Metoder til undersøgelse af Regulatory rolle små RNA og Ribosomal Belægning af * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den genetiske variation er ansvarlig for seglcelle-allelen (HB) giver erythrocytter til at modstå infektion med malariaparasitten, P. falciparum. Den molekylære basis for denne modstand, som er kendt for at være multifaktoriel, forbliver ufuldstændigt forstået. Nylige undersøgelser fandt, at forskellen udtryk for erythrocyt microRNA'er, når omplantede i malariaparasitter, påvirker både genregulering og parasit vækst. Disse miRNA blev senere vist sig at hæmme mRNA translation ved at danne en kimære RNA udskrift via 5'-RNA fusion med diskrete undergrupper af parasit mRNA. Her til de teknikker, der blev brugt studere den funktionelle rolle og formodede mekanisme bag erythrocyt microRNA på genregulering og translationel potentiale P. falciparum, herunder transfektion af modificerede syntetiske microRNA ind i værtsceller erytrocytter, vil blive nærmere beskrevet. Endelig er en polysom ​​gradient anvendt til at bestemme omfanget af translation af disse transkripter. Sammen disse teknikker tilladt os at vise, at de dysregulerede niveauer af erythrocyt microRNA'er bidrager til celle-iboende malaria modstand segl erytrocytter.

Introduction

Malaria forårsaget af Apicomplexan parasitter af slægten Plasmodium, er den mest almindelige humane parasitsygdom, globalt inficerer ca. 200 millioner mennesker hvert år og forårsager omkring 600.000 dødsfald 1. Af de fem Plasmodium arter, der inficerer mennesker, den mest relevante for human sygdom er P. falciparum og P. vivax, på grund af deres udbredte distributioner og potentiale for alvorlige malaria komplikationer. Livscyklus malariaparasitten kræver infektion af både myg og mennesker. Når en inficeret myggestik et menneske, parasitterne rejse gennem blodbanen til leveren, hvor en første runde af replikation finder sted. Efter merozoiter brud fra værten hepatocyt, de inficerer nærliggende røde blodlegemer, indledning enten ukønnede eller seksuel replikation. Ukønnet replikationsstadium, som varer 48 timer i P. falciparum, er fokus for denne undersøgelse, da det er både kilden til de fleste malaria symptomer og let sammenfattet in vitro.

Mens en række offentlige sundhedstiltag, herunder forbedrede anti-malaria behandlinger, noget har reduceret byrden af ​​malaria globalt, den fortsatte fremkomst af lægemiddelresistente parasitter udgør et problem for malaria kontrolindsats. Et område, der kan foreslå nye terapeutiske fremgangsmåder er undersøgelse af, hvordan forskellige genetiske varianter giver resistens over for malaria. I malaria-endemiske områder, en række erythrocytiske polymorfier er helt almindelige 2,3. Disse mutationer, med seglcelle er måske den mest fremtrædende, er ofte forbundet med en betydelig modstand mod symptomatisk malariainfektion 4. De underliggende mekanismer, som de forårsager erythrocytter at modstå malariainfektion er ufuldstændigt forstået. Parasitized erytrocytter med hæmoglobin mutationer er underlagt forstærket fagocytose gennem øget cellulær stivhed og dehydrering, somer forbundet med nedsat invasion af P. falciparum 5. HBc allelen påvirker også proteinekspression på erythrocyt overflade og med ombygningen af cytoskelettet, yderligere inhibering parasit udvikling 6,7. Endelig P. falciparum vokser dårligt inden homozygot seglcelle (HBSS) erythrocytter 8,9 in vitro, hvilket tyder på iboende erythrocytiske faktorer af malaria modstand. Men mens alle disse mekanismer synes at spille en rolle, at de ikke fuldt ud forklare mekanismerne bag seglcelle resistens over for malaria.

Et potentielt sæt erythrocytiske faktorer, der forbliver dårligt forstået er den store pulje af miRNA stede i modne erythrocytter. MikroRNA'er er små ikke-kodende RNA'er, 19-25 nt i størrelse, der medierer oversættelse og / eller stabiliteten af ​​mål-mRNA'er ved baseparring i 3'UTR. De er blevet impliceret i kontrollen af ​​mammale immunreaktioner, herunder suppression of virusreplikation 10, og viste sig at give resistens over for virus i planter De har også vist sig at regulere flere erythrocytiske processer, herunder erythropoiese 11,12 og jern metabolisme 13. Tidligere undersøgelser identificeret en rigelig og varieret bestand af erythrocytiske miRNA, hvis ekspression blev dramatisk ændret i HBSS erythrocytter 14,15. Da modne erythrocytter mangler aktive transskription og translation, den funktionelle rolle af disse erythrocyt miRNA fortsat uklart. Som betydelig materiel udveksling forekommer mellem værtscellen og P. falciparum under intraerythrocytic udviklingsmæssige cyklus (IDC) 16, blev det spekuleret på, at ændret miRNA profilen HBs erythrocytter kan bidrage direkte til celle-intrinsisk malaria modstand.

Disse undersøgelser førte i sidste ende til udviklingen af ​​en rørledning til isolation, identifikation og funktionelt undersøge den rolle af humant miRNA inden for malaria parasit, P. falciparum, hvoraf det fremgik, at de pågældende vært / menneskelige miRNA i sidste ende kovalent sikringen og derefter translatorisk undertrykke parasit mRNA-transkripter 17. Dette gav et eksempel på de første cross-arter kimære udskrifter dannet af trans-splejsning, og implicerer, at denne miRNA-mRNA fusion være opstået i andre arter, herunder andre parasitter. Alle trypanosominfektion mRNA er trans-splejset med en splejsning-leder (SL) til at regulere adskillelsen af polycistroniske udskrifter 18. Da P. falciparum mangler orthologer for Dicer / Ago 19,20, er det muligt, at erythrocyt miRNA kapre lignende SL maskiner i P. falciparum at integrere i målgener. Nylige undersøgelser i P. falciparum har rent faktisk indikerede tilstedeværelsen af 5 'splejsnings ledersekvenser 21. Denne undersøgelse beskriver de metoder, der førte til opdagelsen af ​​menneskelige-parasit miRNA-mRNA fusion udskrifter, herunder både transkriptom og oversætnale regulering teknikker. De overordnede mål for disse metoder er at undersøge virkningerne af små RNA i genregulering, fænotyper og oversættelse potentiale P. falciparum udskrifter.

Den oprindelige identifikation af humane-parasit kimære udskrifter påberåbes brugen af ​​RNA-analyse teknikker, såsom real-time PCR, transkriptom sekventering og EST bibliotek opsamling, som omfattede både totale og små RNA, snarere end at bruge teknikker, som kun isolerede små RNA. Isolering alle RNA sammen i en stor pulje, snarere end separat, tillod identificering af begge translokeres humane små RNA'er i parasitten samt tilstedeværelsen af ​​disse små RNA-sekvenser som del af en større sekvens. Dette krævede derefter en analyse af oversættelsen tilstand disse fusion mRNA'er vurderes de funktionelle konsekvenser af disse fusioner.

Mens omfattende indsats på karakterisering af parasitten genom end transkriptom har føjet til forståelsen af parasittens biologi 22-25, er langt mindre kendt om translationel regulering af mRNA transkriptomet tværs livscyklus P. falciparum 26. Denne begrænsede forståelse af parasittens proteom har hindret både forståelse af parasittens biologi og evnen til at identificere nye mål for den næste generation af anti-malaria terapi. Dette hul i forståelsen af parasittens cellebiologi har varet i høj grad skyldes manglen på passende teknikker til at undersøge translationel regulering i P. falciparum. En nylig undersøgelse beskrev anvendelsen af ribosomale fodaftryk af P. falciparum at bestemme den globale oversættelse status 21. En veletableret måling af translationel potentiale transkripter er antallet af associerede ribosomer bestemmes af polysom ​​profilering. Men når denne teknik anvendes til P. falciparum </ em>, ikke er i stand til at inddrive de fleste polysomer og indfanger overvejende monosomer. For nylig har flere grupper 27,28 optimeret P. falciparum polysom ​​teknikker ved at lysere erythrocyt og parasitten samtidig at bevare polysomerne og karakterisere det ribosomale belægning og translationel potentiale i disse malaria parasitter under deres aseksuelle udvikling i værtens røde blodlegemer 28.

Kollektivt, disse metoder viser, at den observerede fusion af humane miRNA og parasit mRNA modulerer parasit proteintranslation af disse fusion mRNA, som blev demonstreret ved hjælp af tidligere rapporterede metoder 27, og er en vigtig faktor for malaria modstand i HBA'er og HBSS erythrocytter 17. Disse metoder ville være nyttig i ethvert system søger at identificere og funktionelt udforske RNA splejsningsbegivenheder, om disse Fusion RNA'er er inden P. falciparum eller andre eukaryote systemer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Isolering af små RNA fra P. falciparum Under IDC

  1. Opnå malariaparasitter i ukønnet kultur 29.
    BEMÆRK: Den nødvendige kultur størrelse vil variere baseret på den ønskede anvendelse; imidlertid en 10 ml kultur på 3-5% parasitæmi og 5% hæmatokrit giver rigelig RNA til realtids-PCR (RT-PCR). Teknikken blev oprindeligt optimeret til asynkrone kulturer, men når specifikke tidspunkter under infektionen cyklus ønsket kan ring-stadie parasitter synkroniseres af sorbitol synkronisering senest 10-12 timer efter invasion. Synkronisering bør gentages efter en cyklus (ca. 48 timer) 29.
  2. Pool-inficerede celler sammen (ca. 5 x 10 9 RBC'er på 3-5% parasitæmi) og fyld kold PBS til toppen af røret og centrifugeres ved 800 xg i 5 minutter uden bremse for at pelletere røde blodlegemer.
  3. Efter centrifugering, supernatanten fjernes forsigtigt ved hjælp af en opsugning pipette, der er knyttettil et vakuum, da erytrocytiske pellet er let at løsne. Vask pelleten endnu en gang med kold 1x PBS.
  4. Resuspender cellepelleten i koldt 0,15% saponin (i 1 x PBS) og anbring på is i 30 minutter.
  5. Centrifuger cellerne ved 1.500 xg i 12 minutter ved 4 ° C, fjern supernatant (som vil blive mørkerød farve) og resuspender pellet i koldt PBS. Gentag dette trin en gang mere.
    BEMÆRK: For at sikre, at microRNA tilstedeværende var reflekterende af microRNA inden parasitter, og ikke erythrocyt forurening, en række parasit isoleringsbetingelserne blev testet: 1) saponin lyse, 2) saponin lyse kombineret med RNaseA behandling af værtscellelinier miRNA og 3 ) Methyl-beta-cyclodextrin behandling for at fjerne parasitten fra værten erythrocyt. Alle behandlinger gav lignende resultater.
  6. Lyse det isolerede parasit pellet anvendelse af de anbefalede 600 pi lysisbuffer. Dette volumen lysisbuffer er tilstrækkelig til kulturer op til ~ 30 ml ved 2% hæmatokrit og 5% parasitæmi.
    BEMÆRK: For større parasit kulturer, kan denne mængde øges. Det er vigtigt at sikre fuldstændig lyse af parasitten pellet ved grundig vortexing i mindst 1 min. Også, for at lette ekstraktion, de lyserede prøver kan overføres til en 1,7 ml mikrocentrifugerør.
  7. Tilføj 60 pi eller 1/10 volumen af ​​lysisbuffer anvendt i trin 6, homogenat additiv (2 M natriumacetat, pH 4).
  8. Efterlad prøver på is i 10 min.
  9. Tilføj 600 pi, eller en mængde svarende til mængden af ​​lysisbuffer tilsat i trin 6, af syre phenol choloroform til hver prøve og vortex i 1 min.
  10. Adskil de vandige og organiske faser adskilles ved centrifugering af prøverne ved 10.000 x g i 5 min. Denne spin er længere end foreslået af sættet, for at sikre, at alle hæmoglobin / hemozoin er i den organiske fase.
  11. Saml den øverste (vandige) fase og overføre det til et frisk rør. Gentag trin 9 og 10, hvis den vandige fase er hvid eller (mere sandsynligt) brun farve, hvilket tyder proTEIN forurening.
  12. Bestem mængden af ​​den resulterende supernatant med pipette og derefter tilføje 1,25 volumener 100% ethanol (~ 800 pi) og blandes ved at vende 1,7 ml mikrocentrifugerør 5 gange.
  13. Passerer hver prøve gennem en billede RNA-bindende filterpatron (flere forskellige af dem er kommercielt tilgængelige) ved enten centrifugering ved 14.000 x g i 1 min eller ved hjælp af et vakuum manifold.
  14. Vask filterpatronen med 700 pi af miRNA vaskebuffer 1 under anvendelse af en mikrocentrifuge, centrifugering ved 14.000 x g i 1 min.
  15. Vask filterpatronen med 500 pi vaskepuffer 2/3 to gange ved centrifugering ved 14.000 x g i 1 min hver.
  16. Elute RNA med 100 pi DEPC-vand, som er blevet forvarmet til 95 ° C, i to vaske på 50 pi, centrifugering ved 14.000 x g i 1 min hver. Måle koncentrationen af ​​RNA via UV-absorbans ved 260 nm.
    BEMÆRK: Et RNA gel (enten TBE-urea acrylamid eller denaturerende formaldehyd-agarosegel) kan be anvendes til at vurdere størrelsesfordelingen af ​​de isolerede RNA'er.
    BEMÆRK: Denne RNA er velegnet til analyse af microarray, RNA-sekventering, northern blot og ribonuklease beskyttelse assay.

2: Kvantificering af små RNA fra P. falciparum Under IDC

  1. Bestemme koncentrationen af ​​individuelle prøver isoleret i trin 1 under anvendelse af UV-spektrofotometri ved 260 nm.
  2. Generere realtids-PCR-primere for de ønskede RNA-arter. For miRNA Alene brugte vi premade miRNA qPCR assays, mens det for mRNA'er eller fusion miRNA-mRNA vi designede primere til SYBR grøn. For Fusion RNA'er, den fremadrettede primer var miRNA sekvensen selv (MIR-451: AAACCGTTACCATTACTGAGTT), mens bagsiden var en genspecifikke primer ~ 100 bp nedstrøms for miRNA i mRNA-sekvensen (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Gøre cDNA fra RNA-prøver ved hjælp af enten en hårnål primer for miRNA (brug 20-40 ng RNA) alene eller tilfældige hexamerer til mRNA og / eller miRNAarter -mRNA'et Fusion (under anvendelse af 1 ug RNA). Bland RNA og primere i 5 minutter ved 65 ° C, hvorefter der afkøles til stuetemperatur. Bagefter tilsættes revers transkriptase mix (0,5 pi revers transkriptase, 0,5 pi RNase inhibitor, 1 pi dNTP'er (2,5 mM hver), 4 pi 5x buffer, 2 pi 0,1 M DTT, 1 pi H2O).
    1. Kør prøver på en thermocycler stand til at detektere enten SYBR grøn eller TaqMan-prober. SYBR green kvantitativ PCR 30 for specifikke gener blev kørt som en 3-trins PCR, 95 ° C i 15 sekunder, laveste primer annealing temperatur minus 5 ° C i 30 sek, og 68 ° C i 30 sek, i 40 cykler under anvendelse af en kommerciel SYBR grøn mester mix. miRNA realtids-PCR blev kørt som en totrins-PCR, 95 ° C i 15 sek og 60 ° C i 1 min, i 40 cykler.
    2. Kvantificere assays under anvendelse af ΔΔCt fremgangsmåde og normalisere dem mod enten Rab GTPase (PF08_0110) eller 18S rRNA 31.

3: Introduktionaf små RNA ind malariaparasitter

  1. Pelletere 300 pi røde blodlegemer pr transfektion (250 pi RBC'er, ca. 1,5 x 10 9 celler, vil i sidste ende blive anvendt) i komplet malaria medier ved centrifugering ved 800 xg i 5 minutter ved bremsen 1.
  2. Vask erytrocytterne to gange med RPMI og resuspender i fuldstændig cytomix (120 mM KCI; 0,15 mM CaCl2, 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl2; pH justeret med KOH) ved 50% hæmatokrit efter centrifugering ved 800 xg i 5 minutter ved bremsen 1.
  3. Overfør cellerne til en 0,2 cm elektroporeringskuvette.
  4. Tilføj 10 ug, eller passende mængde, brugerdefinerede syntetiske oligonukleotider til kuvetter og resuspender kulturerne.
  5. Juster elektroporator til 310 V / 950 uF og levere en impuls til hver kuvette.
  6. Resuspendere 300 pi RBC'er inden kuvetten i forvarmet komplet malaria medier og pladen dem i plader med 24 brønde og inkuberes ved 37 ° C i en lufttæt beholder med malaria blodgas mix (3% O 2, 5% CO2).
  7. Efter 4 timer, inficere transficerede RBC med synkroniserede sene trophozoitter til en omtrentlig endelige parasitæmi på 1%.
  8. Tilføj frisk transfekterede RBC hver 4-6 dage til inficerede kulturer og bestemme% parasitæmi ved FACS hjælp YoYo-1 farvning, som angivet i punkt 4.

4: Bestemmelse af Erythrocyte microRNAer virkning ved Parasite Infektion Rate

  1. Tag 100 ul resuspenderet kultur ved mikropipette og sted i en 1,7 ml mikrocentrifugerør. Vask to gange med 1 ml 1 x PBS og centrifugeres i en bordplade mikrocentrifuge ved centrifugering ved 800 xg i 5 minutter.
  2. Resuspender pellet i 1 ml 0,025% glutaraldehyd. Inkuber prøver i 20 minutter ved stuetemperatur.
    BEMÆRK: prøver kan opbevares her i flere uger ved 4 ° C. Bagefter pelletere inficerede RBCs ved centrifugering ved 800 xg i 5 minutter. Vask to gange med 1 ml 1x PBS.
  3. Resuspender pellet i 1 ml 0,015% saponin. Der inkuberes ved 4 ° C i 15 minutter. Pellet inficerede røde blodlegemer ved centrifugering ved 800 xg i 5 minutter. Vask to gange med 1 ml 1x PBS. Repeat.4.3. Resuspender celler i 1 ml 1X PBS indeholdende 1 pi (1.000X) DNA-farve.
  4. Bestem grader af parasitæmi på et flowcytometer, ved 488 nM excitation og ~ 530 nM (FL-1) emission.
  5. Først gate flowcytometeret baseret på FSC og SSC at fokusere på RBC. Derefter måle grader af parasitæmi (inficerede RBC) i gated RBC ved fluorescens i FL-1 kanal.
    BEMÆRK: senere tidspunkt parasitter er 10X mere fluorescerende end tidligere stadie parasitter, og ~ 100X over inficerede røde blodlegemer. Også, indsamling ved lav hastighed har tendens til at reducere støj. Endelig har denne tilgang blevet sammenlignet med 3 H-hypoxanthin inkorporering og Giemsa farvning, både som rapporteret tidligere 13, og alle teknikker GAVe lignende resultater.

5: Biotin-tagging og Eluering af miRNA-mRNA Fusion Produkter

  1. Direkte bestilling brugerdefineret syntetiske RNA oligonukleotider med desthiobiotin (db-) kovalent bundet til 5'-enden.
  2. Transficere ikke-inficerede røde blodlegemer med desthiobiotin-konjugeret (db-) miRNA og umodificeret miRNA (negativ kontrol), som angivet i trin 3.
  3. Inficere transfekterede RBC med P. falciparum parasitter til en begyndende parasitæmi på 0,5% (trin 1.1).
  4. Uddrag parasit RNA 4 dage (96 timer) senere som beskrevet ovenfor i trin 1.
  5. Inkuber 10 ug RNA med parasitten 50 pi pakkede streptavidinkugler, tilsat via mikropipette og rotere på et mikrocentrifugerør rotator i 1 time ved 4 ° C.
  6. Pelletere kuglerne ved 800 xg i 30 sek og vask med 20 mM KCl og 1 / 1.000 RNase Inhibitor.
  7. Eluer RNA fra perlerne ved konkurrencen med 2 mM biotin og med 200 pi RNA capture elueringsbuffer (20 mM KCl, 1/1, 000 RNase inhibitor og 2 mM biotin) ved 4 ° C natten over med rotation.
  8. Bestemme graden af berigelse af angivet P. falciparum transkripter ved hjælp af SYBR green QRT-PCR og microRNA berigelse (positiv kontrol) ved TaqMan qPCR som angivet i trin 2.

6: polysom ​​Adskillelse at Bestem det ribosomale Belægning af P. falciparum

  1. Placer 5 ml 15% saccharoseopløsning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 uM cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, og 15% saccharose ) i en SW41 ultracentrifugerør (14 x 89 mm).
  2. Anvendelse af en 5 ml sprøjte, hvorefter der tilsættes 5 ml 50% saccharoseopløsning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 uM cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase hæmmer, og 50% saccharose) under 15% saccharose ved hjælp af en lang stålnål, derefter fjernes kanylen.
  3. Efter 2 timer, langsomt vippe røret tilbage oprejst og overføre røret til is, så den kan køle af i mindst 15 minutter før at prøve lastning (trin 14).
  4. Saml nok Plasmodium inficerede blod fase kultur at generere 100-500 ug totalt RNA eller omkring en 100 ml asynkron kultur på 3-5% parasitæmi. Tilføj 1/10, at mængden af dyrkningsmedium indeholdende 10x (2 mM) cycloheximid (CHX) og inkuberes ved 37 ° C i 10 minutter.
    1. Pellet kulturer ved centrifugering ved 500 x g i 7 min med centrifuge (bremsen 1), vask derefter to gange med stuetemperatur 1x PBS indeholdende 200 uM CHX. Resuspender parasitten kulturer i 1x PBS indeholdende 200 uM CHX og gemme på is.
    Vurdere omfanget af RBC pellet. Tilføj lysisbuffer (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 uM CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630 og 0,5% (w / v) DOC) til RBC pellet overføres til et slutvolumen på 4,25 ml. Inkuber lysatet ved 4 ° C i 10 minutter under rotation.
  5. Overfør lysatet til mikrocentrifugerør, og derefter centrifugeres prøverne i en mikrocentrifuge ved 16.000 xg og 4 ° C i 10 minutter.
  6. Forbered saccharose puder ved pipettering 1,25 ml kold 0,5 M saccharosepude opløsning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 uM cycloheximid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitor og 0,5 M saccharose) i en SW55 ultracentrifugerør (13 x 51 mm).
  7. Forsigtigt lag 3,75 ml lysatsupernatant (fra trin 7) oven på saccharosepude anvendelse af en sprøjte og små (~ 27) gauge nål. Store det resterende lysat (~ 500 pi) ved -80 ° C til at udtrække total RNA-niveauer, som er angivet i afsnit 1.
  8. Læg prøverne i en ultracentrifuge-rotor, præ-kølet til 4 ° C, som kan rumme 13,2 ml rør. Centrifuger prøverne ved 366.000 xg og 4 ° C i 146 min.
  9. Ved hjælp af en pipette, overføres supernatanten til et 15 ml konisk rør. Supernatanten opbevares ved -80 ° C for RNA-isolering af frit (ubundet af ribosomer) RNA'er.
  10. Resuspender ribosom pellet i 500 pi ribosom resuspensionsbuffer (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 uM cycloheximid, 1 mM DTT, 1 mM PMSF og 40 U / ml RNase Inhibitor) ved pipettering i 5 minutter.
  11. Centrifugeres prøverne i en mikrocentrifuge ved 16.000 xg og 4   ° C i 10 minutter.
  12. Mens du holder gradienten fra trin # 4 på is, skal du fjerne Parafilm, derefter forsigtigt lag ribosom suspension på toppen af ​​gradienten USIng en sprøjte og små (~ 27) gauge nål.
  13. Læg røret i en forud kølet ultracentrifuge rotor og centrifugere de indlæste gradienter på 200.000 xg og 4 ° C i 180 minutter. Når spin er afsluttet, Store gradienter centrifugeret ved 4 ° C, indtil klar til at lægge på fraktionatoren.
  14. Indlæse et tomt ultracentrifugerør i gradient fraktionator (dette kan være et rør, der anvendes i en tidligere kørsel), vask derefter med RNAse-frit vand i 5 minutter ved 100 x 10 speed.
  15. Under vask i trin 6.16, indstille følsomheden af ​​UV-absorbans detektoren. Et godt udgangspunkt følsomhed er 0,2, men det kan være nødvendigt at blive justeret i senere løber afhængigt af A 254-signalet (som varierer baseret på parasit nummer, etc.).
  16. Når detektoren følsomheden er indstillet, indstilles baseline signal til nul, mens vandet strømmer gennem detektoren.
  17. Efter vask af fraktionsopsamleren, vende væskestrømmen, indtil linjerne er tomme og derefter remove tomme ultracentrifugerør.
  18. Kør 60% saccharoseopløsning gennem fraktionatoren indtil den forlader nålen apparatet.
  19. Sæt rør indeholdende den første gradient ved toppen af ​​lastning kammeret og stram segl, pas på ikke at over-stramme. Derefter gennembore bunden af ​​røret med nålen.
  20. Nulstil væskestrømmen hastighed til 12,5 x 10 (styret af strømningshastigheden betjeningsknappen på forsiden af ​​pumpen), og indstil derefter automatiseret fraktionsopsamler at indsamle 18 sec fraktioner (~ 330 pl / fraktion) i mikrocentrifugerør.
  21. Start fremløb af saccharoseopløsning 60%.
  22. Når den første dråbe af gradienten opløsningen falder ned i mikrocentrifugerør, straks begynde både fraktion indsamling og live-optagelse af A 254-signalet.
  23. Når et kraftigt fald observeres i A 254-signalet, der svarer til grænsefladen mellem 50% og 60% saccharose løsninger, stop både fluidstrømmen og A 254
  24. Opbevar gradientfraktioner ved -80   ° C til senere brug.
  25. Vende væskestrømmen ved 100 x 10 hastighed, indtil rørsukkeropløsningen 60% tømmes ud af ultracentrifugerør.
  26. Hvis der er yderligere stigninger at fraktionere, fjerne tomme ultracentrifugerør fra ladekammeret og genstart fra trin 6.21. Hvis alle prøver er afsluttet, vaske apparatur, som blev udført i trin 6.16 og 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Global profilering af human microRNA i P. falciparum

Teknikkerne, der præsenteres her blev anvendt til at ekstrahere microRNA fra parasitter i en række tilstande. Én ting at bemærke er, at RNA-ekstraktioner for inficerede røde blodlegemer blev udført som angivet i 32, som ofte serveres som et referencepunkt for microRNA data præsenteret i både denne artikel og den oprindelige undersøgelse 29. Disse tidligere undersøgelser viste også, at HBSS erytrocytter besad langt større grad af bestemte miRNA, miR-451 i særdeleshed. De teknikker, der er angivet ovenfor, var tilstrækkelige til at påvise ændringer i miRNA overflod i HBs (HBA'er eller HBSS) inficerer parasitter. RNA-prøver blev ekstraheret som angivet ovenfor og normaliseret mod 18S rRNA. Parasitprøver fra HBSS RBC'er, for eksempel, viser en betydelig stigning i niveauet af flere microRNA, herunder miR-451 (figur 1). Optagelsen af ​​miRNA fra værten erythrocyte er også i overensstemmelse med tidligere undersøgelser 34,35.

Transfektion af HbAA erythrocytter med miR-451 steg HbAA miR-451 til niveauer svarende til HBSS erythrocytter (figur 1). Flowcytometri blev derefter anvendt til at måle parasitinfektion, med henblik på at vurdere virkningen af ​​miRNA translokation på parasit vækst. Baseret på det, HbAA erythrocytter transficeret med miR-451, miR-223 og miR-181a, sammen med en ssDNA oligo, blev undersøgt for virkningerne af microRNA upon parasit vækst. Transfektion af ssDNA eller MIR-181a havde nogen indflydelse på parasitæmi (figur 2A - D), mens transfektion med MIR-451 markant reduceret parasitæmi, som kunne afbødes kun co-transfektion af et antisense MIR-451 oligo.

Blokering af microRNA ved transfektion af 2'-O-Me antisense microRNA'er demonstrerede en gensidig effekt. HBSS erytrocytter, med naturligt højere MIR-451 niveauer, blev transficeret med antisense MIR-451 eller 2'-O-methyl-oligonukleotider (figur 3). Inhibering af MIR-451 øget parasit vækst i både HBSS erythrocytter (figur 3C - F). Parasit procentdele blev beregnet ud fra mindst 3 uafhængige transfektioner, derefter gennemsnit og præsenteres som fold ændring i forhold til HBSS vækst (figur 3F).

Capture af miRNA-mRNA fusion RNA'er ved biotin indfangningsassay

Efter transfektion af 5'-desthiobiotin-miR-451 (5'Db-miR-451) og 5'Db-miR-181, som angivet i metoder afsnit 5, blev det bestemt, at den observerede miRNA sekvens stammer med humant microRNA. QRT-PCR-analyse viste, at transfektion af 5'Db-MIR-451 resulterede i berigelse af PKA-R fusionstranskripter (figur 4).

Polysom ​​separation til bestemmelse af ribosomale belægning af P. falciparum

telt "> En typisk A 254 spor er vist i figur 5A (med nordlige bekræftelse af rRNA-indhold i figur 5B), med fraktionen densitet stigende fra venstre mod højre på grafen (dvs. lettere fraktioner til venstre). Det oprindelige A 254 er temmelig høje på grund af absorbansen af ​​hæmoglobin i de tidlige fraktioner, men hurtigt falder til basislinjen. Den første lille top svarer til den lille ribosomale underenhed (40S), hurtigt efterfulgt af den anden top, som er lidt større og svarer til den store ribosomale underenhed (60S). Den tredje top, som generelt er den største for P. falciparum, svarer til monosome peak (80S). På grund af sin højde, bør 80S anvendes som en guide til at justere følsomheden af UV-detektor for efterfølgende kørsler (trin 6.17). Også på grund af størrelsen af ​​80S top, er det almindeligt for 60S signal at sløre som en "skulder" i begyndelsen af ​​monosome peak, hvis begge 60S og 80Ssignaler er store.

Efter monosome højdepunkt er de toppe svarende til polysomer. Hver efterfølgende peak repræsenterer en polysom ​​fraktion repræsenterer progressivt større antal af ribosomer (2, 3, 4, etc.). Hver polysom ​​peak er også mindre end den foregående top, faldende i højde med 2-3 gange med hver efterfølgende polysom ​​nummer. Typiske runs vil tillade opløsningen af ​​polysomer sammensat af 5-7 ribosomer, selvom opløsning på op til en 9-mer polysom ​​er blevet observeret i nogle kører med en stor mængde udgangsmateriale. Højere ordens polysomer komponere resten af ​​spor, og kan ikke løses under disse gradient betingelser.

Figur 1
Figur 1: MIR-451 er forhøjet i HBSS erytrocytter Intraparasitic miR-451 niveauer, som bestemt ved real-time PCR og normaliseret mod 18S rRNA, fra parasitter isoleret fra det angivne.erythrocyt typer. Værdier er middel ± SE.

Figur 2
Figur 2: Overekspression af miR-451 i normal erytrocytter hæmmer parasit vækst (A - C) Repræsentative FACS parceller angiver smittespredningen, som en procentdel af den samlede RBC, er angivet med m1, for de viste erythrocyt typer.. (D) Composite infektion satser afledt FACS og normaliserede mod utransficerede HbAA RBC. Værdier i panelet AC er repræsentative FACS parceller, mens D er middel ± SE.

Figur 3
Figur 3:. Hæmning af miR-451 i seglcelle erytrocytter hæver parasit vækst (A - E) Repræsentative FACS parceller angiver smittespredningen, som en procentdel af den samlede RBC, er angivet med m1, for den viste isythrocyte typer. (F) Composite infektion satser afledt FACS og plottet som en normaliseret værdi mod utransficerede HbAA RBC. Værdier i panelet AE er repræsentative FACS parceller, F er gennemsnit ± SE.

Figur 4
Figur 4: Transfektion af MIR-451 beriger for PKA-R fusionstranskripter og viser, at det fusionerede miRNA er erythrocytkoncentrationen oprindelse Berigelse af de angivne desthiobiotin-konjugeret miRNA-mRNA fusionstranskripter, der er blevet fanget af streptavidin.. Værdier blev målt under anvendelse realtids-PCR og afbildet som en relativ værdi i forhold til ikke-transficerede parasitter. Værdier er middel ± SE.

Figur 5
Figur 5:. Parasite ribosomer kan isoleres via saccharosegradient (A - B) Example spor af en polysom ​​profil ekstraheret fra Plasmodium falciparum. (A) Spor af en polysom ​​profil udvundet af Plasmodium falciparum, med 40'erne, 60S, 80S og Polysomprofiler toppe (med # s angiver antallet af ribosomer er forbundet), der vises. (B) Northern blot af 18S rRNA og 28S ribosomale tværs af fraktioner. Værdier er middel ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS er en af de mest almindelige hæmoglobinvarianter i malaria endemiske områder, hovedsagelig fordi det giver beskyttelse mod alvorlig malaria forårsaget af P. falciparum. Teknikkerne er nødvendig for at karakterisere rollen af human microRNA i genregulering af P. falciparum er beskrevet i hele dette håndskrift. Ved ekstraktion total RNA på en sådan måde, at det omfatter alle små RNA'er, og ved at udføre en forholdsvis enkel parasit lyseringsprocedure disse Fusion RNA'er kunne identificeres ved en række uafhængige teknikker.

Disse trin er relativt ligetil, men er følsomme over for problemer og forurening, hvis der ikke følges ordentligt. Under parasitten ekstraktion, er det vigtigt at udføre saponin lysis at fjerne kontaminerende erytrocytter værten. Dette er især tilfældet i det saponin lysistrinnet af RNA-isolering. MiRNA komponent værten røde blodlegemer er flere størrelsesordener greater end den parasit, delvis på grund af de fleste røde blodlegemer bliver inficerede, så det er vigtigt at fjerne så meget erytrocytiske forurening som muligt. Det er også vigtigt at bevare malaria kulturen i en sund og korrekt fase (hvis et bestemt punkt i infektionen cyklus påkrævet) for at opnå en nøjagtig miRNA profil. Ligeledes under phenol-chloroform ekstraktion, er det meget vigtigt at sørge for de vandige faser er klare, og hvis ikke, gentages phenol-chloroform ekstraktion for at undgå enhver tilbageværende forurening.

Også i desthiobiotin capture eksperiment, er det afgørende at eluere med et overskud af biotin og at anvende et minimum af streptavidinkugler, således at sikre korrekt specifik eluering. Elueringen af ​​bundne RNA'er gennem konkurrence med biotin, snarere end fuldstændig denaturering af perlerne selv, tjente for dramatisk at reducere baggrunden RNA berigelse. Endelig blev desthiobiotin capture eksperiment fremhævet ens en vigtig måde at vise, hvordan disse miRNA blev fanget, men flere andre teknikker blev også anvendt i tidligere undersøgelser til at vise disse fusionsproteiner RNA'er, såsom Northern blots og ribonuklease beskyttelse assays 29. Sådanne fremgangsmåder til anvendelse af de transficerede microRNA at hente de modificerede transkripter kan have bredere anvendelse, såsom oprensning af protein-komplekser, der kan mediere transport og forarbejdning af de transficerede miRNA.

Mens forskellige genom-dækkende tilgange er blevet brugt til at studere malaria proteomet og transkriptom 22-25, er der kun få metoder til globalt undersøger translationel regulering i P. falciparum 21,26. Denne metodiske begrænsning udelukker globale analyse af translationel regulering i P. falciparum. En af de mest almindelige eksperimentelle metoder til at studere translationel regulering er polysom ​​profilering, der vurderer den samlede oversættelseal aktivitet baseret på ribosomer læsset på specifikke mRNA af interesse. Beskrevet i dette manuskript er en optimeret polysom ​​profilering fremgangsmåde til anvendelse i malariaparasitten, der lyserer både inficerede erytrocytter og parasitten inden. Tidligere metoder ikke gendanne de fleste af polysomer og gjort det synes som om malaria parasitter ikke havde væsentlige bestande af polysomer. Anvendelsen af ​​en lysepuffer med en høj koncentration af kaliumacetat og magnesium gjort det muligt at lysere både røde blodceller og parasitter samtidig solubilisering membranbundne ribosomer til at tillade indfangning af intakte polysomer.

Denne omkostningseffektiv metode til ribosomale rensning og profilering vil bidrage til at bygge bro over kløften i eksisterende viden mellem malaria transkriptom og proteomanalyse og aktivere genomet-dækkende analyse af translationel tilstand af P. falciparum. Denne fremgangsmåde er blevet anvendt til at sammenligne oversættelse tilstand den tidlige og sene trin blood stadie parasitter 28, som har tæt koordineret genekspression. Data om det ribosomale belastning af transkripter kan let opnås og analyseres for at bestemme tætheden af ​​ribosomer om specifikke mRNA'er. Endvidere når det kombineres med sorbitol synkronisering, ændringer i ribosomal massefylde kan anvendes til at fastlægge, hvordan oversættelse reguleres gennem parasittens livscyklus. Isolering af ribosomer under anvendelse af denne fremgangsmåde kræver en stor mængde kultur, som desværre begrænser faser af malaria livscyklus, hvor den kan udføres. Den store mængde af input materiale vil også begrænse brugen både in vitro lab stammer af Plasmodium falciparum, og kan begrænse dens anvendelse på andre smitsomme organismer. Alle, der bruger denne procedure vil også kunne screene for gener, der viser usædvanlige oversættelse profiler, især udskrifter, som ikke er forbundet med ribosomer, hvilket afspejler alternative former for genregulering. Endelig,denne tilgang vil gøre det muligt for os at vurdere, hvor nye antimalariamidler påvirker proteintranslation og identificere oversættelse mekanismer for resistens. Denne rørledning har stor nytte i at identificere og bestemme den post-transkriptionel regulering i mange eksperimentelle systemer.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics