Methoden om de regulerende rol van kleine RNA's en Ribosomaal bezetting van Onderzoek * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De genetische variatie die verantwoordelijk is voor het sikkelcel allel (GB) stelt erytrocyten om infectie te weerstaan ​​door de malariaparasiet, P. falciparum. De moleculaire basis van deze weerstand, waarvan bekend is multifactorieel, blijft onvolledig begrepen. Recente studies gevonden dat de differentiële expressie van erytrocyten microRNAs, zodra translocatie in malariaparasieten, invloed hebben op zowel genregulatie en de parasiet groei. Deze miRNAs werden later aangetoond dat mRNA translatie te remmen door de vorming van een chimeer RNA-transcript via 5 'RNA fusie met discrete subsets van parasiet mRNA. Hier zijn de technieken die werden gebruikt om de functionele rol en vermeende onderliggende mechanisme erytrocyt microRNA op genregulatie en translationele potentieel van P. bestuderen falciparum, waaronder transfectie van gemodificeerde synthetische microRNA in gastheercellen erytrocyten, zal worden gedetailleerd. Ten slotte wordt een polysoom gradiënt methode die wordt gebruikt om te bepalen van de omvang van translation van deze transcripten. Samen vormen deze technieken konden we aantonen dat het ontregelde niveaus van erytrocyten microRNA's bijdragen aan de cel-intrinsieke malaria weerstand van sikkel erytrocyten.

Introduction

Malaria wordt veroorzaakt door apicomplexa parasieten van het geslacht Plasmodium, is de meest voorkomende menselijke parasitaire ziekte, wereldwijd infecteren ongeveer 200 miljoen mensen per jaar en het veroorzaken van zo'n 600.000 doden 1. Van de vijf Plasmodium soorten die de mens infecteren, het meest relevant zijn voor de menselijke ziekte P. falciparum en P. vivax, vanwege hun brede verdelingen en wat ernstige malaria complicaties. De levenscyclus van de malariaparasiet vereist infectie van zowel muggen en mens. Wanneer een geïnfecteerde mug bijt een mens, de parasieten reizen via de bloedbaan naar de lever, waarbij een eerste ronde van de replicatie plaatsvindt. Na merozoites breuk van de gastheer hepatocyten, die ze infecteren nabijgelegen rode bloedcellen, het initiëren of aseksuele en seksuele replicatie. De aseksuele fase van replicatie, die 48 uur duurt in P. falciparum, is de focus van dit onderzoek, aangezien het zowel de bron van de meeste malaria symptomen en gemakkelijk gerecapituleerd in vitro.

Terwijl een aantal initiatieven voor de volksgezondheid, waaronder verbeterde anti-malaria therapieën, enigszins verminderde de last van malaria wereldwijd, de voortdurende opkomst van resistente parasieten vormt een probleem voor malaria controle-inspanningen. Een gebied waarop nieuwe therapeutische benaderingen kunnen voorstellen is de studie over hoe de verschillende genetische varianten resistentie tegen malaria. In malaria-endemische gebieden, een verscheidenheid aan erythrocytische polymorfismen zijn vrij algemeen 2,3. Deze mutaties, met sikkelcelziekte zijn misschien de meest prominente, vaak geassocieerd met aanzienlijke weerstand tegen het ontstaan ​​van symptomatische malaria 4. De onderliggende mechanismen die ze veroorzaken erytrocyten aan malaria-infectie te weerstaan ​​zijn onvolledig begrepen. Geparasiteerde erytrocyten met hemoglobine mutaties zijn onderhevig aan verbeterde fagocytose door een betere cellulaire stijfheid en uitdroging, dieis geassocieerd met verminderde invasie van P. Falciparum 5. De HbC allel ook invloed op eiwitexpressie in de erytrocyten oppervlak en de hermodellering van het cytoskelet, verdere ontwikkeling remmen parasiet 6,7. Tenslotte P. falciparum groeit slecht binnen homozygote sikkel (HbSS) erytrocyten 8,9 in vitro, wat suggereert intrinsieke erythrocytaire factoren van malaria weerstand. Hoewel al deze mechanismen blijken een rol te spelen, zij niet volledig de mechanismen achter sikkelcel resistentie tegen malaria leggen.

Een mogelijke set erythrocytische factoren die slecht blijven begrepen is het grote zwembad van miRNA aanwezig is in rijpe erytrocyten. MicroRNAs zijn kleine niet-coderende RNA's 19-25 nt in grootte, die translatie en / of stabiliteit van target mRNAs bemiddelen door basenparing binnen de 3 'UTR. Ze zijn betrokken bij de controle van zoogdier immuunresponsen, zoals de onderdrukking of virusreplicatie 10, en werden naar resistentie tegen virussen in planten Zij hebben ook aangetoond dat verschillende erythrocytische processen, waaronder erytropoëse 11,12 en ijzerstofwisseling 13 reguleren. Eerdere studies die een rijke en gevarieerde bevolking van erythrocytische miRNAs, waarvan de expressie is dramatisch veranderd in HBSS erytrocyten 14,15. Sinds rijpe erytrocyten gebrek actieve transcriptie en translatie, de functionele rol van deze erytrocyten miRNAs blijft onduidelijk. Zo belangrijk materiaal uitwisseling plaatsvindt tussen de gastheercel en P. falciparum tijdens de intraerythrocytic ontwikkelings cyclus (IDC) 16, werd gespeculeerd dat de veranderde miRNA profiel binnen HbS erytrocyten direct kunnen bijdragen aan de cel-intrinsieke malaria weerstand.

Deze studies leidde uiteindelijk tot de ontwikkeling van een pijpleiding voor het isoleren, identificeren en functioneel bestuderen van de rol van menselijke miRNA in de malaria parasiet, P. falciparum, die aangaf dat de gastheer / menselijke miRNAs uiteindelijk covalent zekering en vervolgens translationeel onderdrukken parasiet mRNA-transcripten 17. Dit verschaft een voorbeeld van het eerste cross-species chimere transcripten gevormd door trans-splicing en impliceert dat miRNA-mRNA-fusie kan optreden in andere soorten, waaronder andere parasieten. Alle trypanosoom mRNA trans-splicing met een splice-leader (SL) de scheiding van polycistronische 18 transcripten reguleren. Aangezien P. falciparum ontbreekt orthologen voor Dicer / Ago 19,20, is het mogelijk dat erytrocyten miRNAs kapen vergelijkbare SL machines in P. falciparum te integreren in target genen. Recente studies in P. falciparum in feite gaf de aanwezigheid van 5 'splice leadersequenties 21. Deze studie beschrijft de methodes die tot de ontdekking van humane parasieten miRNA-mRNA fusietranscripten, zowel transcriptoom en translanale regelgeving technieken. De algemene doelstelling van deze methoden om de effecten van kleine RNAs in genregulatie, fenotypen en vertaling potentieel van P. onderzoeken falciparum transcripties.

De initiële identificatie van humane parasieten chimere transcripten aangevoerd gebruik van RNA analysetechnieken, zoals real-time PCR, sequencing en transcriptoom EST bibliotheek vangen, die zowel totaal en kleine RNAs, in plaats van technieken die op geïsoleerde kleine RNA inbegrepen. Isoleren alle RNA samen in een grote pool, in plaats van afzonderlijk het mogelijk gemaakt zowel translocatie menselijke kleine RNA in de parasiet en de aanwezigheid van deze kleine RNA-sequenties als deel van een grotere sequentie. Dit vereist dan een analyse van de translatietoestand van deze fusie-mRNA's om de functionele consequenties van deze fusies bepalen.

Terwijl de uitgebreide inspanningen op het karakteriseren van de parasiet genoom eend transcriptome hebben toegevoegd aan het begrip van de parasiet biologie 22-25, veel minder bekend over de translationele regulering van het mRNA transcriptoom over de levenscyclus van P. 26 falciparum. Deze beperkte begrip van proteoom de parasiet heeft zowel begrip van de biologie van de parasiet en de mogelijkheid om nieuwe targets te identificeren voor de volgende generatie van anti-malaria therapeutische gehinderd. Deze kloof in het begrijpen van cellulaire biologie van de parasiet is grotendeels te wijten aan het gebrek aan passende technieken bleef translationeel regelgeving P. onderzoeken falciparum. Een recent artikel beschreef het gebruik van ribosomale footprinting van P. falciparum de wereldwijde vertaalstatus 21 te bepalen. Een gevestigde meting van translatie van transcripten mogelijk is het aantal geassocieerde ribosomen bepaald polysoomdisplays profilering. Echter, wanneer deze techniek wordt toegepast voor P. falciparum </ em>, het is niet in staat om de meeste polysomen herstellen en vangt overwegend monosomes. Onlangs hebben diverse groepen 27,28 P. geoptimaliseerd falciparum polysoom technieken door lyseren van de erytrocyten en parasiet gelijktijdig aan de polysomen behouden en te karakteriseren de ribosomale bezetting en translationele potentieel van deze malariaparasieten tijdens hun ongeslachtelijke ontwikkeling in gastheer rode bloedcellen 28.

Tezamen zijn deze werkwijzen tonen dat de waargenomen fusie van menselijke miRNA parasitaire mRNAs moduleert parasiet eiwittranslatie van die fusie-mRNA, waarbij werd aangetoond met eerder beschreven werkwijzen 27 en is een belangrijke determinant van malaria resistentie in HbAS en HbSS erytrocyten 17. Deze methoden zou nuttig zijn in elk systeem op zoek naar RNA splicing gebeurtenissen identificeren en functioneel te verkennen, of die fusie RNA's zijn binnen P. falciparum of andere eukaryotische systemen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Isolatie van Kleine en middelgrote RNA's van P. falciparum Tijdens de IDC

  1. Verkrijgen malariaparasieten in aseksuele cultuur 29.
    LET OP: De benodigde cultuur grootte zal variëren op basis van de gewenste toepassing; Maar een kweek 10 ml van 3-5% parasitemie en 5% hematocriet biedt voldoende RNA voor real-time PCR (RT-PCR). De techniek werd aanvankelijk geoptimaliseerd voor asynchrone kweken, maar wanneer specifieke tijdstippen gedurende de infectiecyclus gewenst, kan ring-parasieten uiterlijk 10-12 uur na invasie worden gesynchroniseerd door synchronisatie sorbitol. Synchronisatie wordt herhaald na een cyclus (ongeveer 48 uur) 29.
  2. Pool geïnfecteerde cellen samen (5 x 10 ~ 9 RBCs bij 3-5% parasitemie) en vul koude PBS tot de bovenkant van de buis en centrifugeer bij 800 xg gedurende 5 min zonder remmen om de rode cellen te pelleteren.
  3. Na het centrifugeren, verwijder het supernatant voorzichtig met een pipet opzuigen, bevestigdeen vacuüm, aangezien de erythrocytaire pellet gemakkelijk te verwijderen. Was de pellet opnieuw met koud 1x PBS.
  4. Resuspendeer celpellet in koude 0,15% saponine (in 1x PBS) en plaats op ijs gedurende 30 min.
  5. Centrifugeer cellen bij 1500 xg gedurende 12 min bij 4 ° C, verwijder supernatant (die donkerrood van kleur zijn) en resuspendeer pellet in koude PBS. Herhaal nog een keer deze stap.
    Opmerking: Om ervoor te zorgen dat de onderhavige microRNAs waren weerspiegelend van miRNA binnen parasieten, en niet erythrocytische verontreiniging, een aantal parasieten isolatie omstandigheden getest: 1) saponine lysis, 2) saponine lysis gecombineerd met RNaseA behandeling gastheercel miRNAs en 3 ) methyl-beta-cyclodextrine behandeling om de parasiet uit de gastheer erytrocyten te verwijderen. Alle behandelingen gaven vergelijkbare resultaten.
  6. Lyse de geïsoleerde parasiet pellet met behulp van de aanbevolen 600 ul lysisbuffer. Dit volume lysis buffer is voldoende voor kweken tot ~ 30 ml van 2% hematocriet en 5% parasitemie.
    LET OP: Voor grotere parasiet culturen, kan dit volume worden verhoogd. Het is belangrijk om volledige lysis van de parasiet pellet verzekeren door grondige vortexen gedurende ten minste 1 min. Ook voor het gemak van de extractie, de gelyseerde monsters worden overgebracht naar een 1,7 ml microcentrifugebuis.
  7. Voeg 60 ul of 1/10 volume van de lysis buffer die bij stap 6, homogenaat toevoegsel (2 M natriumacetaat, pH 4).
  8. Verlaat monsters op ijs gedurende 10 minuten.
  9. Voeg 600 pl, of een volume gelijk aan de hoeveelheid lysisbuffer toegevoegd in stap 6, zuur fenol chloroform aan elk monster en vortex gedurende 1 minuut.
  10. Scheid de waterige en organische fasen door centrifugeren van de monsters bij 10.000 g gedurende 5 min. Deze rotatie is langer dan de door de kit te verzekeren dat alle hemoglobine / hemozoine in de organische fase.
  11. Verzamel de bovenste (waterige) laag en overbrengen naar een nieuwe buis. Herhaal de stappen 9 en 10 als de waterfase wit of (waarschijnlijker) bruine kleur, waarbij pro suggereertTein besmetting.
  12. Bepaal het volume van de verkregen supernatant met een pipet en voeg 1,25 volumina 100% ethanol (~ 800 ul) en meng door de 1,7 ml microcentrifugebuis 5 keer.
  13. Passeren elk monster door een ontvangen-RNA-bindende filterpatroon (verschillende van de handel verkrijgbaar) door hetzij centrifugeren bij 14.000 xg gedurende 1 min en door een vacuüm spruitstuk.
  14. Was de filterpatroon met 700 ul van het miRNA wasbuffer 1 met behulp van een microcentrifuge, het spinnen bij 14.000 xg gedurende 1 min.
  15. Was het filter met 500 pi wasbuffer 2/3 tweemaal door centrifugeren bij 14.000 xg gedurende 1 minuut elk.
  16. Elueer RNA met 100 pi DEPC-water, dat is voorverwarmd tot 95 ° C, in twee wassen van 50 pl, centrifugeren bij 14.000 xg gedurende 1 min elk. Meet de concentratie van RNA via UV-absorptie bij 260 nm.
    OPMERKING: Een RNA-gel (ofwel TBE-ureum acrylamide of denaturerende formaldehyde-agarosegel) kan be gebruikt om de grootteverdeling van het geïsoleerde RNA beoordelen.
    LET OP: Dit RNA is geschikt voor analyse van microarray, RNA-sequencing, Northern blot en bescherming ribonuclease test.

2: kwantificering van Kleine en middelgrote RNA's van P. falciparum Tijdens de IDC

  1. Bepaal de concentratie van individuele monsters geïsoleerd in stap 1 met UV spectrofotometrie bij 260 nm.
  2. Genereer real-time PCR primers voor de gewenste RNA species. Voor miRNA alleen, gebruikten we premade miRNA qPCR assays, terwijl voor mRNA of fusie miRNA-mRNA we ontworpen primers voor SYBR groen. Voor het fusie RNA, de voorwaartse primer was miRNA sequentie zelf (miR-451: AAACCGTTACCATTACTGAGTT), terwijl het omgekeerde werd een genspecifieke primer ~ 100 bp stroomafwaarts van het miRNA in de mRNA sequentie (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Maak cDNA van het RNA-monsters met behulp van een hairpin primer voor miRNAs (gebruik 20-40 ng RNA) alleen of willekeurige hexameren voor mRNA en / of miRNA-mRNA fusie species (met 1 ug RNA). Meng RNA en primers voor 5 min bij 65 ° C, daarna afkoelen tot kamertemperatuur. Daarna voeg reverse transcriptase mix (0,5 ui reverse transcriptase, 0,5 gl RNase-remmer, 1 pl dNTP's (2,5 mM elk), 4 pl 5 x buffer, 2 ui 0,1 M DTT, 1 ui H2O).
    1. Lopen monsters op een thermocycler het opsporen van zowel SYBR groen of TaqMan probes. SYBR green kwantitatieve PCR 30 specifieke genen werd uitgevoerd als een 3-staps PCR, 95 ° C gedurende 15 sec, laagste primer annealing temperatuur minus 5 ° C gedurende 30 sec en 68 ° C gedurende 30 sec, gedurende 40 cycli, met een commerciële SYBR groene master mix. miRNA real-time PCR werd uitgevoerd als een tweestaps PCR 95 ° C gedurende 15 sec en 60 ° C gedurende 1 minuut, voor 40 cycli.
    2. Kwantificeren testen met behulp van de ΔΔCt methode en normaliseren ze tegen een van beide Rab GTPase (PF08_0110) of 18S rRNA 31.

3: Inleidingvan kleine RNA's in malariaparasieten

  1. Pellet 300 pl rode bloedcellen per transfectie (250 pl RBC ongeveer 1,5 x 10 9 cellen, uiteindelijk worden gebruikt) volledig malaria medium door centrifugatie bij 800 xg gedurende 5 minuten bij brake 1.
  2. Was de erytrocyten tweemaal met RPMI en resuspendeer in volledige cytomix (120 mM KCI, 0,15 mM CaCl2; 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6, 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl2, pH ingesteld met KOH) bij 50% hematocriet na centrifugeren bij 800 g gedurende 5 min bij brake 1.
  3. Overdracht van de cellen naar een 0,2 cm elektroporatie cuvet.
  4. Voeg 10 ug of juiste hoeveelheid, aangepaste synthetische oligonucleotiden aan de cuvettes en resuspendeer de culturen.
  5. Stel de elektroporator tot 310 V / 950 uF en levert een puls aan elke cuvette.
  6. Resuspendeer de 300 pi van RBC in de cuvette in voorverwarmde compleet malaria media en plaat ze in 24 putjes en incubeer bij 37 ° C in een luchtdichte container met malaria bloed gasmengsel (3% O2, 5% CO 2).
  7. Na 4 uur werd infecteren getransfecteerde RBCs met gesynchroniseerde late trofozoiten een geschatte uiteindelijke parasitemie van 1%.
  8. Voeg vers getransfecteerd RBC om de 4-6 dagen om geïnfecteerde culturen en het bepalen van de parasitemie% door FACS met behulp van YoYo-1 kleuring, zoals aangegeven in punt 4.

4: Bepaling van erytrocyten microRNAs Effect Bij Parasite Infectie Rate

  1. Neem 100 ul geresuspendeerde cultuur door micropipettor en plaats in een 1,7 ml microcentrifugebuis. Was tweemaal met 1 ml 1x PBS en centrifugeer in een tafelblad microcentrifuge door centrifugeren bij 800 g gedurende 5 min.
  2. Resuspendeer pellet in 1 ml 0,025% glutaaraldehyde. Incubeer de monsters gedurende 20 min bij kamertemperatuur.
    Opmerking samples can be bewaard verscheidene weken bij 4 ° C. Daarna pellet besmette RBC's door centrifugatie bij 800 xg gedurende 5 min. Was tweemaal met 1 ml van 1 x PBS.
  3. Resuspendeer pellet in 1 ml 0,015% saponine. Incubeer bij 4 ° C gedurende 15 min. Pellet geïnfecteerde RBC door centrifugeren bij 800 g gedurende 5 min. Was tweemaal met 1 ml van 1 x PBS. Repeat.4.3. Resuspendeer cellen in 1 ml 1 x PBS bevattende 1 pi (1000x) DNA kleuring.
  4. Bepaal de mate van parasitemie op een flowcytometer, bij 488 nM excitatie en 530 nM ~ (FL-1) emissie.
  5. Ten eerste poort de flowcytometer basis FSC en SSC richten op RBC. Meet vervolgens de mate van parasitemie (geïnfecteerde RBC) in de gated RBC door fluorescentie in de FL-1 kanaal.
    OPMERKING: later stadium parasieten zijn 10x meer fluorescerende dan eerder stadium parasieten en ~ 100X boven niet-geïnfecteerde rode bloedcellen. Ook verzamelen bij lage snelheid de neiging om ruis te verminderen. Tenslotte heeft deze benadering vergeleken met 3H-hypoxanthine inbouw en Giemsa kleuring, zowel zoals eerder gerapporteerd 13 en alle technieken gave vergelijkbare resultaten.

5: biotine-tagging en Elutie van miRNA-mRNA Fusion producten

  1. Direct te bestellen op maat synthetische RNA oligonucleotiden met desthiobiotine (OB) covalent gebonden aan het 5 'einde.
  2. Transfecteren geïnfecteerde RBC met desthiobiotine-geconjugeerd (DB) miRNA en ongemodificeerde miRNA (negatieve controle), zoals aangegeven in stap 3.
  3. Infecteren getransfecteerd RBC met P. falciparum parasieten om een startlocatie parasitemie van 0,5% (stap 1,1).
  4. Extract parasiet RNA 4 dagen (96 uur) later zoals beschreven in stap 1.
  5. Incubeer 10 ug parasiet RNA met 50 ui gepakte streptavidine korrels, toegevoegd via micropipet en roteren op een microcentrifugebuis rotator gedurende 1 uur bij 4 ° C.
  6. Pellet de korrels bij 800 g gedurende 30 sec en was met 20 mM KCl en 1/1000 RNase Inhibitor.
  7. Elueer RNA's van de bolletjes door competitie met 2 mM biotine en met 200 ul RNA capture elutiebuffer (20 mM KCl, 1/1, 000 RNase inhibitor en 2 mM biotine) en 4 ° C gedurende de nacht met rotatie.
  8. Bepaal de mate van verrijking van aangegeven P. falciparum transcripten met behulp van SYBR groen qRT-PCR en microRNA verrijking (positieve controle) door TaqMan qPCR zoals aangegeven in stap 2.

6: polysoom Scheiding aan Bepaal de Ribosomaal Bezetting van P. falciparum

  1. Plaats 5 ml 15% sucrose-oplossing (400 mM kaliumacetaat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetaat, 200 uM cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor en 15% sucrose ) in een SW41 ultracentrifuge buizen (14 x 89 mm).
  2. Met behulp van een injectiespuit 5 ml, voeg 5 ml 50% sucrose-oplossing (400 mM kaliumacetaat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetaat, 200 uM cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase remmer, en 50% sucrose) onder de 15% sucrose met behulp van een lange stalen naald en verwijder de naald.
  3. Na 2 uur langzaam kantelen van de buis weer rechtop en breng de buis ijs, waardoor het afkoelen van ten minste 15 min voor monsterbelading (stap 14).
  4. Verzamel genoeg Plasmodium geïnfecteerde bloed stadium cultuur 100-500 ug totaal RNA, of ongeveer 100 ml asynchrone cultuur bij 3-5% parasitemie genereren. Voeg 1/10 dat volume kweekmedium dat 10x (2 mM) cycloheximide (CHX) en incubeer bij 37 ° C gedurende 10 min.
    1. Pellet kweken door centrifugatie bij 500 xg gedurende 7 min met de centrifuge (rem 1), vervolgens tweemaal wassen met kamertemperatuur 1x PBS dat 200 uM CHX. Resuspendeer de parasiet culturen in 1x PBS met 200 pM CHX en bewaren op ijs.
    Schat de omvang van de RBC pellet. Voeg lysis buffer (400 mM kaliumacetaat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetaat, 200 uM CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630 en 0,5% (w / v) DOC) aan de RBC pellet tot een eindvolume van 4,25 ml. Incubeer het lysaat bij 4 ° C gedurende 10 minuten tijdens het draaien.
  5. Transfer het lysaat te microcentrifugebuisjes, en centrifugeer de monsters in een microcentrifuge bij 16.000 xg en 4 ° C gedurende 10 min.
  6. Bereid sucrose kussens pipetteren 1,25 ml koude 0,5 M sucrose kussen oplossing (400 mM kaliumacetaat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetaat, 200 uM cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor en 0,5 M sucrose) in een SW55 ultracentrifuge buizen (13 x 51 mm).
  7. Laag voorzichtig 3,75 ml lysaat supernatant (van stap 7) bovenop de sucrose kussen met een spuit en kleine (~ 27) gauge naald. Store de resterende lysaat (~ 500 pi) bij -80 ° C tot totale RNA levels te halen, zoals aangegeven in paragraaf 1.
  8. Laad de monsters in een ultracentrifuge rotor, pre-gekoeld tot 4 ° C, waarbij 13,2 ml buisjes kunnen houden. Centrifugeer de monsters bij 366.000 xg en 4 ° C gedurende 146 min.
  9. Met behulp van een pipet de bovenstaande vloeistof in een 15 ml conische buis. Bewaar het supernatant bij -80 ° C voor RNA-isolatie van vrije (ongebonden door ribosomen) RNAs.
  10. Resuspendeer het ribosoom pellet in 500 pl ribosoom resuspensie buffer (400 mM kaliumacetaat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetaat, 200 uM cycloheximide, 1 mM DTT, 1 mM PMSF, en 40 U / ml RNase Inhibitor) pipetteren gedurende 5 min.
  11. Centrifugeer de monsters in een microcentrifuge bij 16.000 xg en 4   ° C gedurende 10 min.
  12. Terwijl het verloop van stap 4 op ijs, verwijdert de Parafilm, dan voorzichtig laag het ribosoom suspensie bovenop de gradiënt USIng een spuit en kleine (~ 27) gauge naald.
  13. Plaats de buis in een vooraf gekoelde ultracentrifuge rotor gecentrifugeerd en geladen hellingen bij 200.000 xg en 4 ° C gedurende 180 min. Wanneer de rotatie is voltooid, opslag gecentrifugeerd bij 4 hellingen ° C tot klaar om te laden op de fractioneerinrichting.
  14. Plaats een lege ultracentrifuge buis in de gradiënt fractioneerinrichting (dit kan een buis gebruikt in een vorige run te zijn), daarna wassen met RNAse-vrij water gedurende 5 minuten bij 100 x 10 speed.
  15. Tijdens het wassen in stap 6,16, de gevoeligheid van de UV absorptiedetector. Een goed uitgangspunt gevoeligheid is 0,2, maar kan moeten worden aangepast later loopt afhankelijk van het signaal A 254 (die varieert op basis van parasiet nummer, etc.).
  16. Zodra de gevoeligheid detector is ingesteld, stelt u de basislijn signaal naar nul terwijl het water stroomt door de detector.
  17. Na het wassen van de fractie collector, omkeren van de vloeistofstroom tot de lijnen zijn leeg en dan remove de lege ultracentrifuge buis.
  18. Run 60% sucrose oplossing door de fractioneerinrichting totdat deze uit de naald apparaat.
  19. Plaats de buis met de eerste gradiënt aan de bovenkant van de laadruimte en draai de afdichting, zorg niet te strak. Vervolgens doorboren de bodem van de buis met de naald.
  20. Stel de fluïdum stroomsnelheid tot 12,5 x 10 (geregeld door de stroomsnelheid bedieningsknop aan de voorzijde van de pomp), stel de geautomatiseerde fractiecollector voor 18 sec fracties te verzamelen (~ 330 ul / fractie) in microcentrifugebuizen.
  21. Start vooruit stroom van de 60% sucrose-oplossing.
  22. Toen de eerste daling van de gradiënt oplossing druppels in de microcentrifugebuis, onmiddellijk beginnen met zowel fractie verzamelen en live opname van de A 254-signaal.
  23. Zodra een sterke daling waargenomen in de A 254 signaal, corresponderend met het raakvlak tussen de 50% en 60% sucrose oplossingen stop zowel de fluïdumstroom en A 254
  24. Bewaar de gradiënt fracties bij -80   ° C voor later gebruik.
  25. Omkeren van de vloeistofstroom bij 100 x 10 snelheid tot 60% sucrose oplossing leegt uit de ultracentrifuge buis.
  26. Als er extra hellingen te fractioneren, verwijder de lege ultracentrifuge buis van de laadruimte en herstart vanaf stap 6.21. Indien alle monsters zijn voltooid, was de inrichting werd uitgevoerd in stappen 6,16 en 6,19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Wereldwijde profilering van menselijke microRNA in P. falciparum

De hier gepresenteerde technieken werden gebruikt om microRNAs van parasieten extract in verschillende omstandigheden. Een ding om op te merken is dat RNA extracties voor niet-geïnfecteerde rode bloedcellen werden uitgevoerd zoals aangegeven in 32, die vaak diende als een referentiepunt voor de microRNA gegevens in zowel dit artikel en de oorspronkelijke studie 29. Die eerdere studies toonden ook aan dat HbSS erytrocyten bezat veel groter niveau van bepaalde miRNAs, miR-451 in het bijzonder. De bovengenoemde technieken volstonden om de veranderingen in miRNA overvloed in HbS (HbAS of HbSS) infecterende parasieten te tonen. RNA-monsters werden geëxtraheerd zoals boven aangegeven en genormaliseerd tegen 18S rRNA. Parasietmonsters van HbSS RBC's, bijvoorbeeld, vertonen een significante stijging van het aantal microRNA, zoals miR-451 (Figuur 1). De opname van miRNA van de gastheer erythrocyte is ook in overeenstemming met eerdere studies 34,35.

Transfectie van hbaa erytrocyten met miR-451 steeg hbaa miR-451 tot een niveau vergelijkbaar met HbSS erytrocyten (figuur 1). Flowcytometrie werd vervolgens gebruikt om parasitaire infectie te meten, teneinde het effect van miRNA translocatie bij parasietgroei beoordelen. Op basis van dat hbaa erytrocyten getransfecteerd met miR-451, miR-223 en miR-181 A, samen met een oligo ssDNA werden onderzocht op de effecten van miRNA bij parasietgroei. Transfectie van ssDNA of miR-181 A had geen effect op parasitemie (Figuur 2A - D) terwijl transfectie met miR-451 duidelijk verminderd parasitemie, die kunnen worden verzacht alleen co-transfecteren van een antisense oligo miR-451.

Blokkeren van microRNAs door transfectie van 2'-O-Me antisense microRNAs toonde een wederkerige effect. HbSS erytrocyten, met natuurlijk hogere miR-451 niveaus, werden getransfecteerd met antisense miR-451 of 2'-O-methyl oligonucleotiden (Figuur 3). Remming van miR-451 steeg parasiet groei in zowel HbSS erytrocyten (Figuur 3C - F). Parasite percentages werden berekend uit ten minste 3 onafhankelijke transfecties, vervolgens gemiddeld en gepresenteerd als voudige verandering ten opzichte HbSS groei (figuur 3F).

Vangst van miRNA-mRNA fusie RNA's door biotine capture assay

Na transfectie van 5'-desthiobiotine-miR-451 (5'Db-miR-451) en 5'Db-miR-181, zoals aangegeven in methoden sectie 5, werd vastgesteld dat de waargenomen miRNA-sequentie afkomstig is met de menselijke microRNA. qRT-PCR analyse aan dat transfectie van 5'Db-miR-451 leidde tot verrijking van PKA-R fusie transcripten (figuur 4).

Polysoom scheiding de ribosomale bezetting van P. bepalen falciparum

tent "> Een typische 254 spoor wordt getoond in figuur 5A (met Noord bevestiging van rRNA-gehalte in figuur 5B), met de fractie densiteitsverhogende van links naar rechts in de grafiek (dat wil zeggen lichtere fracties links). De aanvankelijke A 254 is vrij hoog vanwege de absorptie van hemoglobine in de vroege fracties, maar snel zakt naar de basislijn. Het eerste kleine piek correspondeert met de kleine ribosomale subeenheid (40S), snel gevolgd door de tweede piek, die iets groter en komt overeen met de grote ribosomale subeenheid (60S). De derde piek, hetgeen doorgaans het grootst voor P. falciparum, overeen met de monosome piek (80S). Door zijn hoogte, moeten de 80S worden gebruikt als richtlijn om de gevoeligheid van de UV detector aanpassen voor volgende runs (stap 6.17). Ook, door de omvang van de 80S piek, is het gebruikelijk dat het 60S signaal te vervagen als een "schouder" in het begin van de piek monosome, als zowel de 60S en 80Ssignalen zijn groot.

Na de monosome piek zijn de pieken die overeenkomen met polysomen. Elke volgende piek staat voor een polysoom breuk welke steeds grotere aantallen ribosomen (2, 3, 4, etc.). Elke polysoom piek is ook kleiner dan de vorige piek afneemt in hoogte 2-3 maal met de opeenvolgende polysoomdisplays nummer. Typische runs wordt de resolutie van polysomen samengesteld 5-7 ribosomen toelaten, hoewel resolutie van een 9-mer polysoomdisplays waargenomen in sommige runs met een grote hoeveelheid uitgangsmateriaal. Hogere polysomen Om samen de rest van het spoor, en kan niet onder deze gradiënt omstandigheden worden opgelost.

Figuur 1
Figuur 1: MiR-451 worden verhoogd in HbSS erytrocyten Intraparasitic miR-451 niveaus, zoals bepaald met real-time PCR en 18S rRNA genormaliseerd tegen uit parasieten geïsoleerd uit de aangegeven.types erytrocyten. Waarden zijn gemiddelden ± SE.

Figuur 2
Figuur 2: Overexpressie van miR-451 in normale erythrocyten remt parasietgroei (A - C) Representatieve FACS plots vermelding infecties, als percentage van de totale RBC, zijn aangegeven met m1, gedurende de types erytrocyten.. (D) Composite infectie tarieven afgeleid van FACS en genormaliseerd tegen ongetransfecteerde hbaa RBC. Waarden in panel AC zijn representatief FACS plots terwijl D gemiddelde ± SE.

Figuur 3
Figuur 3:. Remming van miR-451 in sikkelcel erytrocyten verhoogt parasietgroei (A - E) representatief FACS plots vermelding infecties, als percentage van de totale RBC, zijn aangegeven met m1, gedurende de ERythrocyte types. (F) Composite infectie tarieven afgeleid van FACS en uitgezet als een genormaliseerde waarde tegen ongetransfecteerde hbaa RBC. Waarden in panel AE zijn vertegenwoordiger FACS plots, F gemiddelde ± SE.

Figuur 4
Figuur 4: Transfectie van miR-451 verrijkt voor PKA-R fusietranscripten en toont aan dat het gefuseerde miRNA is erythrocytaire oorsprong Verrijking van de aangegeven desthiobiotine geconjugeerde miRNA-mRNA fusietranscripten die zijn gevangen genomen door streptavidine.. De waarden werden gemeten met real-time PCR en uitgezet als relatieve waarde ten opzichte ongetransfecteerde parasieten. Waarden zijn gemiddelden ± SE.

Figuur 5
Figuur 5:. Parasite ribosomen kunnen worden geïsoleerd door sucrose gradiënt (A - B) voorble sporen van een polysoom profiel gewonnen uit Plasmodium falciparum. (A) Spoor van een polysoom profiel gewonnen uit Plasmodium falciparum, de 40S, 60S, 80S en polysoom pieken (met #s vermelding van het aantal ribosomen verbonden) weergegeven. (B) Northern blot van 18S en 28S rRNA over de ribosomale fracties. Waarden zijn gemiddelden ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS is een van de meest voorkomende hemoglobinevarianten malaria endemische gebieden, vooral omdat het bescherming tegen ernstige malaria veroorzaakt door P. falciparum. De technieken die nodig zijn om de rol van menselijke microRNA karakteriseren in genregulatie P. falciparum zijn beschreven in dit manuscript. Door extractie van totaal RNA op zodanige wijze dat alle kleine RNA's omvatten, en door het uitvoeren van een relatief eenvoudige parasiet lysis procedure die fusie RNA's konden worden geïdentificeerd door een verscheidenheid van onafhankelijke technieken.

Deze stappen zijn relatief eenvoudig, maar zijn gevoelig voor problemen en vervuiling als ze niet goed gevolgd. Tijdens de parasiet extractie, is het essentieel om saponine lysis voeren verwijderen verontreinigend gastheer erytrocyten. Dit geldt met name tijdens het saponine lysis stap van de RNA-isolatie. De component miRNA van de ontvangende rode bloedcellen verscheidene grootteordes greater dan die van de parasiet, mede door de meeste rode bloedcellen zijn ongeïnfecteerde, dus is het belangrijk om zoveel mogelijk erythrocytaire verontreinigingen te verwijderen. Het is ook belangrijk om de malaria cultuur in gezonde en correcte fase te handhaven (als een specifiek punt in het infectieproces is vereist) een nauwkeurig miRNA profiel te verkrijgen. Ook tijdens de fenol-chloroform extractie, is het van vitaal belang om ervoor te zorgen dat de waterige fasen zijn duidelijk en, zo niet, herhaal dan de fenol-chloroform extractie om alle resterende besmetting te voorkomen.

Ook in het desthiobiotine capture experiment, is het essentieel te elueren met een overmaat aan biotine en de minimale streptavidine korrels gebruiken, zodat een goede specifieke elutie te verzekeren. De elutie van gebonden RNA's door de concurrentie met biotine, in plaats van volledige denaturatie van de korrels zelf, diende aanzienlijk sneller achtergrond RNA verrijking. Tenslotte werd de desthiobiotine capture experiment gewezen op eenis een belangrijke manier om aan te tonen hoe deze miRNAs werden gevangen, maar een aantal andere technieken werden ook gebruikt in de voorgaande studies van deze fusie-RNA's, zoals northern blots en bescherming ribonuclease assays 29 tonen. Dergelijke werkwijzen voor het gebruik van de getransfecteerde microRNA de gewijzigde transcripten te halen, kan bredere toepassing, zoals de zuivering van geassocieerde eiwitcomplexen die het transport en de verwerking van de getransfecteerde miRNAs kan mediëren.

Terwijl verschillende genoom-brede benaderingen zijn gebruikt om de malaria proteoom en transcriptoom 22-25 bestuderen, zijn er weinig manieren om wereldwijd te onderzoeken translationele regulering in P. falciparum 21,26. Deze methodologische beperking zich verzet tegen de globale analyse van de translationele regulering in P. falciparum. Een van de meest voorkomende experimentele benaderingen translationeel regelgeving studeren is polysoom profilering, die de algemene vertaling beoordeeltal activiteit op basis van de ribosomen op specifieke mRNA van belang geladen. Gedetailleerde in dit manuscript is een geoptimaliseerde polysoom profilering methode voor gebruik in malariaparasieten dat zowel de geïnfecteerde erytrocyten en de parasiet binnen lyseert. Vorige methoden heeft de meerderheid van de polysomen niet herstellen en maakte het lijken alsof malariaparasieten niet aanzienlijke populaties van polysomen hebben. Het gebruik van een lysis buffer met een hoge concentratie kaliumacetaat en magnesium maakte het mogelijk om zowel rode bloedcellen en parasieten lyseren terwijl solubiliseren membraangebonden ribosomen voor de daarbij intacte polysomen toestaan.

Deze methode van ribosomale zuivering en profilering rendabel zal helpen om de kloof in de bestaande kennis tussen de malaria transcriptoom en proteoom overbruggen en in staat het genoom-brede analyse van de translationele staat van P. falciparum. Deze benadering is gebruikt om de translatietoestand van de vroege en late stadium b vergelijkLood fase parasieten 28, die strak zijn gecoördineerd genexpressie. Gegevens over de ribosomale laden van transcripten gemakkelijk kunnen worden verkregen en geanalyseerd om de dichtheid van de ribosomen van specifieke mRNA's te bepalen. Bovendien, in combinatie met sorbitol synchronisatie veranderingen ribosomale dichtheid kan worden gebruikt om vast te stellen hoe vertaling in parasiet levenscyclus geregeld. Isolatie van ribosomen deze aanpak vereist een grote hoeveelheid cultuur die helaas beperkt de fasen van de levenscyclus malaria waarin kan worden uitgevoerd. De grote hoeveelheid uitgangsmateriaal zal ook het gebruik ervan te beperken tot zowel in vitro laboratorium stammen van Plasmodium falciparum, en kunnen de toepasbaarheid op andere besmettelijke organismen te beperken. Iedereen die deze procedure ook in staat om te screenen op genen die ongebruikelijk vertaling profielen, met name transcripten die niet zijn geassocieerd met ribosomen, reflecterende alternatieve wijzen van genregulatie tonen. Eindelijk,Deze aanpak zal ons in staat stellen om te evalueren hoe nieuwe antimalariamiddelen invloed eiwit vertalen en te vertalen gebaseerde mechanismen van resistentie tegen geneesmiddelen te identificeren. Deze pijplijn heeft groot nut bij het identificeren en het bepalen van de post-transcriptionele regulatie in veel experimentele systemen.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics