아데노 바이러스에 감염된 정상적인 인간의 세포에서 바이러스 복제 구획 풍부한 하위 핵 분수의 분리

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

아데노 바이러스는 감염된 세포의 핵에서 복제하는 이중 가닥 DNA 게놈을 포함합니다. 바이러스의 DNA는 핵 진입하면 PML 핵 몸체 (1)에 인접하여 국소화. 바이러스 초기 유전자 발현 다음, 핵 구조는 과장 되나, 바이러스 성 미세 환경의 형성을 유도하는, 재구성 바이러스 복제 격실 (RC) 2. 아데노 바이러스 (AD) RC는 바이러스 게놈의 복제 및 바이러스 유전자의 발현 늦은이 일어나는 부위이기 때문에, 이들은 이러한 프로세스에 참여하는 모든 필요한 바이러스 및 세포 인자의 채용을위한 환경을 제공한다. 흥미롭게도, 이러한 DNA 손상 반응으로서 세포의 항 바이러스 반응을 담당 세포 단백질의 다양성은 선천성 면역 반응 및 종양 억제는 공동하기로 이들 바이러스 2 위치한다. 병용을 조절하면서 효율적인 바이러스 복제를 촉진 따라서, 광고 RC가 고려 될 수 규제 허브이러한 구조는 바이러스 숙주 세포 상호 작용의 이해에 중요한 것을 나타내는 응답 세포 바이러스. 그럼에도 불구하고, RC 형성의 분자 메커니즘은 그들의 조성과 연관된 활동을 제대로 이해된다.

핵에서 복제 다른 DNA 바이러스에서 아데노 바이러스 RC뿐만 아니라 RC는 세포질 RC 3 대조적으로, 막에 관련되지 않습니다. 또한, 이러한 바이러스 - 유도 구조 단백질 및 핵산의 전체 구성 될 가능성이 높다. RNA 바이러스에 감염된 세포에서 형성 RC는 상세한 형태 적, 기능적, 생화학 적 특성 (4)를 촉진했다 그들의 세포질 현지화 및 막 - 결합 상태, 활용, 고립 된 (일반적으로 바이러스 성 공장을 지칭).

우리의 지식에, 핵 바이러스 성 RC는 아마도 인해 핵내 M의 핵 구조와 부재의 복잡성, 격리되지 않은자신의 분리를 용이하게 할 embranes. 이들의 연구는 대신에 면역 형광 현미경, 생선, 투과 전자 현미경에 의존하고있다. 그러나 subnuclear 구조를 분리 고유의 합병증에도 불구하고, 이러한 핵소체와 Cajal 기관과 같은 다른 핵 도메인은 5,6 전에 격리되었다. 핵소체 및 RC는 모두 단백질 및 핵산으로 구성하고, 직경이 0.5이되기 때문에 - 5 ㎛, 우리는 RC 역시 의무가 분리되어야한다는 가설을 세웠다. 따라서,보다 정확하게 RC 연관된 분자 조성 및 기능을 특성화하기 위해, 우리는 RC subnuclear 풍부 분획을 분리하는 새로운 방법을 확립. 이를 위해 핵소체 7 또는 다른 핵 영역 (6)을 분리하기 위해 사용 된 절차와 유사한 속도 구배 및 수 크로스 쿠션을 사용하는 하위 핵 분획을 제조하고, 분자 조성물의 연구 및 연관된 활동을 가능하게하는 무 세포계를 설립RC. 이 기술은 따라서 바이러스 숙주 세포 상호 작용의 이해를 발전하고 또한 핵 복제 다른 바이러스로부터 RC의 상세한 분석을 용이하게하고 adenovirus- 형성과 동일한 치수의 복제 구획 형성을 유도한다 강력한 도구를 대표한다 예, 헤르페스 바이러스, 유두종 바이러스 또는 폴리오 마 감염된 세포.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF 세포 배양 및 광고 감염

  1. 앞서 설명 된 바와 같이 8 HFF 세포에 형광 형성 유닛 (FFU)로서 HEK-293 세포의 단층에서 역가의 Ad5 WT 바이러스를 전파.
  2. 가습 인큐베이터에서 DMEM / 10 % 태아 소 37 ºC에서 멸균 문화 100mm 요리 혈청 (FBS) 5 % CO 2 10ml에 인간의 포피 섬유 아세포 (HFF)을 성장. 네 16 평방 세트에서 세포를 계산하여 노이 바 우어 챔버를 이용하여 세포 수를 결정합니다. 용액 당 세포 수는 4-16 개의 정사각형 세트 세포 수의 평균을 산출하고 (10) (4)에 의해이 값을 곱함으로써 얻어진다. 스텝 130에 포함 된 각 시간 후 감염, 1 × 10 7 HFF 셀을 사용한다.
  3. 모의 감염시킬가 형성 부 (30) 포커스의 방어에 접시 당 DMEM에서의 Ad5 1 ㎖를 사용하여 100mm 조직 배양 접시에서 아데노 바이러스 5 형 (의 Ad5) 야생형 (WT) (H5pg4100 8)로 HFF 세포를 감염, 또는 FFU 또는 셀 당. 아에 2 시간 동안 품어신중 요리마다 15 분간 흔들 umidified 37 ºC에서 세포 배양 인큐베이터 및 5 % CO 2, 셀 위에 바이러스 접종원 균일 분포를 보장한다. 이 시간 후, 배지를 제거하고, 추가 10 % FBS가 보충 된 신선한 DMEM 및 CO 2에서 37 º C 가습 세포 배양 인큐베이터에서 16, 24 또는 36 시간 동안 배양하고, 5 %. 2.1 단계로 진행합니다.

아데노 바이러스 RC이 함유 하위 핵 분수 2. 준비

  1. 수확의 Ad5는 감염 또는 셀 스크래퍼와 모의에 감염된 HFF 세포와 멸균 원심 분리기 튜브에 세포를 수집합니다. 단계 1.2에서와 같이 세포 수를 결정합니다. 단계 1.3에 지정된 각 시간 후 감염 1 × 10 7 세포를 사용합니다.
  2. 220 XG, 5 분 동안 4 ºC에서 세포를 원심 분리기.
  3. 빙냉 PBS에서 세포 펠렛을 재현 탁 (137 mM의 염화나트륨, 2.7 mM의 KCl을을, 10 mM의 나트륨 2 HPO 4 및 1.8 mM의 KH 2 PO 4). 세척 세포 펠렛S 세척 당 빙냉 PBS 5 mL를 이용하여 3 회. 이를 위해, 원심 분리기 (220) XG, 5 분, 4 캔트 ºC에서 세포 상등액 (SN)을 폐기하고, 부드럽게 피펫 팅하여 세포 펠렛을 재현 탁.
  4. 세포막을 파괴하기 위해, 700에서 세포 펠렛을 얼음 - 냉각 된 저장성 완충액 (L) (10 mM의 HEPES pH가 7.9, 10 mM의 KCl을 1.5 밀리미터의 MgCl 2, 0.5 mM의 DTT, 20 μ g / ㎖의 페닐 메틸 설 포닐 플루오 라이드 (PMSF)를 μ 재현 탁 10 μ g / ㎖ 소 췌장 트립신 저해제 10 μ는 g / ㎖ 펩 스타틴, 10 μ g / ml의 N 아세틸 L 로이 실 - L 로이 실 - L 포함한 시스테인, 세린, 트레오닌 및 아스파 틸 프로테아제 억제제의 혼합물 -argininal)과 세포를 3 시간 동안 얼음에 팽윤.
  5. 를 Lyse 헐렁한 A 형 테플론와 유 봉, 호모 게 나이저를 사용하여 세포. 스트로크와 밝은 필드 현미경으로 매 20 스트로크는 모든 세포가 용해되었는지 확인하는 모니터 샘플 다운스 (80) 수행하지만, 핵 N 가지고손상 또는 파손 된 오티.
  6. 300 XG, 5 분 동안 4 ºC에서 세포 파쇄 액을 원심 분리기. 원심 분리기 튜브 -20 ºC에서 세포질 분수로 SN을 저장합니다.
  7. 솔루션 1 (S1)의 750 μ L (에 재현 탁, 핵에서 펠렛을 세포 파편을 제거하려면 0.25 M 자당, 10 밀리미터의 MgCl (10)를 포함하여 2 ~ 20 μ g / ㎖ PMSF, 시스테인, 세린의 혼합물 쓰 레오 닌과 아스파 틸 프로테아제 억제제 μ g / ㎖ 소 췌장 트립신 저해제 10 μ g / ㎖ 펩 스타틴, 10 μ g / ml의 N 아세틸 L 로이 실 - L 로이 실 - L-argininal)과 용액 (2)의 동일 부피를 통해 층 (S2) (0.35 M 수 크로스, 0.5 밀리미터의 MgCl 2, 20 μ g / ㎖의 PMSF, 시스테인, 세린, 10 μ g / ㎖ 소 췌장 트립신 저해제 10 μ g / ㎖ 펩 스타틴, 10 μ 포함 트레오닌 및 아스파 틸 프로테아제 억제제의 혼합물 g / ㎖의 아세틸 N-L-L 로이 실 - 로이 실 - L-argininal). 하기 Centr1400 XG, 5 분 4 ºC에서 ifuge.
  8. 마이크로 피펫을 사용하여 SN을 폐기하십시오. 펠렛을 방해하지 마십시오.
  9. S2 750 μ 리터에 고립 핵을 함유하는 펠렛을 재현 탁.
  10. 아데노 RC (RCF) subnuclear 풍부 분획을 분리하기 위해, 5 분간 두 펄스를 이용하여, 초음파 욕 핵을 재현 탁하고, 초음파 처리, 또는 명 시야 현미경으로 관찰 된 바와 같이 모든 핵을 용해 될 때까지. C에서 4 ° 이하로 샘플을 유지하기 위해 필요에 따라 초음파 욕조에 얼음을 사용합니다.
  11. 용액 3 (S3)에서 3,000 XG (0.88 M 수 크로스, 0.5 밀리미터의 MgCl 2) 원심 분리기, 10 분 동안 4 ºC 동량 위에 초음파 핵 층을 포함한다. -70 ºC에서 nucleoplasmic 비율 (NPL)과 1.5 ml의 상층 액을 저장합니다. -70 ºC에서 RCF와 S2의 700 μ L의 펠렛 및 저장을 재현 탁.

RCF 3. 서양 얼룩의 분석

참고 : NPL과 RCF 분수 (S)의 웨스턴 블롯 분석을위한등은 제외 (640)는 고정 이하 여신에 대한 L 단계 2.11에서 얻은 총 볼륨에서 RCF 300 μ L를 μ.

  1. 5 분 95 ºC에서 15 μ 램 믈리 버퍼 2 배의 각 subnuclear 부분의 L (4 % SDS, 20 % 글리세롤, 10 % 2- 머 캅토 에탄올, 블루 0.004 % 브로 모 페놀, 0.125 M 트리스 염산의 pH 6.8)과 종기를 섞는다. 10 % 나트륨 도데 실 설페이트 - 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 20 밀리 암페어 (mA)에서 1.5 시간 동안 겔 분리 단백질 변성에 샘플을 로딩.
  2. 폴리 비닐 리덴 디 플루오 라이드 (PVDF) 막에 400mA에서 1.5 시간 동안 electroblotting에 의해 단백질을 전송합니다.
  3. RT는 PBS에 3 % 탈지 분유를 사용에서 2 시간 동안 막을 차단합니다.
  4. PBS / 0.3 % 탈지 분유 500 희석 : 1에서 바이러스 E2A의 DNA 결합 단백질 (B6-8 9)에 대한 일차 항체와 4 ºC에서 O / N을 품어.
  5. 3 회 PBS로 세척 막 / 0.1 %의 10 분 트윈 20.
  6. 마우스 항 IgG의 차와 멤브레인을 품어실온에서 2 시간 동안 PBS에서 10,000 희석 : tibody은 1에서 말 무 퍼 옥시 다제 (HRP)에 연결된다.
  7. PBS로 막 3 회 반복 / 0.1 % 트윈 20을 10 분 동안.
  8. 강화 된 화학 발광 및 X 선 필름을 사용하여 멤브레인을 개발한다.

RCF 4. 바이러스 DNA 검출

참고 : 두 NPL과 RCF 분수의 DNA 분리를 들어, 단계 2.11에서 얻은 총 부피의 RCF에 대한 NPL 210 μ L 100 μ L를 사용합니다.

  1. 단백질 분해 효소 K의 1 ㎎ / ㎖ 및 0.5 % 트윈 20과 55 ºC에서 1 시간 동안 하위 핵 분수를 품어.
  2. 95 ° C에서 10 분 동안 샘플을 배양하여 단백질 분해 효소 K 불 활성화.
  3. 2 분 동안 실온에서 20,000 XG에서 샘플을 원심 분리기.
  4. (SN)를 수집합니다. 4 ℃에서 3M 아세트산 나트륨 1/10 부피의 이소프로판올을 하나의 볼륨, O / N로 DNA를 침전.
  5. 실온에서 10 분 동안 20,000 XG에서 원심 분리.
  6. SN의 U 폐기마이크로 피펫을 노래. 20,000 XG, 5 분 동안 4 ° C에서 70 % 에탄올과 원심 분리기와 펠렛을 씻으십시오.
  7. 10 mm의 10 μ 리터에서 DNA를 재현 탁 트리스 -HCl pH 7.4의
  8. 260 nm에서 광학 밀도 (OD)를 측정하여 분광 광도계를 사용하여 DNA를 정량.
  9. 바이러스 성 DNA를 증폭 뉴클레오티드 7273에서, 주요 늦은 전사 부 내의 영역의 증폭을 허용 프라이머 반응 부피의 25 μ 리터에서의 Taq DNA 폴리머 라제를 사용하여 표준 PCR 반응에서 각 subnuclear 분획으로부터 DNA 100 ng의를 사용하여 염기 7353 (81 BP) FW (: GAGCGAGGTGTGGGTGAGC;, 계 : GGATGCGACGACACTGACTTCA). 95 ºC에서 3 분의 초기 변성, 20 증폭 (95 ºC 72 ºC에서 30 초 62 ºC에서 1 분간 열처리 및 확장시 1 분)의 사이클에 대한 최종 확장 단계 다음에 다음주기 조건을 사용하여 72 ºC에서 3 분.
  10. 티듐 90 V. 얼룩에, 2 % 아가 로스 젤에서 PCR 생성물을 실행할0.5 μ g / ml의 최종 농도 브롬화물과 RCF에서 바이러스 DNA 농축을 확증하기 위해 DNA를 시각화. 이 화합물은 강력한 돌연변이이기 때문에, 장갑을 착용해야합니다 항상 세심한주의와 에티 디움 브로마이드를 처리합니다. 제도적 지침에 따라 에티 디움 브로마이드를 폐기 할 것.

RCF 5. 늦은 바이러스 mRNA를 검출

참고 : 두 NPL과 RCF 분수에서 RNA 분리를 들어, 단계 2.11에서 얻은 총 볼륨에서 RCF에 대한 고정 이하 여신에 대한 640 μ L 300 μ L를 사용합니다.

  1. 제조업체의 지침에 따라 트리 졸 사용 subnuclear 분수에서 RNA를 분리합니다. DEPC (diethilpyrocarbonate) 처리 된 물 50 μ L의 RNA를 재현 탁.
  2. 260 nm에서 OD를 측정하는 분광 광도계를 사용하여 RNA를 정량화 (약 3 μ g를 얻을 수있다). 50 NG에서 RNA를 저장 / -70 ºC에서 L 씩을 μ.
  3. 정제 된 RNA를 확인전체 RNA의 5 NG 단계 4.9에 기재된 사이클 조건을 이용하여, 역전사 효소 (RT)의 부재하에 제어 PCR 반응을 수행하여 DNA 오염의 부재에 대한.
    1. DNA 오염이 존재하지 않는 경우에는 증폭 물이 생성 될 수 없습니다. DNA 오염이 존재하면, 10 U의 RNase 억제제 10 U의 DNase I, 0.1 M 트리스 -HCl pH를 8.3, 0.5 M KCl을 37 ºC에서 30 분 동안 15 밀리미터의 MgCl 2 샘플을 배양. 단계 5.1에서와 같이 RNA를 다시 분리로 이동합니다.
  4. RCF 연관 바이러스의 mRNA를 분석하기 위해, 다른 유전자 군 (표 1)에서 아데노 바이러스 후기의 mRNA를 검출하기위한 프라이머를 사용하여 RT-PCR에 의해 각각 subnuclear 분획으로부터 100 ng의 RNA를 증폭한다.
    1. 역전사 (RT)에 대해, 42 ºC에서 1 시간, 70 ºC에서 10 분 동안 반응 부피의 20 μ 리터에 M-MuLV RT 효소를 이용하여 표준 RT 반응시 각 subnuclear 분획으로부터, RNA 100 NG를 사용한다.
    2. 증폭, 1을 사용단계 4.9에서와 같이 PCR 반응에서 cDNA를 μ 리터. 증폭의 25주기 다음 95 ºC에서 3 분의 초기 변성 (95 ºC에서 1 분, 어닐링 72 ºC에서 30 초 동안 표 1 및 확장에 지정된 온도에서 1 분)와 다음주기 조건을 사용하여 72 ºC에서 3 분 최종 확장 단계.
  5. μ는 0.5 g / ml의 최종 농도에 티듐 브로마이드 90 V. 얼룩 겔에서 2 % 아가 로스 젤에서 RT-PCR 산물을 실행하고 RCF로 바이러스 늦은 mRNA의 연관을 확증하기 위해 시각화. 단계 4.10에 표시된대로 에티 디움 브로마이드를 처리합니다.

RCF 6. 면역 형광 시각화

주 : 반출 절차를 층류 캐비닛 아래의 먼지 입자와 함께 샘플의 오염을 방지하고, 사용 전에 모든 솔루션을 필터링.

  1. 스팟 5 단계에서 얻어진 디레 2.10 RCF 분획을 L μctly 실란 코팅 슬라이드.
  2. 실온에서 약 5 분 동안 자리를 건조 보자.
  3. 다시 수화물 천천히 간접적으로 RCF 지점 옆에 드롭 PBS의 500 μ 리터를 피펫 팅하고 슬라이드를 기울여 흐름 시켜서. 측면에서 초과 PBS를 배출합니다.
  4. RT에서 2 시간 동안 PBS / 5 % 소 혈청 알부민의 500 μ 리터 (BSA) 시료를 피복하여 블록.
  5. 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅하여 슬라이드 3 회 반복한다. 초과 PBS를 배출 슬라이드를 기울.
  6. 실온에서 2 시간 동안 PBS에 희석 500 : 1에서 바이러스 E2A의 DNA 결합 단백질 (B6-8 9)에 대한 일차 항체와 샘플을 품어. 항체 용액의 20 μ 리터와 발견 샘플을 커버하고 건조를 방지하기 위해 습한 챔버에서 배양한다.
  7. 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅에 의해 PBS / 0.02 % 트윈 20 샘플을 3 회 반복한다. 전 오프 드레인 슬라이드를 기울운 세척 솔루션입니다.
  8. 4 ºC에서 1 시간 동안, PBS에서 2,000 희석 : 1에서 488 nm에서 여기되는 형광체에 결합 된 마우스 항 IgG를 이차 항체로 샘플을 품어. 항체 용액의 20 μ 리터와 발견 샘플을 커버하고 건조를 방지하기 위해 습한 챔버에서 배양한다.
  9. 부드럽게 간접적 샘플에 PBS 500 μ L을 피펫 팅에 의해 PBS / 0.02 % 트윈 20 샘플을 3 회 반복한다. 초과 세척 용액을 배출 슬라이드를 기울.
  10. 중간 장착 2- μ L PBS / 10 % 글리세롤을 사용하여 커버 슬립으로 슬라이드 발견 샘플을 커버. 명확한 매니큐어 및 저장 등 -20 ºC와 인감.
  11. 63X 대물 렌즈 및 488 nm의 파장에서 1.4 NA를 (NA)와, 형광 현미경을 이용하여 샘​​플을 분석한다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

바이러스 복제 용 구획 (RC)는 단백질과 다른 핵 도메인 유사한 핵산 이루어지는 subnuclear 바이러스 - 유도 된 구조이기 때문에, 그들은 생화학 적 특징에 기초하여 속도 구배에 의해 분리 의무가 것을 알았다. 분별 프로토콜의 중요한 단계는 샘플이 다른 서브 세포 분획의 무결성을 보장하기 위해 명 시야 현미경으로 관찰 할 필요가 각 단계에서,도 1에 도시되어있다. 세포를 팽창 할 때 예를 들어, 저장성 완충액 배양 시간은 핵의 손상을 방지 세포질을 팽창하기 위해 표준화 될 필요가있다. 소포체 막 포함 세포질 구성 요소를 무료로 휴대 균질화 그대로 핵, 후, 획득해야합니다. 또한, 초음파 처리 시간은 RC 중단없이 모든 세포의 핵막을 파열시키기 위해 표준화 될 필요가있다.

하위 핵 분획을 얻은 후, 키컨트롤은 RCF에서 협회와 선의의 RC 마커의 농축을 결정하기 위해 포함 할 필요가있다. 아데노 바이러스는 통상적으로 RC 바이러스 E2A-72K 단백질 (DBP)에 대한 항체를 이용하여 면역 형광에 의해 감염된 세포 내에서 가시화된다. DBP는 바이러스 게놈의 복제에 직접 참여하는 바이러스 단백질; 도 1에 도시 된 바와 같이, 따라서, RCF 농축 입자 DBP의 존재, 절연 입자 이러한 바이러스 단백질의 직접적인 연관을 보여준다. 또한, 웨스턴 블롯에 의해 RCF에서 DBP의 검출은 절연이 단백질의 연관을 확인 RC. 그림 2에서 그것은 RC는 후 감염이 시간 예상을 반영 서로 다른 시간에이 절차를 얻을 수 있음을 보여주는 늦게 시간 후 감염 (36 HPI)에 의해, DBP는 nucleoplasmic 비율 (NPL)에 비해 RCF에 농축되는 것을 알 수있다 RC에 DBP 협회의 패턴. RC의 필수적인 구성 요소는 바이러스의 DNA 바이러스이다 itseLF. 도 3에 도시 된 것과 같은 실험에서는 바이러스 복제주기가 진행됨에 따라 RCF와 바이러스 DNA 부수의 증가 양은, DBP 대로서,이 분획에서 DNA 복제의 시간적 패턴도 연구 될 수 있음을 나타내는 것을 보여준다.

바이러스 단백질 및 바이러스 게놈을 함유하는 외에, RC는 늦은 바이러스 유전자 발현의 부위도이다. 그림 4에서 우리는 RT-PCR에 의해 바이러스 늦게 mRNA의 36 HPI에서 RCF와 네팔 사이에 자신의 인종 차별의 다양한 종의 수준을 측정하기위한 실험의 대표적인 결과를 제시한다. 바이러스 성 후반의 mRNA는 RC에서 합성과 postranscriptional 처리는 다음 사이트에서 시작된다 나중에 이러한 바이러스의 mRNA는, RC에서 해리 핵질을 해방하고, 이후 세포질에 수출하고 있습니다. 성숙한 바이러스 mRNA의 후반의 전체 풀 (ML mRNA 발현), 삼자 리더 엑손 접합부를 증폭 프라이머를 사용하여 측정했다모든 아데노 바이러스 후반의 mRNA (그림 4A)의 '5를 구성하는 순서. (L2)의 특정 성숙 성적 증명서의 mRNA의에서 엑손 접합은, L4와 L5 가족도 측정 하였다. 그것은 바이러스 성 복제주기의 후기가 진행됨에 따라, 바이러스 후반의 mRNA의 양이 증가가 세포질에 수출되어 설립되었습니다; 그러나, L5의 mRNA 종의 늦은 시간 생산 늦은 다른 mRNA의 가족들과 비교하여 더욱 증가. 예상대로 그림 4에 뿌려 대표적인 결과에 ML의 mRNA의 약 2.5 배 차이, RCF와 비교 NPL에서 관찰된다. 우리가 특정 가족에서의 mRNA를 비교할 때 흥미롭게도, L2 및 L4 mRNA의 양이 모두 subnuclear 분수 (그림 (b)와 C, 각각) 사이에 비슷한 수준으로 분포 한 것으로 나타났습니다,하면서 대조적으로, L5의 mRNA는 NPL에 거의 2 배 증가를 보였다 RCF와 비교. 이러한 결과는 SY의 차분 패턴을 제안 nthesis 및 아데노 RC에서 다른 바이러스 mRNA를 늦게 종의 해방 (10 이전에 제안 된 바와 같이). 현저하게, 이러한 결과는 또한 바이러스의 mRNA의 생합성에서 상이한 단계의 정확한 측정이 새로운 절차와 격리 RC를 이용하여 수행 될 수 있음을 보여준다.

그림 1
분류 과정 동안 상이한 단계의도 1 명 시야 현미경. RC의 분리 중에 샘플 서브 세포 분획의 무결성을 보장하기 위해 광학 현미경으로 관찰 할 필요가있다. 도 자당 쿠션을 통해 핵의 분리 및 단리에 RCF, HFF 셀의 팽윤 RCF를 얻는 절차에 사용되는 단계를 도시한다. 40 배 현미경 : 스케일 바 50 μ M; 63X 현미경 : 눈금 막대 5 μ M; DBP는 녹색으로 표시됩니다.TPS : //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "대상 ="_ 빈 ">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2. DBP에 대한 서양의 얼룩. 샘플 SDS-PAGE에 의해 분석 및 DBP, 바이러스 성 RC의 선의의 마커에 대한 서양 얼룩에 대한 처리됩니다. RCF에서 단백질의 농축을 결정하기 위해서는 서로 다른 시간 후 감염에 RCF와 NPL 모두 존재와 DBP의 상대 풍부을 비교하는 데 유용합니다. HFF 세포에서 16 HPI는 아데노 바이러스 복제주기 동안 초기 시간을 나타내고; 24 HPI는 감염 바이러스의 DNA 합성이 시작으로의 늦은 위상 천이를 표시한다; 36 HPI는 늦은 시간 후 감염을 나타냅니다. DBP의 예상 분자량이 표시됩니다. CLIC하세요이 그림의 더 큰 버전을 보려면 여기를 케이.

그림 3
그림 3. PCR 분석은 24, 36 HPI에서 RCF 및 고정 이하 여신에서 정제 RCF. DNA에서 바이러스 DNA (vDNA)을 감지한다. DNA 바이러스는 바이러스 게놈에 특이적인 프라이머를 사용하여 PCR에 의해 증폭시켰다. 그래프는 36 HPI에서 RCF에서 바이러스 DNA의 농축을 보여줍니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
..도 4 바이러스 늦은 mRNA의 RNA의 분석 RCF와 NPL로부터 단리 및 특정 바이러스 후반의 mRNA를 검출하기 위해 RT-PCR에 의해 분석 하였다 (A) 전체 바이러스 후기의 mRNA (ML : 주요 후기) L 행 (B)의 mRNA2 가족, L4 가족 (C)의 mRNA, L5 가족 (D)의 mRNA. 값은 평균 ±에게 세중 샘플의 표준 편차를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

이름 정방향 프라이머 서열 (5'-3 ') 역방향 프라이머 서열 (5'-3 ') 어닐링 온도
ML의 mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
(L2)의 mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
(L4)의 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5의 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. 바이러스 성 늦은 mRNA의 증폭 ML의 mRNA에 사용되는 표 1. 프라이머 :이 프라이머는 노사정 지도자 내의 영역의 증폭을 허용, 모든 바이러스 후반의 mRNA에 공통적 인 5 '순서; L2 mRNA의 프라이머는 태양 광 내의 mRNA의 특정 영역의 증폭을 허용; L4 mRNA의 프라이머는 100 K의 mRNA 내의 특정 영역의 증폭을 허용; L5의 mRNA는 mRNA의 섬유 내의 영역의 증폭을 허용한다. 각 꼼꼼한의 순서 및 어닐링 온도어 표시됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics