Metodi per studiare il ruolo di regolamentazione dei piccoli RNA ribosomiale e di occupazione * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La variazione genetica responsabile per l'allele falciforme (HbS) consente eritrociti di resistere alle infezioni da parte del parassita della malaria, P. falciparum. La base molecolare di tale resistenza, che è noto per essere multifattoriale, rimane completamente compresa. Recenti studi hanno trovato che l'espressione differenziale dei microRNA eritrocitari, una volta traslocati in parassiti della malaria, influenza sia regolazione genica e la crescita del parassita. Questi miRNA sono stati successivamente dimostrato di inibire la traduzione dell'mRNA formando un RNA trascritto chimerico con 5 'RNA fusione con sottoinsiemi discreti mRNA parassita. Qui, le tecniche che sono state utilizzate per studiare il ruolo funzionale e putative meccanismo sottostante microRNA eritrocitari sulla regolazione genica e il potenziale di traslazione del P. falciparum, compresa la trasfezione dei microRNA sintetici modificati negli eritrociti di accoglienza, sarà dettagliato. Infine, un metodo polysome gradiente è utilizzato per determinare il grado di Translation di queste trascrizioni. Insieme, queste tecniche hanno permesso di dimostrare che i livelli di microRNA sregolati eritrocitari contribuiscono alla cella-intrinseca resistenza della malaria di eritrociti falciformi.

Introduction

La malaria, causata da parassiti Apicomplexa del genere Plasmodium, è la malattia parassitaria umana più comune, infettando il mondo circa 200 milioni di persone ogni anno e provocando circa 600.000 morti 1. Delle cinque specie di Plasmodium che infettano gli esseri umani, il più rilevante per le malattie umane sono P. falciparum e P. vivax, a causa delle loro distribuzioni diffuse e il potenziale di gravi complicazioni di malaria. Il ciclo di vita del parassita della malaria richiede infezione di zanzare e gli esseri umani sia. Quando una zanzara infetta morde un essere umano, i parassiti viaggiano attraverso il flusso sanguigno al fegato, dove si verifica un primo giro di replica. Dopo la rottura merozoiti dal epatociti ospite, infettano vicine globuli rossi, l'avvio di replica sia asessuata o sessuale. La fase asessuata di replica, che dura 48 ore in P. falciparum, è al centro di questo studio in quanto è sia la fonte della maggior Malsintomi Aria e è facilmente ricapitolate in vitro.

Mentre un certo numero di iniziative di salute pubblica, tra cui il miglioramento terapie anti-malarici, hanno in qualche modo ridotto l'impatto della malaria a livello globale, l'emergere continuo di parassiti resistenti ai farmaci rappresenta un problema per gli sforzi di controllo della malaria. Un settore che può suggerire nuovi approcci terapeutici è lo studio su come le varie varianti genetiche conferiscono resistenza alla malaria. Nelle regioni la malaria è endemica, una varietà di polimorfismi eritrocitari sono abbastanza comuni 2,3. Queste mutazioni, con falciforme è forse il più importante, sono spesso associati con notevole resistenza alla insorgenza di infezione malarica sintomatica 4. I meccanismi alla base con cui essi provocano eritrociti di resistere alle infezioni di malaria non sono completamente compresi. Eritrociti parassitato con mutazioni di emoglobina sono soggetti a una maggiore fagocitosi attraverso la rigidità cellulare aumentata e la disidratazione, cheè associato con una diminuzione invasione da parte di P. Plasmodium 5. L'allele HbC colpisce anche l'espressione della proteina sulla superficie degli eritrociti e con il rimodellamento del citoscheletro, inibendo l'ulteriore sviluppo del parassita 6,7. Infine, P. falciparum cresce poco all'interno falce omozigote (HbSS) eritrociti 8,9 in vitro, suggerendo intrinseci fattori eritrocitari di resistenza della malaria. Tuttavia, mentre tutti questi meccanismi sembrano svolgere un ruolo, non spiegano appieno i meccanismi alla base della resistenza falciforme alla malaria.

Un potenziale serie di fattori eritrocitari che rimangono poco conosciuta è la grande piscina di miRNA presenti all'interno eritrociti maturi. I microRNA sono piccoli RNA non codificanti, 19-25 nt in termini di dimensioni, che mediano la traduzione e / o la stabilità di mRNA bersaglio per appaiamento delle basi nel 3 'UTR. Essi sono stati implicati nel controllo delle risposte immunitarie di mammiferi, compreso la soppressione oreplicazione del virus F 10, e hanno mostrato di conferire resistenza ai virus delle piante Essi hanno anche dimostrato di regolare i diversi processi eritrocitari, tra cui l'eritropoiesi 11,12 e metabolismo del ferro 13. Precedenti studi identificato una popolazione abbondante e diversificata di miRNA eritrocitari, la cui espressione è stata drammaticamente alterata in HbSS eritrociti 14,15. Poiché eritrociti maturi manca la trascrizione attiva e la traduzione, il ruolo funzionale di questi miRNA eritrocitari rimane poco chiaro. Come si verifica un notevole scambio di materiale tra la cellula ospite e P. falciparum durante il ciclo di sviluppo intraerythrocytic (IDC) 16, è stato ipotizzato che il profilo di miRNA alterato secondo eritrociti HbS può contribuire direttamente alla resistenza della malaria cellule intrinseco.

Questi studi infine portato allo sviluppo di una pipeline per isolare, identificare e funzionalmente studiare il ruolo di miRNA umano all'interno malaria parassita, P. falciparum, che ha indicato che questi ospitano / miRNA umani in ultima analisi, in modo covalente fusibile e quindi translationally reprimono trascritti parassita mRNA 17. Questo ha fornito un esempio dei primi cross-specie trascritti chimerici formati da trans-splicing e implica che questa fusione miRNA-mRNA potrebbe essersi verificato in altre specie, tra cui altri parassiti. Tutti mRNA trypanosome sono trans-impiombato con una giunta-capo (SL) per regolare la separazione delle trascrizioni policistronici 18. Poiché P. falciparum manca ortologhi per Dicer / Ago 19,20, è possibile che i miRNA eritrocitari dirottare simile macchinario SL in P. falciparum per integrare nelle geni bersaglio. Recenti studi in P. falciparum hanno infatti indicato la presenza di sequenze 5 'splice capo 21. Dettagli Questo studio i metodi che hanno portato alla scoperta di trascritti di fusione umani-parassita miRNA-mRNA, tra cui sia trascrittomica e TRADUCEzionali tecniche di regolazione. Gli obiettivi generali di questi metodi sono per studiare gli effetti di piccoli RNA nella regolazione genica, fenotipi e la traduzione potenziale di P. trascrizioni falciparum.

L'identificazione iniziale di trascritti chimerici umano-parassita invocata l'utilizzo di tecniche di analisi di RNA, come la real-time PCR, il sequenziamento del trascrittoma e la cattura biblioteca EST, che includeva sia totali e piccoli RNA, piuttosto che con tecniche che isolati solo piccoli RNA. Isolando tutto RNA insieme in una grande piscina, piuttosto che separatamente, permesso di individuare i piccoli RNA umani traslocati nel parassita, nonché la presenza di queste piccole sequenze di RNA come parte di una sequenza più ampia. Questo poi ricorso ad analisi dello stato di questi mRNA traduzione fusione per determinare le conseguenze funzionali di tali fusioni.

Mentre ampi sforzi sulla caratterizzazione del genoma del parassita und trascrittoma hanno aggiunto alla comprensione della biologia del parassita 22-25, molto meno si sa circa la regolamentazione di traslazione del trascrittoma mRNA attraverso il ciclo di vita di P. falciparum 26. Questa comprensione limitata del proteoma del parassita ha ostacolato sia la comprensione della biologia del parassita e la capacità di identificare nuovi obiettivi per la prossima generazione di terapie contro la malaria. Questo divario nella comprensione della biologia cellulare del parassita ha persistito in gran parte a causa della mancanza di tecniche adeguate per svolgere indagini regolazione traduzionale in P. falciparum. Un recente documento descritto l'uso di footprinting ribosomiale di P. falciparum per determinare lo stato di traduzione globale 21. Una misura ben consolidata del potenziale traslazionale delle trascrizioni è il numero di ribosomi associati determinati da polysome profiling. Tuttavia, quando questa tecnica è applicata a P. falciparum </ em>, è in grado di recuperare la maggior parte dei polisomi e cattura prevalentemente monosomes. Recentemente, diversi gruppi hanno ottimizzato 27,28 P. Tecniche polysome falciparum di lisi degli eritrociti e parassiti simultaneamente per preservare i polisomi e caratterizzare l'occupazione ribosomiale e il potenziale traslazionale di questi parassiti della malaria durante il loro sviluppo asessuale in ospitanti globuli rossi 28.

Collettivamente, questi metodi dimostrano che la fusione osservato di miRNA e parassiti mRNA umani modula traduzione proteine ​​parassita di quelle mRNA di fusione, che è stato dimostrato utilizzando metodi precedentemente riportati 27, ed è un fattore determinante della resistenza della malaria in HBA e HbSS eritrociti 17. Questi metodi potrebbero essere utili in qualsiasi sistema cerca di individuare e funzionalmente esplorare eventi RNA splicing, se tali RNA di fusione sono in P. falciparum o altri sistemi eucariotici.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Isolamento di RNA di piccole dimensioni da P. falciparum Durante l'IDC

  1. Ottenere i parassiti della malaria nella cultura asessuata 29.
    NOTA: La dimensione culturale necessaria varierà in base alla applicazione desiderata; tuttavia, una cultura 10 ml al 3-5% parassitemia e 5% ematocrito offre ampio RNA per PCR in tempo reale (RT-PCR). La tecnica è stata inizialmente ottimizzato per le culture asincrone, ma quando si desiderano punti temporali specifici durante il ciclo di infezione, parassiti anello-stage può essere sincronizzato da sincronizzazione sorbitolo entro e non oltre 10-12 ore dopo l'invasione. La sincronizzazione deve essere ripetuta dopo un ciclo (circa 48 ore) 29.
  2. Cellule infettate Pool insieme (~ 5 x 10 9 RBC al 3-5% parassitemia) e riempire PBS freddo alla parte superiore del tubo e centrifugare a 800 xg per 5 minuti senza freno per far sedimentare le cellule rosse.
  3. Dopo la centrifugazione, rimuovere il surnatante con cura utilizzando una pipetta di aspirazione, in allegatoa vuoto, in quanto il pellet eritrocitaria è facile da rimuovere. Lavare il pellet ancora una volta con 1x PBS freddo.
  4. Pellet Risospendere cellulare in freddo 0,15% saponina (in 1x PBS) e posto in ghiaccio per 30 min.
  5. Cellule centrifugare a 1.500 xg per 12 min a 4 ° C, rimuovere il surnatante (che sarà di colore rosso scuro) e risospendere pellet in PBS freddo. Ripetere questo passaggio ancora una volta.
    NOTA: Al fine di garantire che i microRNA presenti erano riflettente dei microRNA all'interno di parassiti, e non la contaminazione eritrocitaria, una serie di condizioni di isolamento di parassiti sono stati testati: 1) saponina lisi, 2) saponina lisi combinata con trattamento RNaseA dei miRNA cellula ospite e 3 ) metil-beta-ciclodestrina trattamento per rimuovere il parassita dal eritrociti host. Tutti i trattamenti hanno dato risultati simili.
  6. Lyse il parassita pellet isolato utilizzando la raccomandata 600 ml di tampone di lisi. Questo volume di tampone di lisi è sufficiente per culture fino a ~ 30 ml a 2% e 5% ematocrito parassitemia.
    NOTA: Per le culture parassita più grandi, questo volume può essere aumentato. È importante garantire la completa lisi del pellet parassita nel vortex approfondita per almeno 1 min. Inoltre, per facilità di estrazione, i campioni lisati possono essere trasferiti in una provetta da 1,7 ml microcentrifuga.
  7. Aggiungere 60 microlitri, o 1/10 volume del tampone di lisi utilizzato nel passaggio 6, di additivo omogenato (acetato di sodio 2 M, pH 4).
  8. Lasciare i campioni in ghiaccio per 10 minuti.
  9. Aggiungere 600 microlitri, o un volume uguale alla quantità di tampone di lisi aggiunto nel passaggio 6, di acido fenolo cloroformio a ciascun campione e vortex per 1 min.
  10. Separate le fasi acquosa ed organica mediante centrifugazione dei campioni a 10.000 xg per 5 min. Questa rotazione è più lungo di quello proposto dal kit per assicurare che tutte emoglobina / emozoina è nella fase organica.
  11. Raccogliere il (acquosa) strato superiore e trasferirlo in una nuova provetta. Ripetere i passaggi 9 e 10 se la fase acquosa è bianco o (più probabilmente) di colore marrone, che suggerisce proTEIN contaminazione.
  12. Determinare il volume del supernatante risultante dalla pipetta e quindi aggiungere 1,25 volumi di etanolo 100% (~ 800 microlitri) e miscelare invertendo la provetta 1,7 ml 5 volte.
  13. Passare ogni campione attraverso una cartuccia filtro RNA associazione fornito (diversi diversi dei quali sono disponibili in commercio) da una centrifugazione a 14.000 xg per 1 minuto o utilizzando un collettore sotto vuoto.
  14. Lavare la cartuccia filtrante con 700 ml di miRNA Wash Buffer 1 utilizzando una microcentrifuga, spinning a 14000 g per 1 min.
  15. Lavare la cartuccia filtrante con 500 microlitri di tampone di lavaggio 2/3 volte per centrifugazione a 14.000 xg per 1 minuto ciascuno.
  16. Eluire RNA con 100 microlitri DEPC in acqua, che è stato preriscaldato a 95 ° C, in due lavaggi di 50 microlitri, centrifugazione a 14.000 xg per 1 minuto ciascuno. Misurare la concentrazione di RNA tramite assorbimento UV a 260 nm.
    NOTA: Un gel di RNA (o TBE-urea acrilamide o denaturazione gel di agarosio formaldeide) può be utilizzato per valutare la distribuzione delle dimensioni delle RNA isolati.
    NOTA: Questo RNA è adatto per l'analisi mediante microarray, RNA-sequenziamento, macchia settentrionale e del test di protezione della ribonucleasi.

2: Quantificazione degli RNA di piccole dimensioni da P. falciparum Durante l'IDC

  1. Determinare la concentrazione di singoli campioni isolati al punto 1 mediante spettrofotometria UV a 260 nm.
  2. Generare primer PCR in tempo reale per le specie di RNA desiderati. Per miRNA da solo, abbiamo usato miRNA premade saggi qPCR, mentre per mRNA o fusione miRNA-mRNA abbiamo progettato primer per SYBR green. Per gli RNA di fusione, il primer forward era sequenza miRNA stesso (miR-451: AAACCGTTACCATTACTGAGTT), mentre il contrario era un gene-specifico Primer ~ 100 bp a valle del miRNA nella sequenza mRNA (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Effettuare cDNA dai campioni di RNA utilizzando sia un primer tornante per miRNA (utilizzare 20-40 ng di RNA) da solo o esameri casuali per mRNA e / o miRNASpecie -mRNA fusione (con 1 mg di RNA). Mescolare RNA e primers per 5 min a 65 ° C, poi raffreddare a temperatura ambiente. In seguito, aggiungere mix trascrittasi inversa (0,5 microlitri trascrittasi inversa, inibitori 0,5 microlitri RNasi, 1 dNTP microlitri (2,5 mm ciascuno), 4 pl 5x tampone, 2 microlitri 0.1M DTT, 1 ml H 2 O).
    1. Campioni eseguito su un termociclatore in grado di rilevare sia SYBR sonde verde o TaqMan. SYBR green quantitativa PCR 30 per geni specifici è stato eseguito come un 3-step PCR, 95 ° C per 15 sec, disponibilità temperatura di ricottura Primer meno 5 ° C per 30 sec e 68 ° C per 30 sec per 40 cicli, utilizzando un SYBR commerciale master mix verde. miRNA PCR in tempo reale è stato eseguito come due fasi PCR, 95 ° C per 15 sec e 60 ° C per 1 min per 40 cicli.
    2. Quantificare test utilizzando il metodo ΔΔCt e normalizzare contro sia Rab GTPasi (PF08_0110) o 18S rRNA 31.

3: Introduzionedi piccoli RNA in Malaria Parassiti

  1. Pellet 300 ml di globuli rossi per trasfezione (250 ml di globuli rossi, circa 1.5 x 10 9 cellule, in ultima analisi, da utilizzare) nei media malaria completo per centrifugazione a 800 xg per 5 minuti a freno 1.
  2. Lavare gli eritrociti due volte con RPMI e risospendere in cytomix completa (120 mM KCl; 0,15 mm CaCl 2; 10 mm K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl 2; pH regolato con KOH) al 50% di ematocrito dopo centrifugazione a 800 xg per 5 min a freno 1.
  3. Trasferire le cellule di un 0,2 cm elettroporazione cuvetta.
  4. Aggiungere 10 mg, o adeguate quantità, di oligonucleotidi sintetici personalizzato alle cuvette e sospendere nuovamente le culture.
  5. Regolare il elettroporatore a 310 V / 950 uF e fornire un impulso per ogni provetta.
  6. Risospendere le 300 ml di globuli rossi all'interno della cuvetta in pre-riscaldato mal completoAria supporti e piastra in piastre da 24 pozzetti e incubare a 37 ° C in un contenitore ermetico con miscela di gas del sangue malaria (3% O 2, 5% CO 2).
  7. Dopo 4 ore, di infettare i globuli rossi trasfettate con trofozoiti fine sincronizzati ad una parassitemia finale di circa 1%.
  8. Aggiungere globuli rossi appena trasfezionati ogni 4-6 giorni a culture infette e determinare la parassitemia% da FACS utilizzando YoYo-1 colorazione, come indicato al punto 4.

4: Determinazione della eritrociti microRNA effetto su Parasite infezione Tasso

  1. Prendete 100 ml di cultura risospeso di micropipettatore e posto in una provetta da 1,7 ml microcentrifuga. Lavare due volte con 1 ml di PBS 1x e centrifugare in una microcentrifuga da tavolo per centrifugazione a 800 xg per 5 min.
  2. Risospendere pellet in 1 ml di 0,025% glutaraldeide. Incubare i campioni per 20 minuti a RT.
    NOTA: i campioni possono essere conservati qui per diverse settimane a 4 ° C. In seguito, il pellet infetto RJacket per centrifugazione a 800 xg per 5 min. Lavare due volte con 1 ml di PBS 1x.
  3. Risospendere pellet in 1 ml di 0,015% saponina. Incubare a 4 ° C per 15 min. Pellet infettato globuli rossi mediante centrifugazione a 800 xg per 5 min. Lavare due volte con 1 ml di PBS 1x. Repeat.4.3. Risospendere le cellule in 1 ml di 1x PBS contenente 1 ml (1,000X) macchia del DNA.
  4. Determinare i gradi di parassitemia su un citofluorimetro, a 488 nm di eccitazione e ~ 530 nm (FL-1) emissioni.
  5. In primo luogo, porta il citofluorimetro basata sulla FSC e SSC di concentrarsi su globuli rossi. Quindi misurare i gradi di parassitemia (globuli rossi infetti) nel RBC gated per fluorescenza nel canale FL-1.
    NOTA: dopo i parassiti stadio sono 10 volte più fluorescente di precedenti parassiti palcoscenico, e ~ 100X sopra globuli rossi infetti. Inoltre, la raccolta a bassa velocità tende a ridurre il rumore. Infine, questo approccio è stato paragonato a 3 H-ipoxantina incorporazione e Giemsa, sia come riportato in precedenza 13, e tutte le tecniche gavdi e risultati simili.

5: biotina-tagging e eluizione di miRNA-mRNA Fusion Prodotti

  1. Direttamente ordinare oligonucleotidi sintetici personalizzato RNA con desthiobiotin (DB-) covalentemente legati alla fine del 5 '.
  2. Trasfettare globuli rossi infetti con Desthiobiotin-coniugata (DB-) miRNA e non modificato miRNA (controllo negativo), come indicato al punto 3.
  3. Infettare globuli rossi transfettate con P. falciparum parassiti ad una parassitemia iniziale di 0,5% (punto 1.1).
  4. Estrarre l'RNA parassita 4 giorni (96 ore), più tardi, come descritto in precedenza al punto 1.
  5. Incubare 10 mg di parassita di RNA con 50 ml confezionati perline streptavidina, ha aggiunto tramite micropipetta, e ruotare su un rotatore provetta per 1 ora a 4 ° C.
  6. Pellet le perline a 800 xg per 30 secondi e lavare con 20 mM KCl e 1 / 1.000 RNase Inhibitor.
  7. Eluire RNA dalle perline di concorrenza con biotina 2 mm e 200 microlitri di buffer RNA cattura di eluizione (20 mM KCl, 1/1, 000 RNase Inhibitor e 2 mm biotina) a 4 ° C durante la notte con rotazione.
  8. Determinare il grado di arricchimento indicato P. trascrizioni falciparum con SYBR green qRT-PCR, e microRNA arricchimento (controllo positivo) per TaqMan qPCR come indicato al punto 2.

6: Separazione polysome determinare la ribosomiale Occupazione di P. falciparum

  1. Posizionare soluzione di saccarosio 5 ml di 15% (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, e il 15% di saccarosio ) in un tubo ultracentrifuga SW41 (14 x 89 mm).
  2. Usando una siringa da 5 ml, aggiungere la soluzione di saccarosio 5 ml di 50% (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNasi Inhibitor, e il 50% di saccarosio) sotto il saccarosio del 15% con un lungo ago di acciaio, quindi rimuovere l'ago.
  3. Dopo 2 ore, lentamente inclinare il tubo schiena dritta e trasferire il tubo di ghiaccio, lasciato raffreddare per almeno 15 minuti prima di assaggiare carico (punto 14).
  4. Raccogliere abbastanza Plasmodium sangue -infected cultura fase di generare 100-500 mg di RNA totale, ovvero circa un 100 ml cultura asincrono al 3-5% parassitemia. Aggiungere 1/10 quel volume di terreno di coltura contenente 10x (2 mM) cicloeximide (CHX) e incubare a 37 ° C per 10 min.
    1. Culture pellet per centrifugazione a 500 xg per 7 minuti con la centrifuga (freno 1), poi lavare due volte con temperatura ambiente PBS 1x contenente 200 mM CHX. Risospendere le culture parassita in 1x PBS contenente 200 mM CHX e memorizzare sul ghiaccio.
    Stima il volume del pellet RBC. Aggiungere tampone di lisi (400 potassio acetato mM, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase Inhibitor, 1% (v / v) IGEPAL CA -630, e 0,5% (w / v) DOC) al pellet RBC ad un volume finale di 4,25 ml. Incubare il lisato a 4 ° C per 10 minuti durante la rotazione.
  5. Trasferire il lisato di tubi microcentrifuga, e poi centrifugare i campioni in una microcentrifuga a 16.000 xg e 4 ° C per 10 min.
  6. Preparare cuscini saccarosio pipettando 1,25 ml di soluzione di cuscino di saccarosio freddo 0,5 M (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, 40 U / ml RNasi Inhibitor, e 0,5 M saccarosio) in un tubo ultracentrifuga SW55 (13 x 51 mm).
  7. Strato cautela 3,75 ml di lisato surnatante (dal punto 7) sulla parte superiore del cuscino di saccarosio con una siringa e piccolo (~ 27) gauge. Store il lisato rimanente (~ 500 mL) a -80 ° C per estrarre livelli di RNA totale, come indicato al punto 1.
  8. Caricare i campioni in un rotore ultracentrifuga, pre-raffreddata a 4 ° C, che può contenere 13,2 ml tubi. Centrifugare i campioni a 366.000 xg e 4 ° C per 146 min.
  9. Usando una pipetta, trasferire il surnatante in un tubo conico da 15 ml. Conservare il surnatante a -80 ° C per l'RNA isolamento di libero (non legato dai ribosomi) RNA.
  10. Risospendere il pellet ribosoma in 500 microlitri di tampone di risospensione ribosoma (400 acetato mM di potassio, HEPES potassio 25 mM, pH 7,2, 15 mM di acetato di magnesio, 200 mM cicloeximide, 1 mM DTT, 1 mM PMSF, e 40 U / ml RNase Inhibitor) pipettando per 5 min.
  11. Centrifugare i campioni in una microcentrifuga a 16.000 xg e 4   ° C per 10 min.
  12. Mantenendo il gradiente dal punto # 4 sul ghiaccio, rimuovere il Parafilm, poi strato accuratamente la sospensione ribosoma in cima alla usi gradienteng una siringa e piccolo (~ 27) gauge.
  13. Caricare il tubo in un rotore ultracentrifuga pre-raffreddata e centrifugare i gradienti caricati 200.000 xg e 4 ° C per 180 min. Quando il giro è completato, negozio centrifugato gradienti a 4 ° C fino al momento di caricare sul frazionatore.
  14. Caricare un tubo ultracentrifuga vuoto nel frazionatore pendenza (questo può essere un tubo utilizzato in una precedente esecuzione), poi lavare con acqua RNase-free per 5 min a 100 x 10 velocità.
  15. Durante il lavaggio nel passaggio 6.16, impostare la sensibilità del rivelatore di assorbanza UV. Una buona sensibilità di partenza è di 0,2, ma questo può essere regolato in seguito corre in base al segnale A 254 (che varia in base al numero parassita, ecc).
  16. Una volta che la sensibilità del rivelatore è impostata, impostare il segnale di riferimento a zero mentre l'acqua scorre attraverso il rivelatore.
  17. Dopo aver lavato il raccoglitore di frazioni, invertire il flusso di fluido fino a quando le linee sono vuote e quindi remil sobrio il tubo ultracentrifuga vuoto.
  18. Eseguire soluzione di saccarosio al 60% attraverso la colonna di frazionamento fino a quando non esce l'apparato ago.
  19. Inserire il tubo contenente il primo gradiente nella parte superiore della camera di caricamento e stringere la guarnizione, facendo attenzione a non serrare eccessivamente. Poi, perforare il fondo del tubo con l'ago.
  20. Azzerare la velocità di flusso del fluido di 12,5 x 10 (controllato dal controllo della velocità del flusso sulla parte anteriore della pompa), quindi impostare il raccoglitore di frazioni automatizzato per raccogliere 18 sec frazioni (~ 330 microlitri / frazione) in provette da microcentrifuga.
  21. Inizia in avanti il ​​flusso della soluzione di saccarosio al 60%.
  22. Quando la prima goccia della soluzione di gradiente cade nella provetta, iniziare immediatamente sia la raccolta di frazioni e la registrazione dal vivo del segnale A 254.
  23. Una volta che un forte calo si osserva nel segnale A 254, corrispondente alla interfaccia tra le soluzioni di saccarosio 50% e 60%, sia interrompere il flusso del fluido e A 254
  24. Conservare le frazioni gradiente a -80   ° C per un uso successivo.
  25. Invertire il flusso del fluido a 100 x 10 velocità finché la soluzione di saccarosio al 60% svuota dal tubo ultracentrifuga.
  26. Se ci sono pendenze aggiuntive per frazionare, rimuovere il tubo ultracentrifuga vuoto dalla camera di caricamento e ricominciare dal punto 6.21. Se sono stati completati tutti i campioni, lavare l'apparecchiatura come è stata eseguita in fasi 6.16 e 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Profilazione globale di microRNA umana in P. falciparum

Le tecniche qui presentate sono stati usati per estrarre microRNAs parassitari in una varietà di condizioni. Una cosa da notare è che le estrazioni di RNA per i globuli rossi infetti sono stati effettuati, come indicato nel 32, che spesso serviva come punto di riferimento per i dati microRNA presentati sia in questo articolo e lo studio originale 29. Tali studi precedenti hanno anche dimostrato che eritrociti HBSS possedevano molto maggiori livelli di alcuni miRNA, miR-451 in particolare. Le tecniche sopra indicati sono stati sufficienti per dimostrare i cambiamenti di miRNA abbondanza in HBS (HBA) o HbSS parassiti infettanti. Campioni di RNA sono stati estratti come sopra indicato e normalizzati contro 18S rRNA. Campioni parassita da HbSS globuli rossi, per esempio, mostrano un aumento significativo dei livelli di diversi microRNA, tra miR-451 (Figura 1). L'assorbimento di miRNA dal erythr accoglienzaocyte è anche coerente con gli studi precedenti 34,35.

Trasfezione di eritrociti HbAA con miR-451 è aumentato HbAA miR-451 a livelli simili a eritrociti HBSS (Figura 1). Citometria a flusso è stato poi utilizzato per misurare parassita infezione, per valutare l'effetto di miRNA traslocazione sulla crescita parassita. Sulla base di questo, eritrociti HbAA trasfettate con miR-451, miR-223 e miR-181, insieme a un oligo ssDNA, sono stati esaminati gli effetti di microRNA sulla crescita del parassita. Trasfezione di ssDNA o miR-181 non ha avuto effetto su di parassitemia (Figura 2A - D) mentre trasfezione con miR-451 notevolmente ridotta parassitemia, che potrebbe essere mitigato solo da co-trasfettando un antisenso miR-451 oligo.

Blocco dei microRNA mediante trasfezione di 2'-O-Me microRNA antisenso ha dimostrato un effetto reciproco. Eritrociti HBSS, con naturalmente più elevati livelli di miR-451, sono state trasfettate con antisenso miR-451 o oligonucleotidi 2'-O-metil (Figura 3). L'inibizione di miR-451 è aumentata la crescita del parassita sia eritrociti HBSS (Figura 3C - F). Parasite percentuali sono state calcolate da almeno 3 trasfezioni indipendenti, quindi la media e presentato come piega cambiamento rispetto alla crescita HbSS (Figura 3F).

Cattura di RNA di fusione miRNA-mRNA da biotina test di cattura

Dopo trasfezione di 5'-desthiobiotin-miR-451 (5'Db-miR-451) e 5'Db-miR-181, come indicato nei metodi sezione 5, è stato stabilito che la sequenza miRNA osservato origine con microRNA umano. qRT-PCR ha indicato che la transfezione di 5'Db-miR-451 ha portato un arricchimento di trascritti di fusione PKA-R (Figura 4).

Separazione polysome per determinare la occupazione ribosomiale di P. falciparum

tenda "> Un tipico A 254 traccia è mostrato in Figura 5A (con conferma settentrionale contenuti rRNA in Figura 5B), con la densità frazione crescente da sinistra a destra del grafico (ovvero frazioni più leggere a sinistra). Il primo A 254 è piuttosto elevato a causa di assorbanza per emoglobina nelle prime frazioni, ma rapidamente scende al basale. Il primo piccolo picco corrisponde alla subunità ribosomiale (40S), seguita rapidamente dal secondo picco, che è leggermente più grande e corrisponde alla grande ribosomiale subunità (60S). Il terzo picco, che è generalmente il più grande per P. falciparum, corrisponde al picco monosome (80S). A causa della sua altezza, il 80S deve essere utilizzato come guida per regolare la sensibilità del rivelatore UV per le esecuzioni successive (passo 6.17). Inoltre, a causa delle dimensioni del picco 80S, è comune per i 60S segnale di sfocatura come "spalla" in l'inizio del picco monosome, se entrambi i 60S e 80Ssegnali sono grandi.

Dopo il picco monosome sono picchi corrispondenti ai polisomi. Ogni picco successivo rappresenta una frazione polysome rappresentano numeri progressivamente più grandi di ribosomi (2, 3, 4, ecc). Ogni picco polysome è anche più piccolo rispetto al picco precedente, diminuendo in altezza di 2-3 volte con ogni numero polysome successiva. Piste tipici consentiranno la risoluzione di polisomi composti da 5-7 ribosomi, sebbene risoluzione fino a un polysome 9-mer è stata osservata in alcune piste con una grande quantità di materiale di partenza. Polisomi ordine superiore compongono il resto della traccia, e non possono essere risolti in queste condizioni di gradiente.

Figura 1
Figura 1: miR-451 sono elevati negli eritrociti HBSS Intraparasitic miR-451 livelli, come determinato dal real-time PCR e normalizzata contro 18S rRNA, da parassiti isolati dal indicata.Tipi degli eritrociti. I valori sono media ± SE.

Figura 2
Figura 2: sovraespressione di miR-451 negli eritrociti normale inibisce la crescita del parassita (A - C) trame FACS rappresentativi che indicano tassi di infezione, come percentuale del totale RBC, sono indicate dal m1, per i tipi di eritrociti indicati.. (D) i tassi di infezione compositi derivati ​​da FACS e normalizzati contro untransfected HbAA globuli rossi. Valori in AC pannello sono rappresentativi FACS trame mentre D è media ± SE.

Figura 3
Figura 3:. L'inibizione di miR-451 negli eritrociti falciforme eleva la crescita del parassita (A - E) FACS Rappresentante trame che indicano tassi di infezione, come percentuale del totale RBC, indicati con m1, per l'er indicatoTipi ythrocyte. (F) i tassi di infezione compositi derivati ​​da FACS e tracciati come un valore normalizzato contro untransfected HbAA globuli rossi. I valori nel pannello AE sono rappresentativi FACS trame, F è media ± SE.

Figura 4
Figura 4: Transfection di miR-451 si arricchisce di trascritti di fusione PKA-R e mostra che il miRNA fusa è eritrocitaria origine Arricchimento dei trascritti di fusione indicate desthiobiotin coniugato miRNA-mRNA che sono stati catturati da streptavidina.. I valori sono stati misurati utilizzando real-time PCR e tracciati come un valore relativo rispetto parassiti non transfettate. I valori sono media ± SE.

Figura 5
Figura 5:. Ribosomi parassita può essere isolate tramite gradiente di saccarosio (A - B) example tracce di un profilo polysome estratto da Plasmodium falciparum. (A) Traccia di un profilo polysome estratto da Plasmodium falciparum, con gli anni '40, '60, '80 e picchi polysome (con #s indicanti il numero dei ribosomi associati) visualizzato. (B) Northern blot di 18S e 28S rRNA attraverso le frazioni ribosomiale. I valori sono media ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HBS è una delle varianti di emoglobina più comuni in aree endemiche malaria, principalmente perché fornisce protezione contro la malaria causata da P. grave falciparum. Le tecniche necessarie per caratterizzare il ruolo di microRNA umano nella regolazione genica di P. falciparum sono dettagliate nel corso di questo manoscritto. Estraendo RNA totale in modo tale da includere tutti i piccoli RNA, ed eseguendo una procedura parassita lisi relativamente semplice, questi RNA fusione potevano essere identificati attraverso una varietà di tecniche indipendenti.

Questi passaggi sono relativamente semplici, ma sono sensibili ai problemi e la contaminazione, se non seguite correttamente. Durante l'estrazione parassita, è fondamentale eseguire saponina lisi per rimuovere contaminanti eritrociti ospitante. Questo è particolarmente vero durante la fase saponina lisi dell'isolamento dell'RNA. Il componente miRNA dei globuli rossi ospite è di diversi ordini di grandezza greater quella del parassita, in parte a causa della maggior parte dei globuli rossi che sono non infetto, quindi è fondamentale per rimuovere il più possibile contaminazione eritrocitaria. E 'anche importante mantenere la cultura malaria in una fase sana e corretta (se è richiesto un punto specifico nel ciclo di infezione) per ottenere un profilo miRNA accurata. Allo stesso modo, durante l'estrazione fenolo-cloroformio, è di vitale importanza per assicurarsi che le fasi acquose sono chiare e, in caso contrario, ripetere l'estrazione con fenolo-cloroformio per evitare qualsiasi contaminazione residua.

Inoltre, nell'esperimento cattura desthiobiotin, è fondamentale per eluire con un eccesso di biotina e di utilizzare il minimo di perline streptavidina, in modo da garantire la corretta eluizione specifica. L'eluizione di RNA si lega attraverso la concorrenza con biotina, piuttosto che completa denaturazione delle perle stesse, è servito a ridurre drasticamente l'arricchimento sfondo RNA. Infine, l'esperimento cattura desthiobiotin stata evidenziata unas un modo importante per dimostrare come sono stati catturati questi miRNA, ma diverse altre tecniche sono state utilizzate anche negli studi precedenti per dimostrare questi RNA di fusione, come macchie settentrionali e saggi di protezione ribonucleasi 29. Tali metodi di utilizzo dei microRNAs trasfettate per recuperare i trascritti modificati possono avere una più ampia applicazione, come la purificazione di complessi proteici associati che possono mediare il trasporto e lavorazione dei miRNA trasfettate.

Mentre diversi approcci a livello di genoma sono stati utilizzati per lo studio del proteoma e del trascrittoma 22-25 malaria, ci sono alcuni metodi per esaminare globalmente regolazione traduzionale in P. falciparum 21,26. Questa limitazione metodologica preclude l'analisi globale del regolamento traslazionale in P. falciparum. Uno degli approcci sperimentali più comuni per lo studio regolazione traduzionale è polysome profiling, che valuta traduzione globaleattività al basato sui ribosomi caricati su specifici mRNA di interesse. Dettagliata in questo manoscritto è un metodo di profiling polysome ottimizzato per l'uso in parassiti della malaria che sia la lisi degli eritrociti infettati e il parassita all'interno. Metodi precedenti non recuperare la maggior parte dei polisomi e faceva sembrare come se parassiti della malaria non hanno popolazioni considerevoli di polisomi. L'uso di un tampone di lisi con un'alta concentrazione di acetato di potassio e magnesio ha reso possibile per lisare entrambi globuli rossi e parassiti mentre solubilizzare ribosomi di membrana per consentire la cattura di polisomi intatti.

Questo metodo conveniente di purificazione ribosomiale e profilatura contribuirà a colmare il divario di conoscenze esistenti tra il trascrittoma malaria e proteoma e consentire l'analisi di tutto il genoma dello stato di traslazione del P. falciparum. Questo approccio è stato utilizzato per confrontare lo stato di traduzione della precoce e tardiva fase bfase lood parassiti 28, che sono strettamente coordinato l'espressione genica. I dati relativi al carico ribosomiale di trascrizioni possono essere facilmente ottenuti e analizzati per determinare la densità dei ribosomi su specifici mRNA. Inoltre, quando combinato con sincronizzazione sorbitolo, variazioni della densità ribosomiale possono essere utilizzati per stabilire come la traduzione è regolata durante il ciclo di vita del parassita. Isolamento di ribosomi utilizzando questo approccio richiede una grande quantità di cultura, che limita purtroppo le fasi del ciclo di vita della malaria in cui può essere eseguita. La grande quantità di materiale in ingresso anche limitare il suo uso sia a ceppi di laboratorio in vitro di Plasmodium falciparum, e può limitare la sua applicabilità ad altri organismi infettivi. Chiunque utilizzi questa procedura sarà anche in grado di schermo per i geni che mostrano profili di traduzione insoliti, in particolare le trascrizioni che non sono associati con i ribosomi, che riflette i modi alternativi di regolazione genica. Finalmente,questo approccio ci consentirà di valutare come agenti antimalarici innovativi influiscono traduzione di proteine ​​e di individuare meccanismi di traduzione a base di resistenza ai farmaci. Questo gasdotto ha una grande utilità per individuare e determinare la regolazione post-trascrizionale in molti sistemi sperimentali.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics