.75 mL의 층을 포함한다. STOR섹션 1에 표시된 전자 -80 ° C에서 나머지 해물 (~ 500 μL)는 총 RNA 수준을 추출한다.
  8. 4 사전 냉장 초 원심 분리기 로터로 샘플을로드 13.2 ml의 튜브를 저장할 수 ° C. 366,000 XG에서 샘플을 원심 분리기 146 분 동안 4 ° C.
  9. 피펫을 사용하여, 15ML 원뿔 관에 뜨는을 전송합니다. 무료 (리보솜에 의해 언 바운드)의 RNA의 RN​​A 분리에 대한 -80 ° C에서 뜨는을 저장합니다.
  10. 리보솜 재현 탁 완충액 (400 mM의 아세트산 칼륨, 25 mM의 칼륨 HEPES, pH가 7.2, 15 mM의 아세트산 마그네슘, 200 μM 사이클로 헥시 미드, 1 mM의 DTT, 1mM의 PMSF 및 40 U / ㎖의 RNase 억제제) 500 μL에 리보솜 펠렛을 재현 탁 5 분간 피펫 팅.
  11. 16,000 XG 4에서 마이크로 원심에서 샘플을 원심 분리기   10 분 동안 C를 °.
  12. 얼음에 4 단계에서 기울기를 유지하면서 조심스럽게 그라데이션 USI 위에 리보솜 현탁액 층, 파라 필름 제거NG 주사기와 작은 (~ 27) 게이지 바늘.
  13. 미리 냉장 초 원심 분리기 회 전자에 튜브를 넣고 20 XG 180 분 동안 4 ° C에서로드 구배 원심 분리. 스핀이 완료되면, 저장 4에서 구배 원심 준비가 될 때까지 ° C는 분별에로드합니다.
  14. 분별 구배 초 원심 분리기에 빈 튜브 (이 이전 실행에서 사용되는 튜브 일 수 있음)을로드 한 후 100 × 103의 속도에서 5 분 동안의 RNA 분해 효소가없는 물을 세척한다.
  15. 단계 6.16의 세척 동안 UV 흡광도 검출기의 감도를 설정한다. 좋은 시작 민감도는 0.2이지만,이 이후 (기생충 번호 등에 따라 상당히 달라질 수 있음) (254) 신호에 따라 타점 조절 될 필요가있다.
  16. 검출기 감도가 설정되면 물 검출기를 통해 흐르는 동안, 제로 기준 신호를 설정한다.
  17. 다음 라인이 비어 있고 REM까지 분획 수집기를 세정 후, 액체의 역류빈 초원 심 분리기 튜브를 비켜.
  18. 이 바늘 장치를 종료 할 때까지 분별을 통해 60 % 자당 솔루션을 실행합니다.
  19. - 조 이상 않도록주의하면서 로딩 챔버의 상단에있는 최초의 기울기를 포함하는 튜브를 삽입하고 도장을 조입니다. 그리고, 바늘로 튜브의 바닥을 관통.
  20. (펌프의 전면 유속 조절기에 의해 제어 됨) 12.5 × 106에 유체 흐름의 속도를 재설정 한 후 18 초간의 분획을 수집하는 자동화 된 분획 수집기를 설정 (~ 330 μL / 분획) 마이크로 원심 튜브.
  21. 앞으로 60 % 자당 용액의 흐름을 시작합니다.
  22. 구배 용액의 첫번째 드롭 마이크로 원심 튜브로 떨어지면, 즉시 분획 수집 및 신호 (254)의 실시간 기록 모두를 시작한다.
  23. 급락이 50 % 및 60 % 자당 용액의 계면에 해당하는 신호 (254)에서 관찰하면, 유체 흐름 (254)을 모두 정지
  24. 그라데이션 분수에 보관 -80   나중에 사용하기 위해 C를 °.
  25. 60 % 수크로오스 용액을 초 원심 분리기 튜브에서 비운다까지 100 × 106의 유체 속도로 역류.
  26. 분별 추가적인 구배가있는 경우, 로딩 챔버로부터 빈 초 원심 튜브를 제거하고 6.21 단계에서 다시 시작. 모든 샘플이 완료된 경우 단계 6.16 및 6.19에서 수행되었을 때, 장치를 세척한다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

P. 인간 마이크로 RNA의 글로벌 프로파일 열대열

여기에 제시된 기술은 다양한 조건에서 기생충에서 마이크로 RNA를 추출하는 데 사용되었다. 한가지 유의할 사항들은이 문서 및 원래 공부 (29) 모두에 제시된 마이크로 RNA 데이터 기준점 역임 32에 나타낸 바와 같이, 감염되지 않은 적혈구 용 RNA의 추출을 수행 하였다는 것이다. 그 이전의 연구는 HBSS의 적혈구 특정 miRNA가, 특히은 miR-451의 훨씬 더 큰 수준을 보유하고 있음을 보여 주었다. 위에 표시된 기술은 HBS (HBA의 또는 HBSS) 감염 기생충의 miRNA의 풍부의 변화를 입증하기에 충분했다. 18S rRNA의에 대해 전술 한 바와 같이 정규화 RNA 샘플을 추출 하였다. HBSS 적혈구에서 기생충 샘플은, 예를 들면,은 miR-451 (도 1) 등 여러 가지 마이크로 RNA의 수준에서 상당한 증가를 보여 않는다. 호스트 erythr에서의 miRNA의 흡수ocyte 또한 이전의 연구 (34, 35)과 일치한다.

은 miR-451와 HbAA 적혈구의 형질은 HbAA은 miR-451 HBSS의 적혈구와 비슷한 수준으로 (그림 1) 증가했다. 유동 세포 계측법 후 기생충의 성장시 miRNA의 전위의 영향을 평가하기 위해, 기생충 감염을 측정 하였다. 그 기초 미르 - 451 미르-223은 miR-181a로 형질 HbAA의 적혈구는 ssDNA를 올리고와 함께, 기생충의 성장에 따라 마이크로 RNA의 효과를 조사 하였다. 만에 의해 완화 될 수있다은 miR-451 현저하게 감소 기생충과 형질 안티센스은 miR-451 올리고을 공동 - 형질 동안 - (D 그림 2A) ssDNA를 또는은 miR-181a의 형질은 기생충에 따라 영향을 미치지 아니합니다.

2'-O-Me 전화 안티센스 마이크로 RNA의 형질 전환에 의한 마이크로 RNA의 차단은 상호 효과를 보여 주었다. HBSS의 적혈구는 자연적으로 더 높은은 miR-451 수준, 형질 감염시켰다 안티센스은 miR-451 또는 2'-O- 메틸 올리고 뉴클레오티드 (그림 3)와 함께. 은 miR-451의 억제는 모두 HBSS 적혈구 (- F 그림 3C)에서 기생충의 성장을 증가했다. 기생충 비율은 평균과 HBSS 성장 (그림 3 층)에 배 변경 상대적으로 제시 한 후, 적어도 3 개의 독립적 인 형질에서 계산 하였다.

비오틴 캡처 분석에 의한 miRNA의-mRNA의 융합 RNA를 캡처

5'-desthiobiotin-은 miR-451의 형질 전환 후 (5'Db는-은 miR-451)과 5'Db-은 miR-181, 방법 (5)에 나타낸 바와 같이, 그것은 관찰 된 miRNA의 순서가 인간의 마이크로 RNA와 유래 결정되었다. QRT-PCR 분석 5'Db-은 miR-451의 형질이 PKA-R 융합 성적 증명서의 농축에 (그림 4) 결과 것으로 나타났다.

Polysome 분리 P.의 리보솜 점유율을 결정하는 열대열

십t "> 전형적인 254 트레이스 분획 밀도 그래프 (왼쪽 가벼운 분획). 초기 (254)에 왼쪽에서 오른쪽으로 증가함에 따라, (도 5b에 rRNA의 콘텐츠의 북 확인)와도 5a에 도시 초기 분획에 의한 헤모글로빈의 흡광도가 상당히 높지만 신속 기준선으로 떨어진다. 제 작은 피크가 작은 리보좀 서브 유닛 (40S)에 대응하고, 약간 크고 큰 대응하는 제 2 피크에 의해 신속하게 하였다 리보솜 서브 유닛 (60 년대). 일반적으로 열대열 원충의 가장 큰 세 번째 피크는, 그 높이 때문에 monosome 피크 (80).에 해당하는, 80 년대는 UV 검출기의 감도를 조정을 참조 표기 60 년대는, monosome 피크의 시작으로 "어깨"처럼 흐리게 신호에 대한 후속 실행 (6.17 단계)를 참조하십시오. 또한, 80 년대 최대의 크기로 인해, 그것은 일반적인 경우 모두 60 년대와 80 년대신호가 크다.

monosome 피크 다음 polysom​​es 피크에 대응한다. 각각의 연속적인 피크 리보솜 점차 큰 수를 나타내는 polysome 분획 (2, 3, 4, 등)을 나타낸다. 각 polysom​​e 피크는 각각의 연속 polysom​​e 번호 ​​2-3 배 높이의 감소, 고점보다 또한 작다. 통상적 인 실행은 출발 물질이 다량의 일부 실행에서 관측 된 9 량체 polysom​​e까지의 해상도 비록 5-7 리보솜 이루어지는 polysom​​es의 해상도를 허용 할 것이다. 고차 polysom​​es는 트레이스의 나머지를 구성하고, 이러한 구배 조건에 따라 해결 될 수 없다.

그림 1
그림 1 : MIR-451은 HBSS의 적혈구에서 증가되는 Intraparasitic은 miR-451 수준, 실시간 PCR에 의해 결정 18S rRNA에 대한 표준화로, 지정된 분리 기생충에서.적혈구 유형. 값은 ± SE 평균 있습니다.

그림 2
그림 2 :은 miR-451의 과발현 정상적인 적혈구에서 기생충의 성장을 억제한다 (A - C) 총 적혈구의 비율이 표시 적혈구 유형, (M1)로 표시 될 때, 감염 속도를 나타내는 대표적인 외과 플롯.. (D) 복합 감염률 외과에서 파생 된 형질 감염되지 않은 HbAA 적혈구에 대한 표준화. D는 평균 ± SE 동안 패널 AC의 값은 대표 외과 플롯이다.

그림 3
그림 3 :. 겸상 적혈구 적혈구 미르-451의 억제는 기생충의 성장을 끌어 올리고 (- E) 감염률을 나타내는 대표 외과 플롯, 총 적혈구의 비율 등을 표시 어를 들면, M1으로 표시됩니다ythrocyte 유형. 형질 감염되지 않은 HbAA 적혈구에 대한 정규화 된 값으로 외과에서 파생 된 플롯 (F) 복합 감염률. 패널 AE의 값 대표 외과 플롯이며, F는 ± SE를 의미합니다.

그림 4
그림 4 :은 miR-451의 형질은 PKA-R 융합 성적 증명서에 대한 풍부하고 융합 miRNA를 원점에서 적혈구 것을 보여준다 스트렙 타비 딘에 의해 캡처 된 표시 desthiobiotin 공역의 miRNA-mRNA의 융합 성적 증명서의 농축.. 값은 실시간 PCR을 사용하여 측정 및 비 형질 기생충 대 상대 값으로 플롯 하였다. 값은 ± SE 평균 있습니다.

그림 5
그림 5 :. 기생충 리보솜은 자당 기울기를 통해 분리 할 수있다 (A - B) Examp제작은 말라리아 원충에서 추출 polysome 프로필의 추적합니다. (관련 리보솜의 수를 나타내는 #S와) 40S, 60S, 80S 및 Polysome 봉우리 말라리아 원충에서 추출한 polysome 프로필,의 (A) 추적 표시. (B) 리보솜 분수에서 18S와 28S rRNA의 북부 오. 값은 ± SE 평균 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HBS는 P. 의한 심각한 말라리아에 대한 보호를 제공하기 때문에 주로, 말라리아 풍토병 지역에서 가장 일반적인 헤모글로빈 변형 중 하나이다 열대열. 기술 P.의 유전자 조절에 인간 마이크로 RNA의 역할을 특성화하는 데 필요한 원충이 원고에 걸쳐 자세히 설명되어 있습니다. 모든 작은 RNA를 포함하는 방식으로 전체 RNA를 추출하고, 비교적 간단 기생충 용해 절차를 수행하여함으로써, 이들 융합 RNA를 독립적 인 다양한 기술을 통해 식별 할 수 있었다.

이 단계는 비교적 간단하지만 문제 제대로 따르지 않을 경우 오염에 민감하다. 기생충 추출 동안, 호스트 적혈구 오염 제거 사포닌 분해를 수행하는 것이 중요합니다. 이 RNA 분리의 사포닌 분해 단계에서 특히 그러하다. 호스트 적혈구 miRNA의 성분 크기 g의 몇 배이다그것이 가능한 한 많은 오염 적혈구를 제거하는 것이 중요하므로 인해 대부분 적혈구 부분적 기생충,보다 reater은 비감염 되. 그것은 (감염 사이클의 특정 지점이 요구되는 경우) miRNA의 정확한 프로파일을 획득하기 위해 건강한 적절한 단계에서 말라리아 배양을 유지하는 것도 중요하다. 마찬가지로, 페놀 - 클로로포름 추출 동안, 상기 수성 상이하지 않을 경우, 임의의 잔류 오염을 방지 페놀 - 클로로포름 추출을 반복 명확하고 확인하는 극히 중요하다.

또한, desthiobiotin 캡처 실험에서는, 바이오틴의 과잉 용출 적절한 특정 용출을 확보하기 위해서, 스트렙 타비 딘 비드의 최소를 사용하는 것이 중요하다. 구슬의 비오틴과의 경쟁보다는 완전한 변성 자신을 통해 결합 된 RNA를의 용출, 극적으로 배경 RNA 농축을 줄이기 위해 봉사했다. 마지막 desthiobiotin 캡처 실험 강조 하였다이러한 miRNA가 포착되었다,하지만 몇 가지 다른 기술은 또한 북부 오 점 및 리보 뉴 클레아 제 보호 분석 (29) 등이 융합의 RNA를 보여주기 위해 이전의 연구에서 사용 된 방법을 설명하는 한 가지 중요한 방법이야. 이러한 형질의 miRNAs의 전송 및 처리를 매개 할 수 연관된 단백질 복합체의 정제와 같은 넓은 응용을 가질 수있다 변성 증명서를 검색하는 마이크로 RNA 형질 감염을 사용하는 상기 방법.

다양한 게놈 넓은 접근 방식은 말라리아 프로테옴 및 사체 22-25을 연구하는 데 사용되었지만, 거기에 몇 가지 방법은 세계적이다 P.에서 번역 규제를 검토 21,26 원충. 이 방법 론적 한계는 경찰에서 번역 규제의 글로벌 분석을 배제 열대열. 번역 조절을 연구하는 가장 일반적인 실험 방법 중 하나는 전체 번역을 평가 polysom​​e 프로파일입니다특정 관심의 mRNA에로드 리보솜에 근거 등 활동. 이 원고에서 자세한 감염된 적혈구와 내 기생충을 모두 lyses 말라리아 기생충에 사용하기 위해 최적화 된 polysom​​e 프로파일 링 방법입니다. 이전 방법은 polysom​​es의 대부분을 복구하고 말라리아 기생충 polysom​​es의 상당한 인구를 가지고 있지 않은 것처럼 보이는 이루어지지 않았다. 아세트산 칼륨 및 마그네슘의 고농도 용해 버퍼의 사용은 본래의 polysom​​es 캡처 있도록 막 결합 리보솜 가용화하면서 가능한 적혈구 기생충 모두 용균하도록했다.

리보솜 정화 및 프로파일 링이 비용 효율적인 방법은 말라리아 사체와 프로테옴 사이에 존재하는 지식의 격차를 해소하는 데 도움과 경찰의 번역 상태의 게놈 차원의 분석을 가능하게 할 것이다 열대열. 이 방법은 초기 및 후기 스테이지 (B)의 평행 상태를 비교하기 위해 사용되어왔다스테이지들 (100d)은 밀접 유전자 발현을 조정 한 28 기생충. 사체의 리보솜 로딩의 데이터가 용이하게 획득하고 특정의 mRNA에 리보솜의 밀도를 결정하기 위해 분석 될 수있다. 소르비톨과 결합 될 때 동기화 더욱이, 리보솜 밀도의 변화는 변환이 기생충의 라이프 사이클에 걸쳐 조절되는 방법을 확립하기 위해 사용될 수있다. 이 방법을 사용하여 변이의 분리 불행히도이 수행 될 수있는 말라리아 라이프 사이클 단계를 제한 배양의 큰 양을 필요로한다. 입력 재료의 대량 또한 말라리아 원충의 시험 관내 실험 균주의 사용에 제한을 둘 것이고, 다른 감염성 유기체로의 적용 가능성을 제한 할 수있다. 이 절차를 사용하는 사람은 또한 유전자 조절의 대안 모드를 반영, 리보솜과 연관되지 않은 특정 성적 증명서에 이상한 번역 프로파일을 보여 유전자 선별 할 수있을 것입니다. 마지막으로,이 방법은 새로운 말라리아 에이전트가 단백질 번역에 미치는 영향을 평가하기 위해 사용되며, 약물 내성의 번역 기반 메커니즘을 식별 할 수 있습니다. 이 파이프 라인은 식별하고 많은 실험 시스템의 전사 후 조절을 결정하는 좋은 유틸리티를 가지고있다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics