Métodos para investigar o papel de Regulamentação dos Pequenos RNAs e Ribosomal Ocupação de * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A variação genética responsável pelo alelo falciforme (HbS) permite eritrócitos para resistir à infecção pelo parasita da malária, P. falciparum. A base molecular da resistência a este, que é conhecida por ser multifactorial, permanece incompletamente compreendida. Estudos recentes descobriram que a expressão diferencial de microRNAs de eritrócitos, uma vez translocados em parasitas da malária, afetar tanto a regulação gênica e crescimento do parasita. Estes miARNs foram posteriormente mostrados para inibir a tradução do ARNm através da formação de um transcrito de ARN quimérico através de 5 'do RNA de fusão com subconjuntos discretos de mRNAs do parasita. Aqui, as técnicas que foram usadas para estudar o papel funcional e putativos mecanismo microRNAs eritrócitos subjacentes na regulação gênica e potencial translacional de P. falciparum, incluindo a transfecção de microRNAs sintéticos modificados em eritrócitos de acolhimento, serão detalhados. Por fim, um método de gradiente de polissoma é usado para determinar a extensão da TRAnslation destes transcritos. Juntas, essas técnicas nos permitiu demonstrar que os níveis desregulados de microRNAs eritrócitos contribuir para a célula-intrínseca resistência da malária dos eritrócitos falciformes.

Introduction

A malária, causada por parasitas apicomplexan do gênero Plasmodium, é a doença parasitária humana mais comum, infectando mundialmente cerca de 200 milhões de pessoas por ano e causando cerca de 600.000 mortes 1. Dos cinco espécies de Plasmodium que infectam os humanos, o mais relevante para a doença humana são P. falciparum e P. vivax, devido às suas distribuições generalizadas e potencial para complicações graves de malária. O ciclo de vida do parasita da malária requer infecção de ambos os mosquitos e seres humanos. Quando um mosquito infectado pica um humano, os parasitas viajar através da corrente sanguínea para o fígado, onde uma rodada inicial de replicação ocorre. Depois merozoites ruptura do hepatócito hospedeiro, infectam os glóbulos vermelhos próximos, quer iniciar a replicação assexuada ou sexual. A fase assexuada de replicação, que dura 48 horas em P. falciparum, é o foco deste estudo, uma vez que é a fonte da maior parte malsintomas Aria e é facilmente recapitulou in vitro.

Embora uma série de iniciativas de saúde pública, incluindo as terapias anti-malária melhoradas, ter um pouco reduzido o fardo do paludismo a nível mundial, o surgimento contínuo de parasitas resistentes aos medicamentos constitui um problema para os esforços de controle da malária. Uma área que pode sugerir novas abordagens terapêuticas é o estudo sobre como as várias variantes genéticas conferem resistência à malária. Em regiões endêmicas de malária, uma variedade de polimorfismos eritrocitários são bastante comuns 2,3. Estas mutações, com falciforme sendo talvez o mais importante, estão muitas vezes associados com substancial resistência ao aparecimento de infecção por malária sintomática 4. Os mecanismos subjacentes pelo qual eles causam eritrócitos para resistir à infecção da malária são completamente compreendidas. Eritrócitos parasitados com mutações da hemoglobina estão sujeitos a fagocitose aumentada através de uma maior rigidez celular e desidratação, queestá associada à diminuição invasão pelo P. falciparum 5. O alelo HbC também afecta a expressão da proteína na superfície do eritrócito e com a remodelação do citoesqueleto, inibindo a continuação do desenvolvimento do parasita 6,7. Finalmente, P. falciparum cresce pouco dentro de foice homozigoto (HbSS) 8,9 eritrócitos in vitro, sugerindo fatores eritrocitários intrínsecas de resistência da malária. No entanto, embora todos esses mecanismos parecem desempenhar um papel, eles não explicar completamente os mecanismos de resistência das células falciformes trás para a malária.

Um conjunto de fatores eritrocitários potencial que continuam a ser mal compreendido é a grande piscina de miRNA presentes dentro de eritrócitos maduros. MicroRNAs são pequenos RNAs não-codificantes, 19-25 nt de tamanho, que medeiam a tradução e / ou estabilidade de mRNAs alvo por emparelhamento de bases dentro da UTR 3 '. Eles têm sido implicados no controlo de respostas imunitárias de mamíferos, incluindo a supressão óf replicação do vírus 10, e foram exibidas para conferir resistência a vírus em plantas Eles também têm sido mostrados para regular vários processos, incluindo a eritropoiese eritrocitárias 11,12 e metabolismo do ferro 13. Estudos anteriores identificaram uma população abundante e diversificada de miRNAs eritrocitários, cuja expressão foi alterada drasticamente nos HbSS eritrócitos 14,15. Desde eritrócitos maduros falta de transcrição e tradução activo, o papel funcional destas miARNs eritrocitárias permanece obscura. Como material de troca significativa ocorre entre a célula hospedeira e P. falciparum durante o ciclo de desenvolvimento intraerythrocytic (IDC) 16, especulou-se que o perfil de miARN alterado dentro eritrócitos HbS podem contribuir directamente para a célula-resistência intrínseca a malária.

Estes estudos culminaram no desenvolvimento de um gasoduto para isolar, identificar e funcionalmente estudar o papel de miARN humana dentro do mAlaria parasita, P. falciparum, que indicou que esses hospedeiros / miRNAs humanos em última análise, de forma covalente fusível e, em seguida, traducionalmente reprimir transcritos de ARNm parasita 17. Isto proporcionou um exemplo dos primeiros cruzada entre espécies transcritos quiméricos formados por trans-splicing e implica que esta fusão ARNm-miARN pode estar a ocorrer em outras espécies, incluindo outros parasitas. Todos os mRNAs de tripanossomas são trans-emendado com uma tala-líder (SL) para regular a separação de transcrições policistrónicos 18. Desde P. falciparum carece orthologs para Dicer / Ago 19,20, é possível que miRNAs eritrócitos seqüestrar máquinas SL semelhante em P. falciparum para integrar genes-alvo. Estudos recentes em P. falciparum têm, de facto, indica a presença de sequências líder 5 'da tala 21. Este estudo detalha os métodos que levaram à descoberta de humanos-parasita miRNA-RNAm transcrições de fusão, incluindo tanto transcriptomic e translatécnicas de regulação adicionais. Os objetivos gerais destes métodos são a investigar os efeitos de pequenos RNAs na regulação gênica, fenótipos e tradução potencial de P. transcrições falciparum.

A identificação inicial de transcritos quiméricos humano-parasita invocado a utilização de técnicas de análise de RNA, tais como PCR em tempo real, o seqüenciamento do transcriptoma e EST captura biblioteca, que incluía tanto totais e pequenos RNAs, em vez de usar as técnicas que só isoladas pequenos RNAs. Isolamento de ARN todos juntos em um tanque grande, em vez de separadamente, permitiu a identificação de ambos os pequenos RNAs humanos translocados do parasita, assim como a presença destas sequências de ARN pequenos, como parte de uma sequência maior. Este então necessária uma análise do estado tradução destes ARNms de fusão para determinar as consequências funcionais destas fusões.

Enquanto esforços extensivos sobre a caracterização do genoma do parasita umad transcriptoma contribuíram para a compreensão da biologia do parasita 22-25, muito menos se sabe sobre a regulação da tradução do mRNA transcriptoma em todo o ciclo de vida de P. falciparum 26. Esta compreensão limitada do proteoma do parasita tem dificultado tanto a compreensão da biologia do parasita ea capacidade de identificar novos alvos para a próxima geração de terapias anti-malária. Esta lacuna na compreensão da biologia celular do parasita persiste em grande parte devido à falta de técnicas adequadas para investigar regulação traducional em P. falciparum. Um estudo recente descreveu o uso de pegada ribossomal de P. falciparum para determinar o status de tradução global 21. Uma medição bem estabelecido de potencial de translação dos transcritos corresponde ao número de ribossomas associados determinados pelo perfil polissoma. No entanto, quando esta técnica é aplicada a P. falciparum </ em>, é incapaz de recuperar a maioria polissomos e captura predominantemente monosomes. Recentemente, vários grupos 27,28 otimizaram P. técnicas polissomas falciparum por lise do eritrócito e parasita simultaneamente para preservar os polissomos e caracterizar a ocupação ribossômica e potencial translacional desses parasitas da malária durante o seu desenvolvimento assexuado em hospedeiras células vermelhas 28.

Coletivamente, esses métodos demonstram que a fusão observado de miRNA e parasitas mRNAs humanos modula a tradução da proteína do parasita desses mRNAs de fusão, que foi demonstrada utilizando métodos previamente relatados 27, e é um importante determinante da resistência da malária em HbAS e 17 HbSS eritrócitos. Estes métodos seriam úteis em qualquer sistema de procura para identificar e explorar funcionalmente eventos de splicing de ARN, ARN de fusão se estas estão dentro P. falciparum ou outros sistemas eucariotas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Isolamento de RNAs de pequeno porte de P. falciparum Durante o IDC

  1. Obter parasitas da malária na cultura assexuada 29.
    NOTA: O tamanho cultura requerida irá variar de acordo com a aplicação desejada; No entanto, uma cultura de 10 ml em 3-5% de parasitemia e 5% de hematócrito fornece amplo para ARN-PCR em tempo real (RT-PCR). A técnica foi inicialmente otimizado para culturas assíncronas, mas quando são desejados momentos específicos durante o ciclo de infecção, os parasitas anel de carreira podem ser sincronizados pela sincronização sorbitol, o mais tardar 10-12 horas pós-invasão. Sincronização deve ser repetido após um ciclo (aproximadamente 48 horas) 29.
  2. Piscina células infectadas em conjunto (5 x 10 ~ 9 GVs na parasitemia 3-5%) e PBS frio encher a parte superior do tubo e centrifugar a 800 xg durante 5 minutos, sem travão para sedimentar as células vermelhas.
  3. Após centrifugação, o sobrenadante cuidadosamente remover usando uma pipeta de aspiração, ligadopara um vácuo, uma vez que o pellet eritrocítica é fácil de deslocar. Lava-se a pelete mais uma vez com PBS 1x frio.
  4. Ressuspender o sedimento de células em 0,15% de saponina frio (em PBS 1x) e colocar em gelo durante 30 min.
  5. Centrifugar as células a 1.500 xg durante 12 min a 4 ° C, remover o sobrenadante (que será vermelho escuro em cor) e ressuspender o pellet em PBS frio. Repita este passo mais uma vez.
    NOTA: De modo a assegurar que os microARNs presentes eram reflectora de microARNs dentro parasitas, e não contaminação eritrocítica, um número de condições de isolamento do parasita foram testados: 1) de saponina de lise, 2) saponina de lise combinada com tratamento com ARNase A de miARNs célula hospedeira e 3 ) metil-beta-ciclodextrina de tratamento para remover o parasita do eritrócito hospedeiro. Todos os tratamentos deu resultados semelhantes.
  6. Lisar as parasita sedimento isolado usando as recomendadas 600 ul de tampão de lise. Este volume de tampão de lise é suficiente para culturas até ~ 30 ml em 2% de hematócrito e 5% de parasitemia.
    NOTA: Para as culturas de parasitas de maiores dimensões, este volume pode ser aumentado. É importante garantir uma lise completa do pelete parasita em vórtice completa durante pelo menos 1 min. Além disso, para facilitar a extracção, as amostras submetidas a lise pode ser transferida para um tubo de microcentrífuga de 1,7 ml.
  7. Adicionar 60 ul, ou 1/10 do volume do tampão de lise usado no passo 6, de aditivo homogeneizado (acetato de sódio 2 M, pH 4).
  8. Deixar as amostras em gelo durante 10 min.
  9. Adicionar 600 ul, ou um volume igual ao volume de tampão de lise adicionado no passo 6, de choloroform fenol ácido para cada amostra e vortex durante 1 min.
  10. Separaram-se as fases aquosa e orgânica por centrifugação das amostras a 10000 xg durante 5 min. Esta rotação é maior do que a sugerida pelo kit para garantir que toda a hemoglobina / hemozoína está na fase orgânica.
  11. Recolhe-se o (aquosa) da camada superior e transferi-lo para um tubo fresco. Repetir os passos 9 e 10, se a fase aquosa é branca ou (mais provavelmente) de cor castanha, que sugere prócontaminação tein.
  12. Determinar o volume do sobrenadante resultante por pipeta e, em seguida, adicionar 1,25 volumes de etanol a 100% (~ 800 mL) e misturar por inversão do tubo de microcentrífuga de 1,7 ml de 5 vezes.
  13. Passar cada amostra através de um cartucho de filtro de ligação de ARN fornecida (vários diferente dos quais estão disponíveis comercialmente), quer por centrifugação a 14.000 xg durante 1 min, ou usando um colector de vácuo.
  14. Lavar o cartucho de filtro com 700 ul de tampão de lavagem a miARN 1 usando uma microcentrífuga, girando a 14.000 xg durante 1 min.
  15. Lavar o cartucho de filtro com 500 ul de tampão de lavagem 2/3 duas vezes por centrifugação a 14.000 xg durante 1 min cada.
  16. Eluir com 100 ul de ARN DEPC-água, que foi pré-aquecido a 95 ° C, em duas lavagens de 50 mL, a centrifugação a 14000 xg durante 1 min cada. Medir a concentração de ARN através de absorvência de UV a 260 nm.
    NOTA: O gel de ARN (quer de acrilamida TBE-ureia ou gel desnaturante de formaldeído agarose a) pode be utilizada para avaliar a distribuição de tamanho dos ARN isolados.
    NOTA: Este RNA é adequado para análise por microarray, RNA-sequenciamento, norte blot e ensaio de protecção de ribonuclease.

2: Quantificação de RNAs de pequeno porte de P. falciparum Durante o IDC

  1. Determinar a concentração de amostras individuais isolados no passo 1, utilizando espectrofotometria de UV a 260 nm.
  2. Gerar iniciadores de PCR em tempo real para as espécies de ARN desejado. Para miRNA sozinho, usamos premade ensaios miRNA qPCR, enquanto que para mRNAs ou fusão miRNA-RNAm nós projetamos primers para o verde SYBR. Para os ARN de fusão, o iniciador directo foi a própria sequência miARN (miR-451: AAACCGTTACCATTACTGAGTT), ao passo que o inverso era um iniciador específico do gene ~ 100 pb a jusante da miARN na sequência de ARNm (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Faça cDNA a partir das amostras de RNA usando um iniciador hairpin para miRNAs (20-40 ng de usar RNA) sozinho ou hexâmeros aleatórios para mRNA e / ou miRNAespécies de fusão -mRNA (usando 1 ug de ARN). Misture e iniciadores de ARN durante 5 minutos a 65 ° C, depois arrefece-se até à temperatura ambiente. Em seguida, adicionar mistura de transcriptase reversa (0,5 ul de transcriptase reversa, 0,5 ul de inibidor de RNase, 1 ul de dNTPs (2,5 mM cada), 4 pi de tampão 5x, 2 ul de DTT 0,1 M, 1 mL de H2O).
    1. Amostras executado em um termociclador capaz de detectar qualquer SYBR verde ou sondas TaqMan. SYBR Green PCR quantitativa em 30 para genes específicos foi executado como um 3-passo do PCR, 95 ° C durante 15 seg, menor temperatura de hibridação do iniciador de menos de 5 ° C durante 30 seg, e 68 ° C durante 30 s, durante 40 ciclos, utilizando um SYBR comercial master mix verde. miARN-PCR em tempo real foi executada como uma PCR de dois passos, 95 ° C durante 15 seg e 60 ° C durante 1 min, durante 40 ciclos.
    2. Quantificar os ensaios utilizando o método ΔΔCt e normalizá-los contra qualquer Rab GTPase (PF08_0110) ou 18S rRNA 31.

3: Introduçãodos Pequenos RNAs em Malária Parasitas

  1. Agregar a 300 ul de células vermelhas do sangue por transfecção (250 ul de hemácias, cerca de 1,5 x 10 9 células, em última análise, ser utilizado) em meio completo a malária por centrifugação a 800 xg durante 5 min a 1 freio.
  2. Lavar os eritrócitos duas vezes com meio RPMI e ressuspender em cytomix completo (KCl 120 mM, 0,15 mM de CaCl2, 10 mM de K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM de HEPES, pH 7,6; EGTA a 2 mM, pH 7,6; 5 mM de MgCl2, pH ajustado com KOH) a 50% de hematócrito após a centrifugação a 800 xg durante 5 min a 1 freio.
  3. Transferir as células para uma cuvete de electroporação 0,2 cm.
  4. Adiciona-se 10 ug, ou quantidade apropriada, de oligonucleótidos sintéticos costume às cuvetes e ressuspender as culturas.
  5. Ajustar o electroporador de 310 V / 950 uF e fornecer um impulso para cada cuvete.
  6. Ressuspender as 300 ul de hemácias dentro da tina em pré-aquecido Mal completameios Aria e placa-los em placas de 24 poços e incuba-se a 37 ° C num recipiente estanque ao ar com uma mistura de gases no sangue malária (3% de O2, 5% de CO 2).
  7. Após 4 horas, infectam os glóbulos vermelhos transfectadas com trofozoítos final sincronizado para uma parasitemia final, de cerca de 1%.
  8. Adicionar hemácias recém-transfectadas cada 4-6 dias para culturas infectadas e determinar a parasitemia% por FACS usando YoYo-1 coloração, conforme indicado na secção 4.

4: Determinação da Erythrocyte microRNAs efeito sobre Parasite Taxa de Infecção

  1. Tome 100 ul de cultura ressuspenso por micropipeta e coloque em um tubo de 1,7 ml de microcentrífuga. Lavar duas vezes com 1 ml de PBS 1x e centrifugar numa microcentrífuga mesa por centrifugação a 800 xg durante 5 min.
  2. Ressuspender o sedimento em 1 ml de glutaraldeído a 0,025%. Incubar as amostras durante 20 min à TA.
    NOTA: As amostras podem ser armazenadas aqui durante várias semanas a 4 ° C. Depois, sedimentar os infectados RBCs por centrifugação a 800 xg durante 5 min. Lavar duas vezes com 1 ml de PBS 1x.
  3. Ressuspender o sedimento em 1 mL de 0,015% de saponina. Incubar a 4 ° C durante 15 min. Pellet infectados eritrócitos por centrifugação a 800 xg durante 5 min. Lavar duas vezes com 1 ml de PBS 1x. Repeat.4.3. Ressuspender as células em 1 ml de PBS 1x contendo 1 ul (1.000X) corante de ADN.
  4. Determinar os graus de parasitemia num citómetro de fluxo, a 488 nm de excitação e 530 nm (FL-1) ~ emissão.
  5. Em primeiro lugar, o portão citômetro de fluxo com base em FSC e SSC para se concentrar em hemácias. Em seguida, medir os graus de parasitemia (hemácias infectadas) no RBC fechado por fluorescência no canal FL-1.
    NOTA: depois parasitas estágio são 10X mais fluorescente de parasitas fase anterior, e ~ 100X acima hemácias não infectados. Além disso, a coleta em baixa velocidade tende a reduzir o ruído. Finalmente, esta abordagem tem sido comparada ao 3H-hipoxantina incorporação e Giemsa, tanto como relatado anteriormente 13, e todas as técnicas GAVum e resultados semelhantes.

5: Biotina-tagging e eluição de miRNA-RNAm Fusão produtos

  1. Directamente por ordem oligonucleótidos sintéticos costume de RNA com destiobiotina (DB) ligadas covalentemente à extremidade 5 '.
  2. Transfectar RBC infectados com destiobiotina-conjugado (DB) miARN e não modificado miARN (controlo negativo), como indicado no passo 3.
  3. Infectar hemácias transfectadas com P. falciparum parasitas para uma parasitemia de partida de 0,5% (passo 1.1).
  4. Extrair ARN parasita 4 dias (96 horas) mais tarde, como descrito acima no passo 1.
  5. Incubar 10 ug de ARN parasita com 50 ul embalados esferas de estreptavidina, adicionada através de micropipeta, e girar sobre um rotador tubo de microcentrífuga durante 1 hora a 4 ° C.
  6. Agregar as esferas a 800 xg durante 30 seg e lava-se com 20 mM de KCl e 1 / 1.000 de RNase inibidor.
  7. Eluir ARN a partir das pérolas por competição com biotina 2 mM e tampão com 200 ul de RNA de captura de eluição (20 mM de KCl, 1/1, 000 Inibidor de RNase e 2 mM de biotina) a 4 ° C durante a noite com rotação.
  8. Determinar o grau de enriquecimento de P. indicado transcrições falciparum utilizando SYBR Green qRT-PCR, e microARN enriquecimento (controlo positivo) por TaqMan qPCR como indicado no passo 2.

6: Separação polissoma determinar o Ribosomal Ocupação de P. falciparum

  1. Coloque solução de sacarose a 5 ml de 15% (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase inibidor, e 15% de sacarose ) para um tubo de ultracentrífuga SW41 (14 x 89 mm).
  2. Usando uma seringa de 5 ml, adicionar solução de sacarose a 5 ml de 50% (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, 40 U / ml de ARNase inibidor, e 50% de sacarose) debaixo da sacarose 15% utilizando uma agulha de aço longo, em seguida, remover a agulha.
  3. Após 2 horas, incline lentamente o tubo de volta na posição vertical e transferir o tubo de gelo, permitindo-o esfriar por pelo menos 15 minutos antes da amostra de carregamento (passo 14).
  4. Recolha de sangue infectado com Plasmodium suficiente cultura estágio para gerar 100-500 ug de RNA total, ou cerca de 100 ml de cultura assíncrona em 3-5% parasitemia. Adicionar 1/10 volume de que o meio de cultura contendo 10x (2 mM) de ciclo-heximida (CHX) e incubar a 37 ° C durante 10 min.
    1. Culturas por centrifugação a 500 xg durante 7 minutos com a centrifugadora (freio 1), lavar duas vezes com, em seguida, temperatura ambiente 1x PBS contendo 200 uM CHX. Volte a suspender as culturas de parasitas em 1x PBS contendo 200 mM CHX e armazenar no gelo.
    Estimar o volume do pelete de RBC. Adicionar tampão de lise (400 acetato de potássio mM, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 uM de CHX, DTT 1 mM, PMSF 1 mM, 40 U / ml de RNase Inhibitor, 1% (v / v) de IGEPAL CA -630, e 0,5% (w / v) DOC) à pelete de RBC a um volume final de 4,25 ml. Incubar o lisado a 4 ° C durante 10 min durante a rotação.
  5. Transferir o lisado para tubos de microcentrífuga, e depois centrifugar as amostras numa microcentrífuga a 16000 xg e 4 ° C durante 10 min.
  6. Prepare almofadas de sucrose por pipetagem de 1,25 ml de solução de almofada de sacarose a frio 0,5 M (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, 40 U / ml de ARNase inibidor, e sacarose 0,5 M) para um tubo de ultracentrífuga SW55 (13 x 51 mm).
  7. Camada cuidadosamente 3,75 ml de sobrenadante lisado (a partir do passo 7) no topo da almofada de sacarose utilizando uma seringa e pequeno (~ 27) agulha de calibre. Store o lisado remanescente (~ 500 mL) a -80 ° C para extrair os níveis de ARN total, como indicado no ponto 1.
  8. Coloque as amostras num rotor de ultracentrífuga, pré-refrigerada a 4 ° C, a qual pode conter tubos de 13,2 ml. Centrifugar as amostras a 366.000 xg e 4 ° C durante 146 min.
  9. Usando uma pipeta, transferir o sobrenadante para um tubo cónico de 15 ml. Armazene o sobrenadante a -80 ° C para o isolamento de RNA livre (não ligada por ribossomos) RNAs.
  10. Ressuspender o sedimento ribossoma em 500 ul de tampão de ressuspensão ribossoma (400 mM de acetato de potássio, HEPES de potássio 25 mM, pH 7,2, acetato de magnésio 15 mM, 200 ^ M de ciclo-heximida, DTT 1 mM, PMSF 1 mM, e 40 U / ml de RNase inibidor) pipetando durante 5 min.
  11. Centrifugar as amostras numa microcentrífuga a 16000 xg e 4   ° C durante 10 min.
  12. Mantendo o gradiente do passo 4 em gelo, remover o Parafilm, em seguida, a camada cuidadosamente a suspensão ribossoma no topo do gradiente using uma seringa e pequena (~ 27) agulha de calibre.
  13. Carregar o tubo num rotor de ultracentrífuga pré-gelada e centrifugar os gradientes carregados em 200.000 xg e 4 ° C durante 180 min. Quando a rotação estiver concluída, loja centrifugado gradientes a 4 ° C até estar pronto para carregar no fraccionador.
  14. Coloque um tubo de ultracentrífuga vazio no fraccionador do gradiente (este pode ser um tubo usado em uma execução anterior), depois lave com água RNase por 5 min a 100 x 10 velocidade.
  15. Durante o passo de lavagem em 6,16, ajustar a sensibilidade do detector de absorvância no UV. Uma boa sensibilidade de partida é de 0,2, mas este pode ter de ser ajustado em mais tarde corre dependendo do sinal A 254 (que varia com base no número de parasitas, etc.).
  16. Uma vez que a sensibilidade do detector é definido, defina o sinal de linha de base para zero, enquanto a água está fluindo através do detector.
  17. Depois de se lavar o colector de fracções, inverter o fluxo de fluido até que as linhas estão vazios e, em seguida, REMove o tubo de ultracentrífuga vazio.
  18. Executar solução de 60% de sacarose através do fraccionador até que ele sai do aparelho de agulha.
  19. Insira o tubo que contém o primeiro gradiente na parte superior da câmara de carga e apertar o selo, tomando cuidado para não apertar demasiado. Em seguida, furar o fundo do tubo com a agulha.
  20. Repor a velocidade de fluxo de fluido a 12,5 x 10 (controlada pelo botão de controlo de velocidade do fluxo na parte da frente da bomba), em seguida, definir o colector de fracções automático para recolher fracções de 18 seg (~ 330 ul / fracção) em tubos de microcentrífuga.
  21. Comece a frente de fluxo da solução de sacarose a 60%.
  22. Quando a primeira gota da solução gradiente cai para dentro do tubo de microcentrífuga, começará imediatamente tanto a recolha de fracções e gravação ao vivo do sinal A 254.
  23. Uma vez que uma queda brusca é observada no sinal de A 254, que corresponde à interface entre as soluções de sacarose a 50% e 60%, parar o fluxo de fluido e uma 254
  24. Armazenar as fracções de gradiente a -80   ° C para uso posterior.
  25. Inverter o fluxo de fluido a 100 x 10 velocidade até que a solução de sacarose 60% esvazia para fora do tubo de ultracentrífuga.
  26. Se houver gradientes adicionais para fracionar, remover o tubo de ultracentrífuga vazio da câmara de carga e reinicie a partir do passo 6.21. Se todas as amostras são completadas, lavar o aparelho como foi realizada em passos 6.16 e 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Perfil global de microARN humana em P. falciparum

As técnicas aqui apresentadas foram usadas para extrair microARNs de parasitas em uma variedade de condições. Uma coisa a notar é que extrações de RNA para glóbulos vermelhos não infectados foram realizados como indicado na 32, que muitas vezes serviu como um ponto de referência para os dados de microRNA apresentadas tanto este artigo e do estudo original 29. Esses estudos também demonstraram que os eritrócitos HBSS possuía muito maiores níveis de certos miRNAs, miR-451 em particular. As técnicas indicadas acima foram suficientes para demonstrar as mudanças na abundância miRNA em HBS (HBAs ou HbSS) parasitas que infectam. As amostras de RNA foram extraídos tal como indicado acima e normalizados contra rRNA 18S. As amostras de parasitas de HbSS eritrócitos, por exemplo, mostram um aumento significativo nos níveis de várias microARNs, incluindo o miR-451 (Figura 1). A captação de miRNA do erythr anfitriãoocyte também é consistente com estudos anteriores 34,35.

A transfecção de eritrócitos HbAA com miR-451 aumentou HbAA miR-451 para níveis semelhantes aos eritrócitos HBSS (Figura 1). A citometria de fluxo foi então usado para medir a infecção pelo parasita, a fim de avaliar o efeito de miARN translocação sobre o crescimento do parasita. Com base em que, eritrócitos hbaa transfectadas com miR-451, miR-223 e miR-181º, juntamente com um iniciador oligo ssDNA, foram examinados os efeitos de microARNs sobre o crescimento do parasita. A transfecção de ADNcs ou miR-181º não teve nenhum efeito sobre a parasitemia (Figura 2A - D), enquanto que a transfecção com o miR-451 reduziu acentuadamente a parasitemia, que pode ser mitigada única por co-transfecção de um anti-sentido de miR-451 oligo.

Bloqueio de microARNs por transfecção de 2'-O-Me microARNs anti-sentido demonstraram um efeito recíproco. Eritrócitos HBSS, com naturalmente maiores níveis de miR-451, foram transfectadas anti-sentido com miR-451 ou oligonucleidos 2'-O-metilo (figura 3). Inibição de miR-451 aumentou o crescimento parasita em ambos os eritrócitos HBSS (Figura 3C - F). Parasita percentagens foram calculadas a partir de, pelo menos, 3 transfecções independentes, em seguida, calculados e apresentados como dobra mudança em relação ao HbSS crescimento (Figura 3F).

Captura de miRNA-RNAm RNAs de fusão por ensaio de captura de biotina

Após transfecção de 5'-destiobiotina-miR-451 (5'Db-miR-451) e 5'Db-miR-181, tal como indicado na secção métodos 5, determinou-se que a sequência de miARN observado originado com microARN humano. análise de qRT-PCR indicaram que a transfecção de 5'Db-miR-451 resultou no enriquecimento da PKA-R transcrições de fusão (Figura 4).

Separação polissomas para determinar a ocupação ribossomal de P. falciparum

tenda "> Um típico A 254 traço é mostrado na Figura 5A (com a confirmação do norte de conteúdo rRNA na Figura 5B), com a densidade fração crescente da esquerda para a direita no gráfico (ou seja, frações mais leves para a esquerda). A inicial A 254 é bastante elevada devido à absorção pela hemoglobina nas primeiras fracções, mas rapidamente cai para a linha de base. O primeiro pico pequeno corresponde à pequena subunidade ribossomal (40S), seguido rapidamente por o segundo pico, o qual é ligeiramente maior e corresponde à grande subunidade ribossomal (60s). O terceiro pico, o qual é geralmente maior para o P. falciparum, corresponde ao pico monosome (80S). Devido à sua altura, as 80S deve ser usado como um guia para ajustar a sensibilidade do detector de UV para execuções subseqüentes (passo 6,17). Além disso, devido ao tamanho do pico 80S, é comum que os 60S sinalizar a borrar como um "ombro" para o início do pico monosome, se ambos os anos 60 e 80sinais são grandes.

Após o pico monosome são os picos correspondentes aos polissomas. Cada pico sucessivo representa uma fração polysome representar números cada vez maiores de ribossomos (2, 3, 4, etc.). Cada pico polissoma é também menor do que o pico anterior, diminuindo de altura por 2-3 vezes com cada número de polissoma sucessiva. Corridas típicas irão permitir a resolução de compostos de polissomas 5-7 ribossomas, embora resolução de até um polissoma 9-mer foi observada em algumas pistas, com uma grande quantidade de material de partida. Polissomas de ordem superior compor o restante do traço, e não pode ser resolvido sob estas condições de gradiente.

figura 1
Figura 1: miR-451 são elevados em eritrócitos HBSS Intraparasitic miR-451 níveis, como determinado por PCR em tempo real e normalizado contra rRNA 18S, a partir de isolados de parasitas o indicado.tipos de eritrócitos. Os valores são média ± SE.

Figura 2
Figura 2: A sobre-expressão de miR-451 em eritrócitos normais inibe o crescimento do parasita (A - C) parcelas de FACS representativos indicando taxas de infecção, como uma percentagem de RBC totais, são indicadas por M1, para os tipos eritrocitárias mostrados.. (D) as taxas de infecção compostos derivados de FACS e normalizados contra não transfectada HbAA hemácias. Valores em painel AC são FACS representativos parcelas, enquanto D é média ± SE.

Figura 3
Figura 3:. Inibição de miR-451 em eritrócitos de células falciformes eleva o crescimento do parasita (A - E) parcelas de FACS representativos indicando taxas de infecção, como uma percentagem de RBC totais, são indicadas por M1, para o er mostradotipos ythrocyte. (F) as taxas de infecção compostos derivados de FACS e plotados como um valor normalizado contra não transfectada HbAA hemácias. Valores em painel AE são FACS representativos parcelas, F é a média ± SE.

Figura 4
Figura 4: Transfecção de miR-451 enriquece para a PKA-I transcrições de fusão e mostra que a miARN fundida é em eritrocítica origem Enriquecimento dos indicados destiobiotina conjugado miARN-ARNm transcritos de fusão que foram capturados por estreptavidina.. Os valores foram medidos utilizando PCR em tempo real e representados graficamente como um valor relativo versus parasitas não transfectadas. Os valores são média ± SE.

Figura 5
Figura 5:. Ribossomas parasita pode ser isolado por meio de gradiente de sacarose (A - B) example traça um perfil de polissoma extraído de Plasmodium falciparum. (A) Traço de um perfil polysome extraído do Plasmodium falciparum, com os anos 40, 60s, 80s e picos polissoma (com #s indicando o número de ribossomos associados) exibida. (B) Northern blot de 18S e 28S rRNA entre os frações ribossômicas. Os valores são média ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS é uma das variantes da hemoglobina mais comuns em áreas endêmicas de malária, em grande parte porque ele fornece proteção contra a malária grave causada por P. falciparum. As técnicas necessárias para caracterizar o papel do microRNA humana na regulação de genes de P. falciparum são detalhadas ao longo deste manuscrito. Ao extrair o RNA total de modo a incluir todos os pequenos RNAs, e através da realização de um procedimento de lise parasita relativamente simples, estes ARN de fusão foram capazes de ser identificados através de uma variedade de técnicas independentes.

Estas etapas são relativamente simples, mas são sensíveis aos problemas e contaminação se não forem seguidas corretamente. Durante a extracção parasita, é crítico para executar saponina de lise para remover contaminantes eritrócitos hospedeiras. Isto é particularmente verdadeiro durante a etapa de lise de saponina do isolamento do ARN. O componente de miRNA das hospedeiras células vermelhas do sangue é várias ordens de magnitude greater do que a do parasita, em parte devido à maior parte das células vermelhas do sangue não infectados sendo, por isso, é essencial para remover tanto quanto possível contaminação eritrocitária. É também importante para manter a cultura a malária em uma fase adequada e saudável (se for necessário um ponto específico no ciclo de infecção) para se obter um perfil preciso miARN. Da mesma forma, durante a extração de fenol-clorofórmio, é extremamente importante certificar-se as fases aquosas são claras e, se não, repetir a extracção fenol-clorofórmio para evitar qualquer contaminação remanescente.

Além disso, na experiência de captura destiobiotina, é crítico para eluir com um excesso de biotina e de usar o mínimo de esferas de estreptavidina, de modo a assegurar a eluição específica adequada. A eluição de RNAs ligados através de competição com biotina, em vez de uma desnaturação completa dos grânulos eles próprios, serviu para reduzir drasticamente o enriquecimento de RNA fundo. Finalmente, a experiência de captura destiobiotina foi destacado umé um aspecto importante para demonstrar a forma como estes miARNs foram capturados, mas várias outras técnicas também foram utilizados nos estudos anteriores para demonstrar estes ARN de fusão, tais como hibridações de Northern e ensaios de protecção de ribonuclease 29. Tais métodos de utilização dos microARNs transfectadas para recuperar os transcritos modificado pode ter uma aplicação mais vasta, tal como a purificação de complexos de proteínas associados que podem mediar o transporte e processamento dos miARNs transfectadas.

Embora várias abordagens do genoma têm sido utilizados para estudar o proteoma e transcriptoma malária 22-25, existem alguns métodos para examinar globalmente regulamento translacional em P. falciparum 21,26. Esta limitação metodológica impede a análise global do regulamento de translação em P. falciparum. Uma das abordagens experimentais mais comuns para estudar regulação de translação é polysome profiling, que avalia a tradução geralai actividade calculada com base nos ribossomas carregados em mRNAs específicos de interesse. Detalhado neste manuscrito é um método de criação de perfil polysome otimizado para uso em parasitas da malária que lise tanto do eritrócito infectado e o parasita dentro. Os métodos anteriores não recuperou a maioria dos polissomos e fez parecer que os parasitas da malária não têm populações substanciais de polissomos. O uso de um tampão de lise com uma concentração elevada de acetato de potássio e de magnésio, foi possível lisar ambos os glóbulos vermelhos e parasitas enquanto solubilizante em ribossomas ligados à membrana para permitir a captura de polissomas intactas.

Este método eficaz em termos de custos de purificação ribossômica e profiling vai ajudar a preencher a lacuna no conhecimento existente entre o transcriptoma e proteoma malária e permitir a análise de todo o genoma do estado de translação de P. falciparum. Esta abordagem tem sido utilizada para comparar o estado de tradução da fase precoce e tardia blood parasitas fase 28, que têm bem coordenado a expressão do gene. Os dados sobre a carga ribossomal de transcritos podem ser facilmente obtidas e analisadas para determinar a densidade de ribossomas em mRNAs específicos. Por outro lado, quando combinada com a sincronização de sorbitol, alterações na densidade do ribossoma pode ser utilizado para determinar como a tradução é regulada ao longo do ciclo de vida do parasita. Isolamento de ribossomas utilizando esta abordagem requer uma grande quantidade de cultura, o que limita, infelizmente, as fases do ciclo de vida da malária em que ela pode ser realizada. A grande quantidade de material de entrada também irá limitar o seu uso tanto para in vitro cepas de laboratório de Plasmodium falciparum, e podem restringir sua aplicabilidade a outros organismos infecciosos. Qualquer pessoa que use este procedimento também será capaz de rastrear genes que mostram perfis de tradução incomuns, em transcrições particulares que não estão associados a ribossomas, refletindo modos alternativos de regulação gênica. Finalmente,esta abordagem irá permitir-nos avaliar como novos agentes anti-malária afeta a tradução da proteína e identificar mecanismos baseados em tradução de resistência aos medicamentos. Este oleoduto tem grande utilidade na identificação e determinação da regulação pós-transcricional em muitos sistemas experimentais.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics