Metoder for å undersøke om forskrifter rolle Små RNA og Ribosomalt Kapasitet av * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den genetiske variasjon som er ansvarlig for sigdcelle allel (HbS) gjør det mulig å motstå erytrocytter infeksjon av malariaparasitten, P. falciparum. Den molekylære basis for denne motstand, som er kjent for å være faktorer, forblir ufullstendig forstått. Nyere studier har funnet at differensial uttrykk for erytrocytt microRNAs, gang translokerte inn malariaparasitter, påvirker både genregulering og parasitt vekst. Disse mirnas ble senere vist seg å hemme mRNA oversettelse ved å danne en kimær RNA transkripsjon via 5 'RNA fusjon med diskrete undergrupper av parasitt mRNA. Her, til teknikker som ble brukt for å studere den funksjonelle rolle og antatte mekanismen bak erytrocytt microRNAs på genregulering og translasjonelle potensialet P. falciparum, herunder transfeksjon av modifiserte syntetiske microRNAs i verts erytrocytter, skal beskrives nærmere. Endelig er en polysome gradient metode som brukes for å fastslå omfanget av translation av disse transkripsjoner. Sammen utgjør disse teknikkene tillater oss å vise at feilregulert nivåene av erytrocytt microRNAs bidra til celle-malaria indre motstand av sigd erytrocytter.

Introduction

Malaria, forårsaket av apicomplexan parasitter av slekten Plasmodium, er den mest vanlige humane parasittsykdom, globalt infiserer omtrent 200 millioner mennesker og forårsaker hvert år rundt 600.000 dødsfall 1. Av de fem Plasmodium arter som infiserer mennesker, den mest relevante for sykdom hos mennesker er P. falciparum og P. vivax, på grunn av deres utstrakte distribusjoner og potensialet for alvorlige malaria komplikasjoner. Livssyklusen til malariaparasitten krever infeksjon av både mygg og mennesker. Når en infisert mygg biter et menneske, parasitter reise gjennom blodet til leveren, hvor en første runde av replikasjon finner sted. Etter merozoitter brudd fra verts hepatocytter, de infisere nærliggende røde blodceller, initiere enten aseksuell eller seksuell replikering. Aseksuell fasen av replikasjon, som varer i 48 timer i P. falciparum, er fokus for denne studien, siden det er både kilden til mest malaria symptomer og enkelt rekapitulert in vitro.

Mens en rekke offentlige helsetiltak, inkludert forbedret anti-malaria behandling, noe har redusert byrden av malaria globalt, presenterer den fortsatte fremveksten av resistente parasitter et problem for malaria kontroll innsats. Et område som kan foreslå nye terapeutiske tilnærminger er studiet av hvordan ulike genetiske varianter gir resistens mot malaria. I malaria-endemiske regioner, en rekke erythrocytisk polymorfismer er ganske vanlig 2,3. Disse mutasjonene, med sigdcelle er kanskje den mest fremtredende, er ofte forbundet med betydelig motstand mot symptomatisk malaria infeksjon fire. De underliggende mekanismer som forårsaker de erytrocytter å motstå malaria er ufullstendig forstått. Parasitized erytrocytter med hemoglobin mutasjoner er gjenstand for økt fagocytose gjennom økt cellulær stivhet og dehydrering, somer forbundet med redusert invasjon av P. falciparum 5. HBC allelet påvirker også protein uttrykk ved erythrocyte overflaten og med ombygging av cytoskjelettet, videre hemme parasitt utvikling 6,7. Til slutt, P. falciparum vokser dårlig innen homozygot sigd (HBSS) erytrocytter 8,9 in vitro, tyder iboende erythrocytisk faktorer av malaria motstand. Imidlertid, mens alle disse mekanismene synes å spille en rolle, er de ikke fullt ut forklare mekanismene bak sigdcelle motstand mot malaria.

En mulig sett erythrocytisk faktorer som fortsatt dårlig forstått er det stor pool av miRNA stede i modne erytrocytter. MicroRNAs er små RNA ikke-kodende, 19-25 nt i størrelse, som medierer oversettelse og / eller stabiliteten av mål mRNA ved baseparing i det 3'-UTR. De har vært innblandet i kontrollen av pattedyrimmunresponser, inkludert undertrykkelse of virusreplikasjon 10, og ble vist å gi resistens mot virus i anlegg De har også vist seg å regulere flere erythrocytisk prosesser, herunder erytropoese 11,12 og jernmetabolismen 13. Tidligere studier identifisert et rikt og mangfoldig befolkning på erythrocytisk mirnas, hvis uttrykket ble dramatisk endret i HBSS erytrocytter 14,15. Siden modne erytrocytter mangler aktiv transkripsjon og oversettelse, den funksjonelle rollen til disse erytrocyttransfusjoner mirnas fortsatt uklart. Som betydelige materielle utveksling oppstår mellom vertscellen og P. falciparum under intraerythrocytic utviklingssyklus (IDC) 16, ble det spekulert i at endret miRNA profil innenfor HBS erytrocytter kan direkte bidra til celle-egenverdi malaria motstand.

Disse studiene til slutt førte til utviklingen av en rørledning for å isolere, identifisere og funksjonelt studere rollen til human miRNA i malaria parasitt, P. falciparum, som indikerte at de vert / menneskelige mirnas slutt kovalent sikringen og deretter translasjonsmessig undertrykke parasitt mRNA transkripter 17. Dette ga et eksempel på det første kryss-arter kimære transkripter som dannes ved trans-spleising, og impliserer at det miRNA-mRNA-fusjons ha oppstått i andre arter, inkludert andre parasitter. Alle trypanosom mRNA er trans-spleiset med en skjøt-leder (SL) for å regulere separeringen av polycistronisk transkripsjoner 18. Siden P. falciparum mangler ortologer for dicer / Ago 19,20, er det mulig at erythrocyte mirnas kapre lignende SL maskiner i P. falciparum å integrere i mål gener. Nyere studier i P. falciparum har nemlig indikerte tilstedeværelse av 5 'spleise-ledersekvenser 21. Denne studien detaljer metodene som førte til oppdagelsen av menneske parasitt miRNA-mRNA fusion transkripsjoner, inkludert både transcriptomic og omregningelle reguleringsteknikk. De overordnede målene for disse metodene er å undersøke effektene av små RNA i genregulering, fenotyper og oversettelse potensialet P. falciparum transkripsjoner.

Den innledende identifisering av menneske parasitt kimere transkripsjoner stoles på bruk av RNA-analyseteknikker, slik som real-time PCR, transkriptomet sekvensering og EST bibliotek fangst, som omfattet både totalt og små RNA, i stedet for å bruke teknikker som bare isolerte små RNA. Isolere alle RNA sammen i en stort basseng, i stedet for separat, tillot identifisering av begge translokerte humane små RNA i parasitten, i tillegg til tilstedeværelsen av disse små RNA-sekvenser som del av en større sekvens. Det kreves da en analyse av tilstanden oversettelsen av disse fusjons mRNA for å bestemme de funksjonelle konsekvenser av disse fusjoner.

Mens omfattende innsats på karakterisering av parasitten genom end transkriptomet har lagt til forståelsen av parasittens biologi 22-25, er langt mindre kjent om translasjonsforskning regulering av mRNA transkriptomet over livssyklusen til P. falciparum 26. Dette begrenset forståelse av parasittens proteom- har hindret både forståelse av parasittens biologi og evnen til å identifisere nye mål for neste generasjon av anti-malaria therapeutics. Dette gapet i forståelsen av parasittens cellebiologi har vedvart i stor grad på grunn av mangel på tilstrekkelige teknikker for å undersøke translasjonsforskning regulering i P. falciparum. En nyere artikkel beskrev bruk av ribosomalt footprinting av P. falciparum for å bestemme den globale oversettelsen status 21. En godt etablert måling av translatorisk potensialet transkripter er antall tilknyttede ribosomer bestemt ved polysome profilering. Når denne teknikken anvendes til P. falciparum </ em>, er det i stand til å gjenopprette de fleste polysomes og fanger hovedsakelig monosomes. Nylig har flere grupper 27,28 optimalisert P. falciparum polysome teknikker ved lyse erytrocytt og parasitten samtidig å bevare polysomes og karakterisere ribosomal belegg og translasjonell potensialet i disse malariaparasitter under aseksuell utvikling i verts røde celler 28.

Kollektivt, disse metodene viser at den observerte fusjon av menneskelige miRNA og parasitt mRNA modulerer parasitt protein oversettelse av disse fusjons mRNA, som ble demonstrert ved hjelp av tidligere rapporterte metoder 27, og er en viktig faktor for malaria motstand i HBA og HBSS erytrocytter 17. Disse metodene vil være nyttig i ethvert system som ønsker å identifisere og funksjonelt utforske RNA spleising hendelser, enten disse fusjons RNA er innenfor P. falciparum eller andre eukaryote systemer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Isolering av små dimensjoner RNA fra P. falciparum Under IDC

  1. Skaff malariaparasitter i aseksuell kultur 29.
    MERK: Den nødvendige kulturen Størrelsen vil variere basert på ønsket program; imidlertid en 10 ml kultur på 3-5% parasittemi og 5% hematokritt gir god RNA for sanntids-PCR (RT-PCR). Teknikken ble opprinnelig optimalisert for asynkrone kulturer, men når bestemte tidspunkter i løpet av infeksjonssyklusen er ønskelig, kan ring-trinns parasitter synkroniseres av sorbitol synkronisering innen 10-12 timer etter invasjon. Synkronisering bør gjentas etter en syklus (ca 48 timer) 29.
  2. Pool infiserte celler sammen (~ 5 x 10 9 RBCs ved 3-5% parasittemi) og fyll kald PBS til toppen av røret, og sentrifuger ved 800 xg i 5 minutter uten brems for å pelletere de røde cellene.
  3. Etter sentrifugering, fjern supernatanten forsiktig med en suge pipette, festettil et vakuum, siden erythrocytisk pellet er lett å løsne. Vask pelleten gang med kald 1 x PBS.
  4. Resuspender cellepelleten i kald 0,15% saponin (i 1 x PBS) og plasser på is i 30 min.
  5. Sentrifuger cellene ved 1500 xg i 12 min ved 4 ° C, fjern supernatanten (som vil bli mørk rød farge) og resuspender pelleten i kald PBS. Gjenta dette trinnet en gang.
    NB: For å sikre at microRNAs tilstede var reflektert av microRNAs innenfor parasitter, og ikke erythrocytisk forurensning, ble en rekke parasitter isoleringsforhold testet: 1) saponin lysis, 2) saponin lyse kombinert med RNaseA behandling av vertscelle miRNAs og 3 ) metyl-beta-cyklodekstrin behandling for å fjerne parasitter fra verten erytrocytt. Alle behandlinger ga lignende resultater.
  6. Lyse den isolerte parasitten pellet ved hjelp av de anbefalte 600 ul lyseringsbuffer. Dette volumet av lyseringsbuffer er tilstrekkelig for kulturer opp til ~ 30 ml på 2% hematokritt og 5% parasittemi.
    MERK: For større parasitt kulturer, kan dette volumet økes. Det er viktig å sikre fullstendig lysis av parasitten pellet ved grundig virvling i minst 1 min. Også for å lette ekstraksjon, de lyserte prøver kan bli overført til et 1,7 ml mikrosentrifugerør.
  7. Legg 60 ul, eller 1/10 av volumet av lyseringsbuffer anvendt i trinn 6, fra homogenat additiv (2 M natriumacetat, pH 4).
  8. La prøvene på is i 10 min.
  9. Legg 600 pl, eller et volum svarende til mengden av lyseringsbuffer tilsatt i trinn 6, av syre fenol choloroform til hver prøve og virvle i 1 min.
  10. Separer den vandige og organiske faser ved sentrifugering av prøvene ved 10 000 xg i 5 minutter. Dette spinn er lengre enn den som foreslått av settet for å sikre at alle hemoglobin / hemozoin er i den organiske fase.
  11. Samle øvre (vandige) sjikt og overføre den til et nytt rør. Gjenta trinn 9 og 10 hvis vandige fase er hvit eller (mer sannsynlig) brun i farge, noe som antyder protein forurensning.
  12. Bestemme volumet av den resulterende supernatant ved hjelp av pipette og deretter legge 1,25 volumer 100% etanol (~ 800 ul) og bland ved å snu 1,7 ml mikrosentrifugerør 5 ganger.
  13. Passere hver prøve gjennom et gitt RNA-bindende filterpatron (flere forskjellige av disse er tilgjengelige i handelen) ved enten sentrifugering ved 14 000 x g i 1 min, eller ved hjelp av en vakuum-manifold.
  14. Vask filterpatron med 700 ul av vaskebuffer miRNA en ved hjelp av en mikrosentrifuge, spinning ved 14 000 xg i 1 min.
  15. Vask filterpatron med 500 ul vaskebuffer 2/3 to ganger ved sentrifugering ved 14 000 xg i 1 minutt hver.
  16. Elute RNA med 100 ul DEPC-vann, som er blitt forvarmet til 95 ° C, i to vaskinger på 50 ul, sentrifugering ved 14 000 xg i 1 minutt hver. Måle konsentrasjonen av RNA via UV-absorbans ved 260 nm.
    MERK: En RNA gel (enten TBE-urea akrylamid eller denaturering formaldehyd agarosegel) kan be brukt for å vurdere størrelsesfordelingen av de isolerte RNA.
    MERK: Dette RNA er egnet for analyse av microarray, RNA-sekvensering, nordlige blot og ribonuklease beskyttelsestest.

2: Kvantifisering av små dimensjoner RNA fra P. falciparum Under IDC

  1. Bestemme konsentrasjonen av individuelle prøver isolert i trinn 1 ved hjelp av UV-spektrofotometri ved 260 nm.
  2. Generere sanntid PCR primere for de ønskede RNA arter. For miRNA alene, brukte vi forhåndslagde miRNA qPCR analyser, mens for mRNA eller fusjon miRNA-mRNA vi utviklet primere for SYBR grønt. For fusjons RNA, foroverprimeren var miRNA-sekvensen i seg selv (Mir-451: AAACCGTTACCATTACTGAGTT), mens det motsatte var en gen-spesifikk primer ~ 100 bp nedstrøms for miRNA i mRNA-sekvens (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Gjør cDNA fra RNA prøver ved hjelp av enten en hårnål primer for mirnas (bruker 20-40 ng RNA) alene eller tilfeldige heksamerer for mRNA og / eller miRNA-mRNA fusion arter (ved hjelp av en mikrogram av RNA). Bland RNA og primere i 5 min ved 65 ° C, deretter avkjøles til romtemperatur. Etterpå legger revers transkriptase mix (0,5 ul revers transkriptase, 0,5 mL RNase inhibitor, 1 pl dNTPs (2,5 mm hver), 4 pl 5x buffer, 2 ul 0,1M DTT, 1 mL H 2 O).
    1. Kjør prøver på en termo stand til å oppdage enten SYBR grønn eller TaqMan prober. SYBR grønn kvantitativ PCR 30 for spesifikke gener ble drevet som en tre-trinns PCR, 95 ° C i 15 sek, laveste primer glødetemperaturen minus 5 ° C i 30 sekunder og 68 ° C i 30 sek, for 40 sykluser under anvendelse av en kommersiell SYBR grønn mester mix. miRNA real-time PCR ble utført som en to-trinns PCR, 95 ° C i 15 sekunder og 60 ° C i 1 minutt, 40 sykluser.
    2. Kvantifisere analyser ved hjelp av ΔΔCt metode og normalisere dem mot enten Rab GTPase (PF08_0110) eller 18S rRNA 31.

3: Introduksjonav Small RNA inn malariaparasitter

  1. Pellet 300 ul av røde blodceller pr transfeksjon (250 mL av RBC, ca. 1,5 x 10 9 celler, til slutt vil bli anvendt) i fullstendig malaria medium ved sentrifugering ved 800 xg i 5 minutter ved en brems.
  2. Vaske erytrocyttene to ganger med RPMI og resuspendert i fullstendig cytomix (120 mM KCl, 0,15 mM CaCl2, 10 mM K-2 HPO 4 / KH 2PO 4, pH 7,6, 25 mM HEPES, pH 7,6, 2 mM EGTA, pH 7,6; 5 mM MgCl2, pH justert med KOH) ved 50% hematokritt etter sentrifugering ved 800 xg i 5 minutter ved en brems.
  3. Overfør cellene til en 0,2 cm kyvette elektroporering.
  4. Tilsett 10 mikrogram, eller passende mengde, av tilpassede syntetiske oligonukleotider til kyvettene og resuspender kulturer.
  5. Juster electroporator til 310 V / 950 uF og leverer en puls for hver kyvette.
  6. Suspender 300 ul RBC innen kyvetten i forvarmet komplett malaria media og plate dem i 24 brønners plater og inkuberes ved 37 ° C i en lufttett beholder med malaria blodgassblanding (3% O2, 5% CO2).
  7. Etter 4 timer, infisere Transfekterte RBC med synkroniserte sene trophozoites til en omtrentlig endelig parasitemia på 1%.
  8. Legg ferskt transfekterte RBC hver 4-6 dager å infiserte kulturer og bestemme% parasittemi ved FACS hjelp YoYo-en flekker, som angitt i § 4.

4: Bestemmelse av Erythrocyte microRNAs Effect Ved parasitt infeksjon rate

  1. Ta 100 ul resuspenderte kultur ved mikropipette og plasser i en 1,7 ml mikro tube. Vask to ganger med 1 ml av 1 x PBS og sentrifuger i en mikrosentrifuge bord ved sentrifugering ved 800 xg i 5 minutter.
  2. Resuspender pellet i 1 ml 0,025% glutaraldehyd. Inkuber prøvene i 20 min ved RT.
    MERK: Prøvene kan oppbevares her i flere uker ved 4 ° C. Etterpå pellet den infiserte RBCs ved sentrifugering ved 800 xg i 5 min. Vask to ganger med 1 ml 1x PBS.
  3. Resuspender pellet i 1 ml 0,015% saponin. Inkuber ved 4 ° C i 15 min. Pellet infisert RBC ved sentrifugering ved 800 xg i 5 minutter. Vask to ganger med 1 ml 1x PBS. Repeat.4.3. Resuspender celler i 1 ml 1x PBS som inneholder en fil (1,000X) DNA flekken.
  4. Bestem grader av parasitemia på et flowcytometer, ved 488 nM eksitasjon, og ~ 530 nM (FL-1) utslipp.
  5. Først gate flowcytometer basert på FSC og SSC å fokusere på RBC. Deretter måler grader av parasitemia (infisert RBC) i gated RBC ved fluorescens i en FL-kanal.
    MERK: senere stadium parasitter er 10X mer fluorescerende enn tidligere stadium parasitter, og ~ 100X ovenfor uinfiserte RBC. Også oppsamling ved lav hastighet har en tendens til å redusere støy. Endelig har denne tilnærmingen blitt sammenlignet med 3 H-hypoxantin inkorporering og Giemsa-farging, både som rapportert tidligere 13, og alle teknikker GAVe lignende resultater.

5: Biotin-tagging og Elusjon av miRNA-mRNA Fusion Produkter

  1. Direkte bestille tilpassede syntetiske RNA oligonukleotider med desthiobiotin (DB) kovalent knyttet til 5 'enden.
  2. Transfisere uinfiserte RBC med desthiobiotin-konjugert (DB) miRNA og umodifisert miRNA (negativ kontroll), som angitt i trinn 3.
  3. Infisere transfekterte RBC med P. falciparum parasitter til et utgangs parasitemia på 0,5% (trinn 1.1).
  4. Ekstraher parasitt RNA 4 dager (96 timer senere), som beskrevet ovenfor i trinn 1.
  5. Inkuber 10 ug parasitt RNA med 50 ul streptavidin pakkede kuler, tilsettes via mikropipette, og roterer på et mikrosentrifugerør rotator i 1 time ved 4 ° C.
  6. Pellet perlene ved 800 xg i 30 sek, og vask med 20 mM KCl og 1/1000 RNase inhibitor.
  7. Elute RNA fra perlene av konkurranse med 2 mM biotin og med 200 mL RNA-fangst elueringsbuffer (20 mM KCl, 1/1000 RNase Inhibitor og 2 mm biotin) ved 4 ° C over natten med rotasjon.
  8. Fastslå graden av anriking av indikert P. falciparum transkripsjoner bruker SYBR grønn QRT-PCR, og mikroRNA berikelse (positiv kontroll) av TaqMan qPCR som angitt i trinn 2.

6: Polysome Separasjon fastslår Ribosomalt Kapasitet av P. falciparum

  1. Plasser 5 ml 15% sukrose-oppløsning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 mM cykloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitor, og 15% sukrose ) i et SW41 ultrasentrifugerør (14 x 89 mm).
  2. Ved hjelp av en 5 ml sprøyte, tilsett 5 ml 50% sukrose-oppløsning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 mM cykloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase hemmer, og 50% sukrose) under 15% sukrose ved hjelp av en lang nål, og fjern nålen.
  3. Etter 2 timer, sakte vippe røret tilbake oppreist og overføre røret til is, slik at den avkjøles i minst 15 min før prøve lasting (trinn 14).
  4. Samle nok Plasmodium -infected blod trinnet kultur for å generere 100-500 mikrogram av total RNA, eller omtrent en 100 ml asynkron kultur på 3-5% parasittemi. Legg 1/10 det volum av kulturmedium inneholdende 10 x (2 mM) cykloheksimid (CHX) og inkuber ved 37 ° C i 10 min.
    1. Pellet kulturene ved sentrifugering ved 500 x g i 7 min ved sentrifuge (brems 1), vask deretter to ganger med romtemperatur 1 x PBS inneholdende 200 uM CHX. Suspender parasitten kulturer i 1x PBS som inneholder 200 mikrometer CHX og lagre på is.
    Estimere volumet av RBC-pellet. Legg lyseringsbuffer (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 mM CHX ', 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630, og 0,5% (vekt / volum) DOC) til RBC-pellet til et sluttvolum på 4,25 ml. Inkuber løsningen ved 4 ° C i 10 minutter mens den roterer.
  5. Overfør lysatet til mikrosentrifugerør og sentrifuger deretter prøvene i en mikrosentrifuge ved 16 000 xg og 4 ° C i 10 min.
  6. Forbered sukrose puter ved å pipettere 1,25 ml kald 0,5 M sukrose pute-oppløsning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 mM cykloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, og 0,5 M sukrose) i et SW55 ultrasentrifugerør (13 x 51 mm).
  7. Nøye lag 3,75 ml lysat supernatant (fra trinn 7) på toppen av sukrose puten ved hjelp av en sprøyte og små (~ 27) gauge nål. Store gjenværende lysat (~ 500 mL) ved -80 ° C for å ekstrahere total-RNA-nivå, som angitt i punkt 1.
  8. Laste prøvene inn i en ultrasentrifuge rotor, pre-kjølt til 4 ° C, som kan holde 13,2 ml rør. Sentrifuger prøvene ved 366 000 xg og 4 ° C i 146 min.
  9. Ved hjelp av en pipette, overføre supernatanten til en 15 ml konisk tube. Oppbevar supernatanten ved -80 ° C for RNA-isolering av fri (ubundet av ribosomer) RNA.
  10. Resuspender ribosomet pellet i 500 mL av ribosom resuspensjon buffer (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 mM cykloheksimid, 1 mM DTT, 1 mM PMSF, og 40 U / ml RNase inhibitor) ved pipettering i 5 min.
  11. Sentrifuger prøvene i en mikrosentrifuge ved 16 000 xg og 4   ° C i 10 min.
  12. Samtidig som gradient fra trinn # 4 på isen, fjern Parafilm, deretter forsiktig lag ribosomet suspensjon på toppen av gradient USIng en sprøyte og små (~ 27) gauge nål.
  13. Installering av røret i en på forhånd avkjølt ultrasentrifuge rotor og sentrifugere det belastede gradientene ved 200.000 xg og 4 ° C i 180 min. Når spinningen er fullført, lagre sentrifugeres gradienter ved 4 ° C til den er klar til å laste inn fraksjonatoren.
  14. Laster inn en tom ultrasentrifugerør inn i fraksjonerings gradient (dette kan være et rør som benyttes i en tidligere kjøring), vask deretter med RNase-fritt vann i 5 minutter ved 100 x 10 hastighet.
  15. Under vasketrinnet i 6,16, sett følsomheten av UV-absorbans-detektor. Et godt utgangspunkt følsomhet er 0,2, men dette kan justeres i senere renner avhengig A 254 signal (som varierer basert på parasitt nummer, etc.).
  16. Når detektoren følsomhet er angitt, angir referansesignalet til null, mens vannet strømmer gjennom detektoren.
  17. Etter vasking av fraksjonssamler, reversere fluidstrømmen til linjene er tomme og deretter remOve den tomme ultrasentrifugerør.
  18. Kjør 60% sukroseløsning gjennom fraksjoneringsinnretningen inntil det kommer ut av nålen apparat.
  19. Sett røret som inneholder den første gradient på toppen av lasterommet og stram segl, tar seg ikke å over-stramme. Deretter stikke hull på bunnen av røret med nålen.
  20. Tilbakestill fluidumstrømmen hastigheten til 12,5 x 10 (kontrollert av strømningshastighet kontrollknappen på forsiden av pumpen), og deretter sette den automatiserte fraksjonssamleren å samle 18 sek fraksjoner (~ 330 mL / fraksjon) i Mikrosentrifugerør.
  21. Start fremover strømningen av 60% sukroseløsning.
  22. Når den første dråpe av gradient løsning faller inn i mikrosentrifugerør, umiddelbart begynne både brøkdel innsamling og liveopptak av A 254 signal.
  23. Når et kraftig fall er observert i A 254 signal, som svarer til grenseflaten mellom 50% og 60% sukrose-løsninger, stoppe både fluidstrømning og A 254
  24. Oppbevar gradient fraksjoner ved -80   ° C for senere bruk.
  25. Reversere fluidstrømmen ved 100 x 10 hastighet til 60% sukroseløsning tømmer ut av ultrasentrifugerør.
  26. Hvis det er flere gradienter å fraksjonere, fjern den tomme ultrasentrifugerør fra lasterommet og starte på nytt fra trinn 6.21. Dersom alle prøvene er fullført, vaskes apparatet som ble utført i trinnene 6.16 og 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Global profilering av menneskelig mikroRNA i P. falciparum

Teknikkene er presentert her ble anvendt for å ekstrahere microRNAs fra parasitter i en rekke forhold. En ting å merke seg er at RNA ekstraksjon for uinfiserte RBC ble utført som angitt i 32, som ofte fungerte som et referansepunkt for de mikroRNA data presentert i både denne artikkelen og den opprinnelige studien 29. De tidligere studier også vist at HBSS erytrocytter besatt langt høyere nivåer av visse mirnas, Mir-451 spesielt. De teknikker som er angitt ovenfor var tilstrekkelig til å påvise endringer i miRNA overflod i HBS (HBA eller HBSS) infiserer parasitter. RNA prøver ble ekstrahert som angitt ovenfor og normalisert mot 18S rRNA. Parasitt prøver fra HBSS RBC, for eksempel, viser en betydelig økning i nivåene av flere microRNAs, deriblant Mir-451 (Figur 1). Opptaket av miRNA fra verten erythrocyte er også konsistent med tidligere studier 34,35.

Transfeksjon av HbAA erytrocytter med Mir-451 økt HbAA Mir-451 til nivåer tilsvarende HBSS erytrocytter (figur 1). Strømningscytometri ble deretter brukt til å måle parasitt infeksjon, for å vurdere effekten av miRNA translokasjon ved parasitt vekst. Basert på det, HbAA erytrocytter transfektert med Mir-451, Mir-223 og Mir-181a, sammen med en ssDNA oligo, ble undersøkt for effekter av microRNAs ved parasitt vekst. Transfeksjon av ssDNA eller Mir-181a ikke hadde noen virkning på parasitemia (figur 2A - D), mens transfeksjon med Mir-451 reduseres markert parasittemi, som kan avhjelpes bare ved ko-transfeksjon av et antisense Mir-451 oligo.

Blokkering av microRNAs ved transfeksjon av 2'-O-Me antisense microRNAs demonstrert en gjensidig effekt. HBSS erytrocytter, med naturlig høyere Mir-451 nivåer, ble transfektert med antisense Mir-451 eller 2'-O-metyl- oligonukleotider (figur 3). Hemming av Mir-451 økt parasitt vekst både HBSS erytrocytter (Figur 3C - F). Parasitt prosenter ble beregnet fra minst 3 uavhengige transfeksjoner, så gjennomsnittsberegnet og presentert som gangers endring relativt til HBSS vekst (figur 3F).

Fangst av miRNA-mRNA fusion RNA av biotin fangst assay

Etter transfeksjon av 5'-desthiobiotin-Mir-451 (5'Db-Mir-451) og 5'Db-Mir-181, som indikert i metoder § 5, ble det fastslått at den observerte miRNA sekvens oppsto med menneskelig mikroRNA. QRT-PCR-analyse indikerte at transfeksjon av 5'Db-Mir-451 resulterte i anriking av PKA-R-fusjons transkripter (figur 4).

Polysome separasjon å bestemme ribosomal belegg på P. falciparum

telt "> En typisk A 254 kontur er vist i figur 5A (med nord bekreftelse av rRNA-innhold i figur 5B), og fraksjonen tettheten øker fra venstre til høyre på diagrammet (dvs. lettere fraksjoner til venstre). Den innledende A 254 er ganske høye på grunn av absorpsjon av hemoglobin i de tidlige fraksjonene, men raskt synker til grunnlinjen. Den første lille topp tilsvarer den lille ribosomale subenhet (40S), raskt etterfulgt av den andre topp, som er litt større, og tilsvarer den store ribosomale subenhet (60S). Den tredje topp, som generelt er den største for P. falciparum, svarer til monosome peak (80S). På grunn av sin høyde, bør 80S brukes som en guide for å justere følsomheten av UV-detektoren for påfølgende runs (trinn 6.17). Også på grunn av størrelsen på 80S topp, er det vanlig at 60S signal å viske ut som en "skulder" i starten av monosome topp, hvis begge 60S og 80Ssignaler er store.

Etter monosome peak er toppene som tilsvarer polysomes. Hver etterfølgende topp representerer en polysome fraksjon som representerer progressivt større tall av ribosomer (2, 3, 4, etc.). Hver polysome topp er også mindre enn den forrige topp, minkende i høyde med 2-3 ganger med hver påfølgende polysome nummer. Typiske løper vil tillate oppløsning av polysomes sammensatt av 5-7 ribosomer, selv om oppløsning av opp til en 9-mer polysome er blitt observert i noen forsøk med en stor mengde av utgangsmateriale. Høyere ordre polysomes komponere resten av kurven, og kan ikke løses under disse graderings forhold.

Figur 1
Figur 1: MiR-451 er forhøyet i HBSS erytrocytter Intraparasitic Mir-451 nivåer, som bestemmes av real-time PCR og normalisert mot 18S rRNA, fra parasitter isolert fra angitt.erytrocyttantigener typer. Verdier er gjennomsnitt ± SE.

Figur 2
Figur 2: Overuttrykte Mir-451 i normal erytrocytter hemmer parasitt vekst (A - C) Representant FACS tomter som indikerer infeksjon priser, i prosent av totale RBC, indikeres med m1, for de viste erythrocyte typer.. (D) Composite infeksjonsrater avledet fra FACS og normalisert mot utransfekterte HbAA RBC. Verdier i panelet AC er representative FACS tomter mens D er gjennomsnitt ± SE.

Figur 3
Figur 3:. Hemming av Mir-451 i sigdcelle erytrocytter løfter parasitt vekst (A - E) Representant FACS tomter som indikerer infeksjon priser, i prosent av totale RBC, indikeres med m1, for vist erythrocyte typer. (F) Composite infeksjonsrater avledet fra FACS og plottet som en normalisert verdi mot utransfekterte HbAA RBC. Verdier i panelet AE er representative FACS tomter, er F gjennomsnitt ± SE.

Figur 4
Figur 4: Transfeksjon av Mir-451 beriker for PKA-R fusion transkripsjoner og viser at den smeltet miRNA er erythrocytisk opprinnelse Enrichment av de angitte desthiobiotin-konjugert miRNA-mRNA fusion transkripsjoner som har blitt fanget av streptavidin.. -Verdier ble målt ved anvendelse av sanntids-PCR og plottet som en relativ verdi i forhold til ikke-transfekterte parasitter. Verdier er gjennomsnitt ± SE.

Figur 5
Figur 5:. Parasitt ribosomer kan isoleres via sukrosegradient (A - B) example spor av en polysome profil hentet fra Plasmodium falciparum. (A) Spor av en polysome profil hentet fra Plasmodium falciparum, med 40S, 60S, 80S og Polysome topper (med # s indikerer antall ribosomer assosiert) vises. (B) Northern blot av 18S og 28S rRNA tvers av ribosomale fraksjoner. Verdier er gjennomsnitt ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS er en av de mest vanlige hemoglobinvarianter i malaria endemiske områder, i stor grad fordi den gir beskyttelse mot alvorlig malaria forårsaket av P. falciparum. Teknikkene som er nødvendig for å karakterisere rollen til human mikroRNA i genregulering av P. falciparum er detaljert gjennom dette manuskriptet. Ved å ekstrahere total-RNA på en slik måte at det omfatter alle små RNA, og ved å utføre en relativt grei parasitt lyse prosedyre disse fusjons RNA var i stand til å bli identifisert ved en rekke uavhengige teknikker.

Disse trinnene er relativt grei, men er følsomme for problemer og forurensning hvis ikke fulgt skikkelig. I løpet av parasitten ekstraksjonen, er det avgjørende å utføre saponin lysering for å fjerne forurensende verts erytrocytter. Dette er spesielt sant i løpet av saponin lysis trinn av RNA-isolering. MiRNA komponent av verts røde blodlegemer er flere størrelsesordener greater enn for parasitten, delvis på grunn av de fleste røde blodcellene er uinfisert, så det er viktig å fjerne så mye erythrocytisk forurensning som mulig. Det er også viktig å opprettholde malaria kultur i et sunt og riktig trinn (hvis et bestemt punkt i infeksjonssyklusen er nødvendig) for å oppnå en nøyaktig miRNA profil. Tilsvarende under fenol-kloroform avstamning, er det svært viktig å sørge for at vannfasene er klare, og hvis ikke, gjenta fenol-kloroform ekstraksjon for å unngå eventuelle gjenværende forurensning.

Også i desthiobiotin fangst eksperimentet, er det avgjørende å eluere med et overskudd av biotin, og å benytte et minimum av streptavidin perler, for derved å sikre riktig spesifikk eluering. Elueringen av bundne RNA gjennom konkurranse med biotin, i stedet for fullstendig denaturering av kulene selv, tjente til å dramatisk redusere bakgrunnen RNA berikelse. Til slutt ble desthiobiotin fangst eksperiment markert ener en viktig måte å vise hvordan disse mirnas ble fanget opp, men flere andre teknikker ble også anvendt i de foregående studier for å demonstrere disse fusjons RNA, slik som Northern blot og ribonuklease beskyttelses assays 29. Slike metoder for anvendelse av de transfekterte microRNAs å hente de modifiserte transkriptene kan ha bredere anvendelse, for eksempel rensing av tilknyttede proteinkomplekser som kan formidler transport og behandling av de transfekterte miRNAs.

Mens ulike genom-wide tilnærminger har blitt brukt til å studere malaria proteomet og transkriptom 22-25, er det få metoder til globalt undersøke translasjonsforskning regulering i P. falciparum 21,26. Denne metodiske begrensninger utelukker global analyse av translasjonsforskning regulering i P. falciparum. En av de mest vanlige eksperimentelle tilnærminger for å studere translasjonell regulering er polysome profilering, som vurderer totale oversettelsenal aktivitet basert på ribosomene lastet inn på spesifikke mRNA av interesse. Detaljert i dette manuskriptet er en optimalisert polysome profilering metode for bruk i malariaparasitter som lyserer både smittet erytrocytt og parasitten innenfor. Tidligere metoder ikke gjenopprette de fleste av polysomes og gjort det virke som om malariaparasitter ikke har betydelige bestander av polysomes. Bruken av en lyseringsbuffer med en høy konsentrasjon av kaliumacetat og magnesium har gjort det mulig å lyse både røde blodceller og parasitter, mens oppløseliggjøre membranbundne ribosomer for å tillate opptak av intakte polysomes.

Dette kostnadseffektiv metode for ribosomal rensing og profilering vil bidra til å bygge bro over gapet i eksisterende kunnskap mellom malaria transkriptom og proteom og aktivere genom-wide analyse av translasjonsforskning delstaten P. falciparum. Denne fremgangsmåten har blitt brukt til å sammenligne tilstanden oversettelse av den tidlige og sene trinn blood scenen parasitter 28, som har tett koordinert genuttrykk. Data om det ribosomale lasting av transkripter lett kan fremstilles og analyseres for å bestemme tettheten av ribosomer på spesifikke mRNA. Videre, når kombinert med sorbitol synkronisering, forandringer i ribosomalt tetthet kan benyttes for å fastslå hvordan oversettelses reguleres gjennom hele parasitten livssyklus. Isolering av ribosomer som bruker denne tilnærmingen krever en stor mengde av kulturen, som dessverre begrenser stadier av malaria livssyklus der det kan utføres. Den store mengden av innsatsmateriale vil også begrense bruken både in vitro laboratorie stammer av Plasmodium falciparum, og kan begrense dens anvendbarhet til andre infeksiøse organismer. Alle som bruker denne prosedyren vil også være i stand til å screene for gener som viser uvanlige oversettings profiler, spesielt transkripsjoner som ikke er forbundet med ribosomer, reflekterer alternative moduser av genregulering. Endelig,denne tilnærmingen vil gjøre oss i stand til å vurdere hvordan nye antimalariamidler påvirke protein oversettelse og å identifisere oversettingsbaserte mekanismer for resistens. Denne rørledningen har stor nytte i å identifisere og bestemme post-transcriptional regulering i mange eksperimentelle systemer.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics