Yöntemler Küçük RNA'ların ve Ribosomal doluluk Düzenleyici Rolü Araştırma * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Orak hücre alel sorumlu genetik varyasyon (HbS) sıtma parazitinin, P. tarafından enfeksiyonu karşı eritrosit sağlar Falciparum. Multifaktöryel olduğu bilinmektedir, bu direncin, moleküler temeli, tam olarak anlaşılamamıştır. Son çalışmalar kez sıtma parazitleri transloke eritrosit microRNA, ayırıcı ifadesi, gen düzenlemesi ve parazit büyümesi hem de etkilediği bulundu. Bu miRNA'ların sonra parazit mRNA'ların gizli alt grupları ile 5 'RNA füzyon ile bir kimerik RNA transkripti oluşturarak mRNA translasyonunu inhibe ettiği gösterilmiştir. Burada kullanılan teknikler gen regülasyonu ve P. translasyonel potansiyeline fonksiyonel rolü ve varsayılan mekanizma altında yatan eritrosit microRNA incelemek için falsiparum, ev sahibi eritrositlerin içine modifiye sentetik microRNA transfeksiyonunun dahil detaylı olarak açıklanacaktır. Son olarak, polisom gradyan yöntemi tra derecesini belirlemek için kullanılırBu transkriptlerin nslation. Birlikte, bu teknikler bize eritrosit microRNA düzensiz düzeyleri orak eritrositlerin hücre içsel sıtma direncine katkıda bulunduğunu göstermek için izin verdi.

Introduction

Cinsi Plasmodium apicomplexan parazitlerin neden Sıtma, Her yıl dünya çapında yaklaşık 200 milyon kişiyi enfekte ve yaklaşık 600.000 kişinin ölümüne neden olan 1, en ​​yaygın insan parazitik bir hastalıktır. İnsanları enfekte eden beş Plasmodium türleri arasında, insan hastalığı ile en çok ilgili P. ve P. falciparum Şiddetli sıtma komplikasyonlar için onların yaygın dağılımları ve potansiyel nedeniyle Vivax. Sıtma parazitinin yaşam döngüsü sivrisinekler ve insanlarda hem de enfeksiyon gerektirir. Virüslü bir sivrisinek bir insanı ısırdığında, parazitler replikasyon başlangıç ​​yuvarlak meydana karaciğer, kan dolaşımı yoluyla seyahat. Ev sahibi hepatosit gelen merozoitler kopma sonra, aseksüel veya cinsel ya çoğaltma başlatarak, yakındaki kırmızı kan hücreleri enfekte. P. 48 saat sürer replikasyon aseksüel aşaması, en mal kaynağı hem beri falciparum, bu çalışmanın odak noktasıaria semptom ve kolayca in vitro değinmeyecek.

Gelişmiş anti-sıtma terapileri de dahil olmak üzere kamu sağlığı girişimlerinin, bir dizi biraz küresel sıtma yükünü azalttık ederken, ilaca dirençli parazitlerin devam çıkması sıtma kontrolü çabaları için bir sorun oluşturur. Yeni tedavi yaklaşımları önerebilir bir alan genetik varyantlar sıtmaya karşı direnç kazandıran nasıl çeşitli üzerinde çalışmadır. Sıtmanın endemik olduğu bölgelerde, eritrosit polimorfizmleri çeşitli 2,3 oldukça yaygındır. Orak hücre belki de en belirgin olduğu bu mutasyonlar, semptomatik sıtma enfeksiyonu 4 başlamasından büyük bir direnç ile ilişkilidir. Onlar sıtma enfeksiyonu karşı eritrositler nedeni olan altta yatan mekanizmalar tam olarak anlaşılamamıştır. Hemoglobin mutasyonları ile parazitlenmiş eritrositler gelişmiş hücresel katılık ve dehidratasyon yoluyla geliştirilmiş fagositoz tabi olanP. azalarak işgali ile ilişkili 5 Falciparum. HbS, HbC allelin de eritrosit yüzeyine ve hücre iskeleti yeniden modellenmesi, daha da parazit gelişimini inhibe 6,7 protein ekspresyonunu etkilemektedir. Son olarak, P. Falciparum homozigot orak içinde kötü büyür (HbSS) sıtma direnci içsel faktörler eritrosit düşündüren, in vitro 8,9 eritrosit. Bu mekanizmaların her bir rol oynuyor gibi görünmektedir Ancak, tam sıtma orak hücre direnci arkasında mekanizmalarını açıklar yoktur.

Yeterince anlaşılamamıştır eritrosit faktörlerden biri potansiyel seti olgun eritrositler içinde miRNA mevcut büyük havuzudur. MikroRNA'lar 3 'UTR içindeki baz çiftlemesi, çeviri ve / veya hedef mRNA stabilitesini aracılık 19-25 nt küçük boyutlu kodlayıcı olmayan RNA'lar, bulunmaktadır. Bu bastırma-o dahil olmak üzere, memeli bağışıklık tepkilerinin kontrolünde implike edilmiştirf virüs replikasyonu, 10, ve bitkilerde virüslere karşı direnç gösterilmiştir Ayrıca eritropoezi 11,12 ve demir metabolizması 13 dahil olmak üzere birçok eritrosit süreçleri düzenleyen gösterilmiştir. Önceki çalışmalar ifadesi dramatik HBSS değiştirilmiş 14,15 eritrosit eritrosit miRNA'lar, bir bol ve çeşitli nüfus tespit edilmiştir. Olgun eritrositler aktif transkripsiyon ve çeviri yoksun olduğundan, bu eritrosit miRNA'lar fonksiyonel rolü belirsizliğini korumaktadır. Önemli malzeme değişimi konak hücreye ve P. arasında oluşur gibi intraerythrocytic gelişim döngüsü (IDC) 16 sırasında falciparum, bu HbS eritrositler içinde değişmiş miRNA profil doğrudan hücre içsel sıtma direncine katkıda bulunabilir iddia edildi.

Bu çalışmalar sonunda, izole tespit ve fonksiyonel m olan, insan miRNA'nın rolünü araştırmak için bir boru hattı geliştirilmesine yol açmıştıralaria parazit P. Bu konak / insan miRNA'lar sonuçta kovalent sigorta ve sonra translasyon parazit mRNA transkriptleri 17 bastırmak olduğunu belirtti falciparum. Bu şekilde trans-ekleme ile oluşturulan ilk çapraz tür kimerik transkript bir örnek Resim ve miRNA mRNA füzyon diğer parazitler gibi diğer türlerde de meydana geliyor olabilir bir şekilde gösterir. Tüm tripanosom mRNAlar trans-splayslanmış bir bağlayıcı lideri (SL) ile polisistronik transkript 18 ayrılmasını düzenleyen bulunmaktadır. P. yana falciparum Dicer / Önce 19,20 için ortologlarını yoksun, bu eritrosit miRNA'lar P. benzer SL makineleri kaçırmak mümkündür falsiparum hedef genlerin entegre. P. Son çalışmalar falsiparum Aslında 5 'lider sekansların bağlantı 21 mevcudiyetine işaret vardır. Bu çalışma transkriptomik ve transla de dahil olmak, insan-parazit miRNA-mRNA füzyon transkriptleri keşfine yol açtı yöntemleri ayrıntılarıtional regülasyon teknikleri. Bu yöntemlerin genel amaçları P. gen regülasyonu, fenotipleri ve çeviri potansiyelinin küçük RNA'ların etkilerini araştırmak için vardır Falciparum transkript.

İnsan-parazit kimerik transkript ilk tanımlama gibi oldukça sadece küçük RNA'lar izole teknikleri kullanarak daha toplam hem de küçük RNA'lar dahil real-time PCR, transcriptome sıralama ve EST kütüphane yakalama gibi RNA analiz tekniklerinin kullanımı üzerine dayanıyordu. Büyük bir havuzda birlikte tüm RNA İzolasyon, ayrı ayrı olarak daha parazit hem transloke insan küçük RNA belirlenmesini yanı sıra daha büyük bir sekansın bir parçası olarak, bu küçük bir RNA dizilerinin varlığının sağladı. Bu daha sonra bu füzyonların fonksiyonel sonuçlarını belirlemek için bu füzyon mRNA'ların çeviri devletin bir analizini gerekli.

Parazitin genom bir karakterizasyonu kapsamlı çabalar ikend transcriptome parazitin biyoloji 22-25 anlayışına eklemiş, çok daha az P. yaşam döngüsü boyunca mRNA transcriptome öteleme yönetmelik hakkında bilinen Falciparum 26. Parazitin proteom Bu sınırlı anlayış parazitin biyoloji anlayışını ve anti-sıtma terapötik nesil için yeni hedefler belirlemek için yeteneği hem de engellemiştir. Parazitin hücre biyolojisi anlayış bu boşluk P. translasyonel düzenlemeyi incelemek için yeterli tekniklerin olmaması nedeniyle büyük ölçüde devam etmiştir Falciparum. Yakın zamanda kağıt P. ribozomal ayak izi kullanımını tarif Falciparum küresel çeviri durumunu belirlemek için 21. Transkript öteleme potansiyelinin biri iyi kurulmuş ölçüm Polizom profilleme tarafından belirlenen ilgili ribozomların sayısıdır. Bununla birlikte, ne bu teknik, P. uygulanır Falciparum </ em>, en Polisomlar kurtarmak edemiyor ve ağırlıklı olarak monosomes yakalar. Son zamanlarda, çeşitli gruplar 27,28 P. optimize Polisomlar korumak ve ev sahibi kırmızı hücrelerin 28 kendi aseksüel gelişimi sırasında bu sıtma parazitlerinin ribozomal doluluk ve translasyonel potansiyelini karakterize etmek aynı zamanda eritrosit ve parazit parçalama yoluyla falsiparum Polizom teknikleri.

Topluca, bu yöntemler, insan miRNA ve parazit mRNA'larının gözlenen füzyon daha önce bildirilen yöntemler kullanılarak 27 gösterilmiştir olanlar füzyon mRNA'lann, parazit protein çevirisini modüle ve HBA sıtma direncinin önemli bir belirleyicisidir ve HbSS 17 eritrosit göstermektedir. Bu yöntemler, bu füzyon RNA'lar P. içinde olup olmadığını, RNA ekleme olaylarını tanımlamak ve fonksiyonel keşfetmek isteyen herhangi bir sisteme yararlı olacaktır falciparum ya da olmasın diğer ökaryotik sistemlerde.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: P. Küçük ebatlı RNA İzolasyonu IDC Sırasında Falciparum

  1. Eşeysiz kültüründe 29 sıtma parazitleri edinin.
    NOT: Gerekli kültür boyutu istenen başvuru üzerine göre değişir; Bununla birlikte,% 3-5 parazitemi ve% 5 hematokrit bir 10 ml kültür, gerçek zamanlı PCR (RT-PCR) için yeterli RNA içerir. Tekniği başlangıçta asenkron kültürler için optimize edilmiş, ancak enfeksiyon döngüsü sırasında belirli bir zaman noktaları arzu edildiğinde, halka sahne parazitler geç 10-12 saat işgal sonrası daha sorbitol senkronizasyonu ile senkronize edilebilir. Senkronizasyon bir devir (yaklaşık 48 saat) 29 sonra tekrar edilmelidir.
  2. Havuz enfekte hücreler bir araya (~ 5 x 10 9 eritrositler% 3-5 parasitemia at) ve kırmızı pelet hücreleri frensiz 5 dakika boyunca 800 xg'de tüp ve santrifüj üstüne soğuk PBS doldurun.
  3. Santrifüj işleminden sonra, ekli, dikkatli bir aspirasyon pipet kullanarak süpernatant kaldırmakbir vakuma, eritrosit pelet yana çıkarmak kolaydır. Soğuk 1x PBS ile bir kez daha topak yıkayın.
  4. 30 dakika boyunca buz üzerinde tekrar süspansiyon hücre (1x PBS içinde) soğuk% 0.15 saponin içinde pelet ve yer.
  5. 4 ° C'de 12 dakika süreyle 1500 xg'de Santrifüj hücreleri, soğuk PBS süpernatant (renkli koyu kırmızı olacak) ve tekrar süspansiyon pelet çıkarın. Bir kez daha bu adımı yineleyin.
    NOT: Bu mikroRNAlar parazit olan mikroRNA yansıtıcı olup eritrosit kirlenme olmasını sağlamak için, parazit, tecrit koşulları bir takım test edilmiştir: 1) bir saponin liziz, 2) bir saponin liziz RnazA konakçı hücre miRNA'ların tedavisi ve 3 ile birlikte ) Metil-beta-siklodekstrin tedavi konak eritrositlerinden parazit kaldırmak için. Tüm tedaviler benzer sonuçlar verdi.
  6. Lyse lizis tamponu tavsiye 600 ul kullanarak izole parazit pelet. Liziz tamponu Bu birim ~% 2 hematokrit ile% 5 parazitemi 30 mi kadar kültürler için yeterlidir.
    NOT: Daha büyük parazit kültürleri için, bu hacim artırılabilir. En az 1 dakika boyunca tam bir vorteks ile parazit pelet tamamen parçalama sağlamak için önemlidir. Ayrıca, ekstre kolaylığı için, lize numuneleri 1,7 ml mikrosantrifüj tüpüne transfer edilebilir.
  7. Homojenat, ilave madde (2 M sodyum asetat, pH 4) arasında, 60 ul ya da aşama 6'da kullanılan parçalama tamponu 1/10 hacim.
  8. 10 dakika boyunca buz üzerinde örneklerin bırakın.
  9. 600 ul veya her biri 1 dakika numune ve vorteks asit fenol choloroform arasında, Aşama 6'da ilave lizis tamponu miktarına eşit bir hacim.
  10. 5 dakika boyunca 10.000 x g'de santrifüjleme ile örnekleri, sulu ve organik fazlar ayırın. Bu durum döner tüm hemoglobin / hemozoin organik fazda olmasını sağlamak için daha uzun kit önerdiği daha uzundur.
  11. Üst (sulu) tabakayı toplayın ve yeni bir tüp aktarın. Sulu faz yanlısı anlaşılacağı renk (daha büyük olasılıkla) kahverengi, beyaz ya da tekrarlayın 9 ve 10 numaralı adımlarıtein kirlenme.
  12. Pipetle elde edilen üstte kalan sıvı kısmın hacmi tayin edilir ve daha sonra% 100 etanol (~ 800 | il), 1.25 birimleri eklemek 1,7 ml mikrosantrifüj tüpü 5 kez ters yüz edilerek karıştırılır.
  13. 1 dakika süre ile ya da vakum manifoldu kullanılarak 14.000 x g'de santrifüjleme ile, ya bir mesafede RNA bağlayıcı filtre kartuşundan her bir örnek (ticari olarak temin edilebilir çeşitli olan) geçirin.
  14. MiRNA 700 ul tampon 1 1 dakika için 14,000 xg'de iplik, bir mıkro kullanarak yıkama ile filtre kartuşunu yıkayın.
  15. Iki kez 1 dakika her biri için 14.000 x g'de santrifüjleme ile 500 ul yıkama tamponu ile filtre kartuşunu 2/3 yıkayın.
  16. 1 dakika her biri için 14.000 x g santrifüj, 50 ul iki yıkamalarda, 95 ° C 'ısıtılmış olan 100 ul DEPC su ile Elute RNA. 260 nm'de UV absorbansı ile RNA konsantrasyonu ölçümü.
    NOT: RNA jel (TBE üre-akrilamid veya denatüre edici formaldehit agaroz jel olarak) olabilir be izole RNA'ların büyüklük dağılımını değerlendirmek için kullanılan.
    NOT: Bu RNA mikrodizinin RNA-dizisi, Northern blot ve ribonükleaz koruma deneyi ile analiz için uygundur.

2: P. Küçük ebatlı RNA'ların kantitasyonu IDC Sırasında Falciparum

  1. 260 nm'de UV spektrofotometrisi kullanılarak adım 1 'de izole edilmiş tek tek örneklerinin konsantrasyonunu belirler.
  2. İstenilen RNA türleri için real-time PCR primerleri oluşturun. MRNAların ya da füzyon miRNA mRNA biz SYBR yeşil için primerler dizayn ederken miRNA için yalnız biz, önceden hazırlanmış miRNA qPCR deneyleri kullanılır. Ters mRNA dizisi (: ATCGAACATGCTGTGAACAT PKA-R) 'de miRNA'nın alt bir gen spesifik primer ~ 100 bp iken: Füzyon RNA'lar için, ileri primer MiRNA dizisi, (AAACCGTTACCATTACTGAGTT miR-451) idi.
  3. Kullanarak, RNA numuneleri, ya mRNA ve / veya miRNA için miRNA'ların (RNA 20-40 ng kullanımı), tek başına veya rastgele heksamerler bir firkete primeri cDNA sağlayın-mRNA füzyon türleri (RNA'nın 1 | ig kullanılarak). Oda sıcaklığına kadar daha sonra soğuk, 65 ° C 'de 5 dakika süre ile, RNA ve primerler karıştırın. Daha sonra, ters transkriptaz karışımı ekleyin (0.5 ul ters transkriptaz, 0.5 ul RNaz inhibitörü, 1 ul dNTP (her biri 2.5 mM), 4 ul 5x tamponu, 2 ul 0.1 M DTT, 1 ul H2O).
    1. SYBR yeşil veya TaqMan probu ya saptayabilen bir termo Run örnekler. Spesifik genlerin PCR 30 kantitatif yeşil SYBR using, 40 çevrim için, bir 3-aşama PCR, 15 sn için 95 ° C, en primer tavlama sıcaklığı eksi 30 saniye için 5 ° C olarak çalışır, ve 30 saniye süreyle 68 ° C olan Ticari SYBR yeşil master miks. MiRNA gerçek zamanlı PCR, 40 çevrim için, 1 dakika süre ile, iki aşamalı bir PCR gibi 15 sn için 95 ° C ve 60 ° C çalıştırıldı.
    2. ΔΔCt yöntemiyle tahlilleri sayısal olarak ve her iki Rab GTPaz (PF08_0110) ya da 18S rRNA 31 karşı normalize.

3: GirişSıtma Parazitler içine Küçük RNA'lar

  1. Transfeksiyon başına kırmızı kan hücrelerinin 300 ul Pelet freni 1, 5 dakika boyunca 800 x g'de santrifüj ile tam bir sıtma medya (eritrosit 250 ul, yaklaşık 1.5 x 10 9 hücreleri, sonuçta kullanılacağı).
  2. RPMI ve tam cytomix (120 mM KCI içinde tekrar süspansiyon ile iki kez yıkanır, eritrositleri, 0,15 mM CaCl2, 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7.6; 25 mM HEPES, pH 7.6, 2 mM EGTA, pH 7.6; 5 mM MgCl2; fren 1, 5 dakika boyunca 800 x g'de santrifüje tabi tutulmasımn ardından% 50 hematokrit) KOH ile ayarlandı.
  3. 0.2 cm elektroporasyon küvetine hücreleri aktarın.
  4. Küvetler özel sentetik oligonükleotidlerin, 10 ug veya uygun miktarda ekleyin ve kültürleri tekrar süspansiyon.
  5. 310 V / 950 iF için elektro-ayarlayın ve her küvete bir darbe teslim.
  6. Önceden ısıtılmış tam mal olarak küvetin içinde eritrosit 300 ul yeniden süspansearia araçları ve 24 yuvalı plakalar içinde onları plaka ve sıtma kan gazı karışımı ile hava geçirmez bir kapta 37 ° C'de inkübe (% 3 O 2,% 5 CO2).
  7. 4 saat sonra,% 1 yaklaşık son parazitemi senkronize geç trofozoitleri ile transfekte eritrositlerde bulaştırmak.
  8. Enfekte kültürlere, her 4-6 gün taze olarak transfekte eritrositlerde ekleyin ve bölüm 4 de belirtildiği gibi, YOYO-1 lekelemesi kullanılarak FACS ile% paraziteminin belirler.

4: Parazit Enfeksiyon Oranı üzerine Eritrosit mikroRNAlar Etkisinin Belirlenmesi

  1. 1.7 ml mikrosantrifüj tüpü içinde mikropipetöre sabit ve yerine göre yeniden süspanse kültürü 100 ul al. 5 dakika boyunca 800 x g'de santrifüj ile bir masa üstü mikrosantrifüj 1 1x PBS ilave edildi ve santrifüj ile iki kez yıkanır.
  2. % 0.025 glutaraldehit 1 ml süspanse pelet. Oda sıcaklığında 20 dakika boyunca inkübe edin.
    Not: örnekler 4 ° C'de birkaç hafta muhafaza edilebilir. Daha sonra, enfekte R pelet5 dakika boyunca 800 x g'de santrifüj ile BC ler. 1x 1 ml PBS ile iki kez yıkanır.
  3. % 0.015 saponin 1 ml süspanse pelet. 15 dakika boyunca 4 ° C'de inkübe edilir. Pelet 5 dakika boyunca 800 x g'de santrifüj ile RBC bulaştırılır. 1x 1 ml PBS ile iki kez yıkanır. Repeat.4.3. 1x PBS 1 ul (1,000X), DNA leke ihtiva eden 1 ml içinde süspanse hücreleri.
  4. 488 nM eksitasyon, bir akış sitometresi üzerinde parazitemi derece belirlemek ~ 530 nM (FL-1) emisyonu.
  5. İlk olarak, kapı FSC ve SSC dayalı sitometresi akış eritrosit odaklanmak. Sonra FL-1 kanal floresan kapı RBC parazitemya derecelerde (enfekte eritrositler) ölçün.
    NOT: Daha sonra sahne parazitler erken evre parazitler daha 10X daha floresan, ve bulaşmamış eritrosit yukarıda ~ 100X. Aynı zamanda, düşük hızda toplama gürültü azaltma eğilimi gösterir. Son olarak, bu yaklaşım 3H-Hipoksantin Kuruluş ve Giemsa boyama, daha önce 13 rapor hem de ve tüm teknikler gav kıyasla olmuşturbenzer sonuçlar e.

5: miRNA-mRNA Fusion Ürünlerinin Biotin-etiketleme ve Elution

  1. Doğrudan kovalent 5 'ucuna operatif şekilde bağlanmış destiyobiyotin ile özel sentetik RNA oligonükleotidleri (DB) sipariş.
  2. Aşama 3'te gösterildiği gibi, destiobiyotin-konjüge edilmiş (DB) miRNA'nın ve modifiye edilmemiş miRNA (negatif kontrol) ile birlikte enfekte olmamış eritrositlerde transfekte.
  3. P. ile transfekte eritrositlerde Infect falsiparum% 0.5 (adım 1.1) bir başlangıç ​​parazitemya için parazitleri.
  4. Aşama 1 'de yukarıda tarif edildiği gibi parazit RNA daha sonra 4 gün (96 saat) ekstrakte edin.
  5. Streptavidin boncuk dolu 50 ul parazit RNA 10 ug inkübe, mikropipet vasıtasıyla ilave edilmiş ve 4 ° C 'de 1 saat süre ile, bir mikrosantrifüj tüpü rotator döndürün.
  6. 30 saniye için 800 x g'de boncuk Pelet ve 20 mM KCI, 1/1000 RNaz inhibitörü ile yıkayın.
  7. 2 mM biyotin ve 200 ul RNA yakalama elüsyon tamponu (20 mM KCI, 1/1 ile karşılaştırma yoluyla boncuklar Elute RNA'lar4 ° C'de, 000 RNaz inhibitör ve 2 mM biyotin) ° C sıcaklıkta gece boyunca rotasyon ile.
  8. Belirtilen P. zenginleştirme derecesini belirlemek Adım 2'de gösterildiği gibi, SYBR yeşil QRT-PCR ve TaqMan qPCR mikroRNA zenginleştirme (pozitif kontrol) ile falciparum transkript.

6: P. Ribosomal Kişiler belirleme Polizom Ayırma Falciparum

  1. 5 ml% 15 sukroz çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitör ve% 15 sükroz yerleştirin ) Bir SW41 bir ultra santrifüj tüpüne (14 x 89 mm) içine.
  2. 5 ml'lik bir şırınga kullanarak, 5 ml% 50 sukroz çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase ekleme Önleyici ve uzun çelik iğne kullanılarak% 15 sukroz altında% 50 sukroz), sonra iğneyi çıkarın.
  3. 2 saat sonra, yavaş yavaş, dik boru eğme ve önceden örnek yükleme en az 15 dakika (aşama 14) için soğumasına izin buz tüp aktarın.
  4. 100-500 toplam RNA ug veya% 3-5 parazitemi kabaca 100 ml'lik asenkron kültürünü oluşturmak için yeterli Plasmodium enfekte olan kan sahne kültürü toplayın. 10x (2 mM) sikloheksimid (CHX) ihtiva eden kültür ortamına bu hacim inci 1/10 ilave edin ve 10 dakika boyunca 37 ° C'de inkübe edin.
    1. Santrifüj Pelet kültürler santrifüj ile 7 dakika (fren 1) için 500 xg'de sonra PBS 200 uM CHX içeren 1x oda sıcaklığı ile iki kez yıkayın. 200 uM CHX içeren 1x PBS içinde parazit kültürleri yeniden süspanse ve buz üzerinde saklayın.
    RBC pelet hacmi tahmin edin. Liziz tamponu (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM CHX, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase inhibitör,% 1 (h / h) IGEPAL CA ekleme -630, ve% 0.5 4.25 ml nihai hacme kadar RBC pelet DOC) (w / v). 4 ° C'de inkübe lizat Dönerken 10 dakika süreyle ° C.
  5. Mikrosantrifüj tüplerine lizat transferi ve daha sonra 16,000 x g'de 4 ° C'de ve bir mikrosantrfuj örnekleri santrifüj 10 dakika boyunca ° C.
  6. 0.5 M, soğuk sükroz tampon çözeltisi (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, 40 U / ml RNase ve 1.25 mi pipetleme sükroz yastıkları hazırlayın Bir SW55 bir ultra santrifüj tüpüne (13 x 51 mm) içine inhibitör ve 0.5 M sükroz).
  7. Dikkatle bir şırınga ve küçük (~ 27) iğne kullanılarak sakaroz yastık üstünde (aşama 7'den) lizat süpernatant 3.75 ml katman. StorBölüm 1 'de gösterildiği gibi, e -80 ° C de geri kalan lisat (~ 500 | il), toplam RNA düzeyini elde etmek için.
  8. 4 önceden soğutulmuş bir ultrasantrifüjdeki rotora içine örnekleri yükleyin 13.2 ml tüpler tutabilir ° C. 366,000 x g'de örnekleri santrifüj ve 146 dakika boyunca 4 ° C.
  9. Bir pipet kullanarak, bir 15 mL konik tüp içine süpernatant aktarın. Serbest (ribozomlar tarafından bağlı olmayan) RNA'lar RNA izolasyonu için -80 ° C'de süpernatan saklayın.
  10. Ribozom yeniden süspansiyon tamponu (400 mM potasyum asetat, 25 mM potasyum HEPES, pH 7.2, 15 mM magnezyum asetat, 200 uM sikloheksimid, 1 mM DTT, 1 mM PMSF, ve 40 U / ml RNase İnhibitörü) 500 ul ribozom pelletini 5 dakika boyunca pipetleme.
  11. 16.000 x g'de, 4 ° C'de bir mikrosantrfuj örnekleri santrifüj   10 dakika boyunca ° C.
  12. Buz üzerinde adım # 4 den degrade tutarken, sonra dikkatlice degrade usi üstünde ribozom süspansiyon tabaka, Parafilm kaldırmakng bir şırınga ve küçük (~ 27) iğne.
  13. Önceden soğutulmuş bir ultra santrifüj tüpü rotor içine yükleyin ve 200,000 x g ve 180 dakika boyunca 4 ° C 'de yüklü gradyanlar santrifüj. Spin tamamlandığında, mağaza 4'te degradeler santrifüj Hazır olana kadar ° C kincinin üzerine yüklemek için.
  14. Gradyan kısımlara içine boş bir ultra santrifüj tüpüne (bu, önceki bir çalışmada kullanılan tüp olabilir) takın ve 100 x 10 hızda 5 dakika boyunca düzgün miktarlan RNAse bulunmayan su ile yıkayınız.
  15. Adımda 6.16 yıkama sırasında, UV absorbans dedektörün hassasiyetini ayarlamak. İyi bir başlangıç ​​hassasiyeti 0,2, ancak bu, daha sonra (parazit sayısı, vs göre değişir olan) bir 254 sinyaline göre çalışır ayarlanabilir gerekebilir.
  16. Dedektör hassasiyeti ayarlandıktan sonra su detektörü akan iken, sıfıra taban sinyalini ayarlayın.
  17. Çizgiler daha sonra rem boş ve kadar fraksiyon toplayıcı yıkadıktan sonra, sıvı akışını tersineBoş ultrasantrifüjdeki tüpü ove.
  18. Iğne aparatı çıkıncaya kadar kincinin ile% 60 sukroz solüsyonu çalıştırın.
  19. Sıkın üzerinde dikkat çekici, yükleme odasının üstündeki ilk degrade içeren tüp takın ve mühür sıkın. Daha sonra, iğne ile, tüpün alt kısmını delmek.
  20. (Pompanın önündeki akış hızı kontrol düğmesi ile kontrol) 12.5 x 10 sıvı akış hızı Reset sonra 18 sn kesirler toplamak için otomatik fraksiyon toplayıcı ayarlamak (~ 330 ul / fraksiyon) mikrosantrifüj tüplerinde.
  21. Ileri% 60 sukroz çözeltisi akışını başlatın.
  22. Degrade çözümünün ilk açılan mikrosantrifüj tüp içine düştüğünde, hemen fraksiyon toplama ve A 254 sinyalin canlı kayıt, hem başlar.
  23. Keskin bir düşüş% 50 ve% 60 sükroz çözeltiler arasındaki ara yüze karşılık gelen bir 254 sinyalinde bir gözlenmiştir, sıvı akışı ve bir 254 durdurulmasına
  24. Gradyan kesirler de saklayın -80   Daha sonra kullanmak üzere ° C.
  25. % 60 sakaroz çözeltisini ultrasantrifüjdeki tüp dışarı boşaltır kadar 100 x 10 hızında sıvı akışını tersine.
  26. Damıtmak için ek degrade varsa, yükleme odasından boş ultrasantrifüjdeki tüp kaldırmak ve adım 6.21 den yeniden başlatın. Tüm numuneler tamamlandığında ise adımlarla 6.16 ve 6.19 gerçekleştirildi gibi aparat yıkayın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

P. insan microRNA Küresel profilleme Falciparum

Burada sunulan teknikler çeşitli koşullar içerisinde parazitlerden microRNA çıkarmak için kullanıldı. Unutulmaması gereken bir şey, genellikle bu makalede ve orijinal çalışmada 29 hem de sunulan microRNA verileri için bir referans noktası olarak görev 32, belirtildiği gibi enfekte olmamış eritrositlerde için RNA ekstraksiyonu gerçekleştirilmiştir olmasıdır. Bu daha önceki çalışmalarda da HbSS eritrositler belli miRNA'lar, özellikle miR-451 çok daha yüksek düzeyde sahip olduğunu göstermiştir. Yukarıda belirtilen teknikler HbS (HBA veya HBSS) bulaşmasını parazitler miRNA bereket değişiklikleri göstermek için yeterli idi. 18S rRNA karşı yukarıda ve normalize belirtildiği gibi RNA örnekleri ekstre edildi. Orak hücre anemisi Eritrosit gelen parazit örnekleri, örneğin, miR-451 (Şekil 1) dahil olmak üzere birçok mikroRNA, düzeylerinde önemli bir artış gösteriyor. Ev sahibi kızarıklara gelen miRNA'nın alımıocyte daha önceki çalışmalarda 34,35 ile tutarlıdır.

MiR-451 ile HbAA eritrositlerin Transfeksiyonu HbAA MIR-451 HbSS eritrositler benzer seviyelerde (Şekil 1) arttı. Akış sitometri sonra Parazit çoğalmasının üzerine MiRNA translokasyon etkisini değerlendirmek amacıyla, parazit enfeksiyonu ölçümü için kullanılmıştır. Bu dayanarak, miR-451, miR-223 ve miR-181a ile transfekte HbAA eritrosit bir ssDNA oligo birlikte Parazit çoğalmasının üzerine mikroRNA etkiler olup olmadığı muayene edildi. Sadece hafifletilebilir olabilir miR-451 önemli ölçüde azaltılmış parasitemi, transfeksiyon, bir antisens miR-451 ko-transfekte oligo ise - (D Şekil 2A'da) ssDNA ya miR-181a transfeksiyonu parazitemi üzerinde hiç bir etkisi olmamıştır.

2'-O-Me antisens mikroRNA transfeksiyonu ile mikroRNA Engelleme karşılıklı etki göstermiştir. HbSS eritrositler, doğal olarak yüksek miR-451 seviyeleri ile, transfekte edildi antisens miR-451 veya 2'-O-metil oligonükleotidler (Şekil 3). MiR-451 inhibisyonu, hem HbSS eritrositler (F - Şekil 3C) parazit büyümesi. Parazit yüzdeleri ortalama ve HbSS büyüme (Şekil 3F) ile kat değişim göreceli olarak sunulan daha sonra, en az 3 bağımsız transfeksiyonlardan hesaplandı.

Biotin yakalama testi ile miRNA mRNA füzyon RNA'lar yakalama

5'-destiyobiyotin-miR-451 transfeksiyonu sonrası (5'Db-miR-451) ve 5'Db-miR-181, yöntemler bölümünde 5 de belirtildiği gibi, gözlemlenmiştir miRNA dizisi, insan microRNA ile kökenli olduğu tespit edilmiştir. QRT-PCR analizi 5'Db-miR-451 transfeksiyonu PKA-R füzyon transkriptlerinin zenginleştirme (Şekil 4) neden olduğunu göstermektedir.

Polizom ayrılık P. ribozomal doluluk belirlemek için Falciparum

tert "> Tipik bir 254 iz bölümü yoğunluğu grafiği (sola, yani hafif fraksiyon). Başlangıç ​​A 254 soldan sağa doğru artan, (Şekil 5B'de rRNA içeriğine kuzey onayı ile) Şekil 5A'da gösterilmektedir Erken fraksiyonlardaki hemoglobin tarafından sebebiyle absorbans oldukça yüksek, ama hızlı bir şekilde başlangıç ​​düşer. ilk küçük tepe küçük ribozomal alt ünitesine (40S) karşılık, biraz daha büyük ve geniş tekabül ikinci zirve, hızla izledi ribozomal alt birim (60S). Genellikle P. falciparum için en büyük üçüncü zirve, yüksekliği nedeniyle monosome tepe (80S). karşılık, 80S UV dedektör hassasiyetini ayarlamak için bir rehber olarak kullanılmalıdır 60S, monosome zirve başlamadan bir "omuzdan" gibi bulanıklık sinyal müteakip çalışır (6.17 Adım) için. Ayrıca, 80S tepe büyüklüğü nedeniyle, ortak ise hem 60S ve 80Ssinyaller büyüktür.

Monosome tepe aşağıdakı polizom karşılık gelen tepe noktaları vardır. Her bir ardışık zirve ribozomların giderek daha fazla sayıda temsil eden bir polisom kısmını (2, 3, 4, vs.) temsil etmektedir. Her Polizom zirve birbirini izleyen Polizom numarası ile 2-3 kat yüksekliği azalan bir önceki zirve daha da küçüktür. Tipik çalışır başlangıç ​​malzemesinin büyük bir miktarı ile bazı çalışır gözlenmiştir 9-mer polisom kadar olan ama çözünürlük, 5-7 ribozom oluşan polizom çözünürlüğü sağlar. Yüksek mertebeden Polisomlar iz kalanını oluşturan ve bu degrade koşullar altında çözülemez.

figür 1
Şekil 1: miR-451 HbSS eritrositlerde yükseltilir Intraparasitic miR-451 seviyelerinin, gerçek zamanlı PCR ile belirlenmekte ve 18S rRNA karşı normalize edilmiş olarak, belirtilen izole parazitlerden.eritrosit türleri. Değerler ± SE ortalamasıdır.

Şekil 2,
Şekil 2: miR-451 aşırı ekspresyonu, normal eritrositlerin parazit büyümesini engeller (A - C) toplam RBC bir yüzdesi, gösterilen eritrosit türleri için, m1 ile belirtilmiş olduğu gibi, enfeksiyon oranları gösteren Temsilcisi FACS araziler.. (D) Kompozit enfeksiyon oranları FACS türetilmiştir ve edilmemiş HbAA RBCs karşı normalize. D ortalama ± SE ise paneli AC değerler temsilcisi FACS araziler bulunmaktadır.

Şekil 3,
Şekil 3:., Orak hücreli eritrositlerde miR-451 inhibisyonu parazit büyümesi yükseltir (A - E) enfeksiyon oranı gösteren Örnek FACS araziler toplam RBC bir yüzdesi olarak, gösterilen er için m1 ile gösterilirythrocyte türleri. Untransfected HbAA RBCs karşı normalleştirilmiş bir değer olarak FACS türetilmiştir ve çizilmiştir (F) Kompozit enfeksiyon oranları. Panel AE Değerler temsilcisi FACS araziler vardır, F ortalama ± SH olduğunu.

Şekil 4,
Şekil 4: miR-451 transfeksiyonu PKA-R füzyon transkriptleri için zenginleştirir ve kaynaşmış miRNA kökenli eritrosit olduğunu göstermektedir streptavidin tarafından yakalanan belirtilen destiobiyotin-konjuge miRNA-mRNA füzyon transkript zenginleştirilmesi.. Değerler, gerçek zamanlı PCR ile ölçülmüş ve transfekte-olmayan parazitlere karşı nispî bir değer olarak çizildi. Değerler ± SE ortalamasıdır.

Şekil 5,
Şekil 5:. Parazit ribozom sukroz gradyanı yoluyla izole edilebilir (A - B) Örnekle Plasmodium falciparum çıkarılan bir Polizom profilinin izler. (Ilişkili ribozomların sayısını belirten Başarım) 40S, 60S, 80S ve Polizom zirveleri ile Plasmodium falciparum çıkarılan bir Polizom profili, (A) İz görüntülenir. (B) ribozomal fraksiyonların genelinde 18S ve 28S rRNA Northern blot. Değerler ± SE ortalamasıdır.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS o P. neden olduğu şiddetli sıtmaya karşı koruma sağlar, çünkü büyük ölçüde, sıtmanın endemik bölgelerde en yaygın hemoglobin varyantları biridir Falciparum. Teknikleri P. gen regülasyonu insan microRNA rolünü karakterize etmek gerekli Falciparum Bu yazının boyunca ayrıntılı olarak verilmektedir. Tüm küçük RNA'ların içerecek şekilde toplam RNA ekstre edilmesi ve oldukça basit bir parazit lizis prosedürü uygulayarak olarak, bu füzyon RNA'lar, bağımsız çeşitli teknikler vasıtasıyla tespit edilmesi mümkün oldu.

Bu adımlar nispeten doğru olan, ancak problem ve düzgün bir şekilde takip takdirde kirlenmeye karşı duyarlıdır. Parazit çıkarma sırasında, ev sahibi eritrositler kirlenmesine neden kaldırmak için saponin lizisini gerçekleştirmek için çok önemlidir. Bu RNA izolasyonu saponinler parçalama aşaması esnasında özellikle doğrudur. Konak kırmızı kan hücrelerinin miRNA bileşeni büyüklüğü g birkaç siparişler iseBu mümkün olduğunca eritrosit kirleri temizlemek için çok önemlidir, böylece nedeniyle, en kırmızı kan hücreleri, kısmen parazit daha reater, enfekte olmamış olması. Bu (enfeksiyon döngüsünün belirli bir noktaya gerekiyorsa) doğru bir miRNA profil elde etmek için sağlıklı ve uygun aşamada sıtma kültürünü korumak da önemlidir. Benzer şekilde, fenol-kloroform ekstraksiyon sırasında, sulu fazlar değilse, kalan kirlenmeyi önlemek için fenol-kloroform ekstraksiyon tekrarlayın açık ve emin olun son derece önemlidir.

Ayrıca, destiobiyotin yakalama deneyde, bu biyotin fazlası ile elüt edilmesi için ve uygun belirli bir elüsyon sağlayacak şekilde streptavidin boncuk az kullanmak için çok önemlidir. Boncuk biotin ile rekabet yerine tam denatürasyon kendileri aracılığıyla bağlı RNA'ların elüsyon, dramatik arka plan RNA zenginleştirme azaltmak için görev yaptı. Son olarak, destiobiyotin yakalama deneyi vurgulanmış birBu miRNA'ların yakalandı, ama birçok başka teknikler de bu kuzey lekeleri, ribonükleaz koruma deneyleri ve 29 olarak bu füzyon RNA'ları, göstermek için önceki çalışmalarda kullanılmıştır göstermek için önemli bir şekli. Bu tür transfekte miRNA'ların taşıma ve işleme aracılık edebilir ilişkili protein kompleksleri saflaştırma gibi daha geniş bir uygulama, sahip olabilir, transkript almak için transfekte edilmiş microRNA kullanarak Bu yöntemler.

Çeşitli genom yaklaşımlar sıtma Proteomun ve transcriptome 22-25 incelemek için kullanılmış olsa da, orada birkaç yöntemler dünyada olduğu P. translasyonel düzenlemeyi incelemek 21,26 Falciparum. Bu metodolojik sınırlama P. translasyonel düzenlemenin küresel analiz edilmesini önleyen Falciparum. Öteleme yönetmeliği incelemek için en yaygın deneysel yaklaşımlardan biri genel çevirisini değerlendirir Polizom profilleme olduğunuözel ilgi mRNA yüklenen ribozomlar dayalı al faaliyet. Bu yazıda detaylı enfekte eritrosit ve içinde parazit hem lyses sıtma parazitleri kullanılmak üzere optimize edilmiş Polizom profilleme yöntemidir. Önceki yöntemler polizom çoğunluğu kurtarmak ve sıtma parazitleri polizom önemli popülasyonlarını yoktu sanki görünüyor yapılan değildi. Potasyum asetat ve magnezyum yüksek bir konsantrasyon ile bir liziz tamponu kullanılması, sağlam polizom tutulmasına olanak sağlamak üzere zara bağlı ribozomlar çözündürücü yandan da kırmızı kan hücreleri ve parazitleri hem lize yaptı.

Ribozomal arınma ve profilleme Bu maliyet-etkin bir yöntem sıtma transcriptome ve proteom arasındaki mevcut bilgide köprü yardımcı ve P. öteleme durumunun genom analizi sağlayacak Falciparum. Bu yaklaşım, erken ve geç aşama b çeviri durumunu karşılaştırmak için kullanılmıştırLOOD aşaması sıkı gen ifadesini koordine var 28, parazitleri. Transkript ribozomal yükleme ile ilgili veriler kolayca elde ve spesifik mRNA üzerinde ribozomların yoğunluğu belirlemek için analiz edilebilir. Sorbitol senkronizasyonu ile birleştirildiğinde Dahası, ribozomal yoğunluğunda değişimler için parazitin yaşam döngüsü boyunca nasıl düzenlendiği kurmak için de kullanılabilir. Bu yaklaşımı kullanarak ribozomların izolasyonu ne yazık ki bu gerçekleştirilebilir olan malarya yaşam döngüsünün aşamaları sınırlayan kültür, büyük miktarda gerektirir. Giriş maddesinin büyük bir miktarı da Plasmodium falciparum in vitro laboratuar suşları kullanımını hem de sınırlar ve diğer bulaşıcı organizmalar için uygulanabilirliğini sınırlayabilir. Bu yordamı kullanarak Herkes gen regülasyonu alternatif modları yansıtan, ribozomlar ile ilişkili olmayan belirli transkript alışılmadık çeviri profillerini gösteren genlerin taranması için mümkün olacaktır. Son olarak,Bu yaklaşım, yeni antimalaryal ajanlar, protein çevirisini nasıl etkilediğini değerlendirmek için bize sağlayacak ve ilaç direnci çeviri dayalı mekanizmaları tespit etmek. Bu boru hattı belirlenmesi ve bir çok deneysel sistemlerde transkripsiyon sonrası düzenleme belirlenmesinde büyük yararı vardır.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics