Adenovirüs ile enfekte Normal İnsan Hücreleri Viral Çoğaltma Bölme zenginleştirilmiş Alt nükleer Kesirler izolasyonu

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenovirüsler, enfekte hücre çekirdeğinde replike olan bir çift sarmallı DNA genomunu içerir. Viral DNA çekirdeği girdiğinde, PML nükleer organları 1 bitişik lokalize. Viral erken gen ifadesinin ardından, nükleer mimarisi dramatik olarak adlandırılan viral mikroçevrelerde oluşumunu uyaran, yeniden düzenlenir viral çoğaltma Bölmeler (RC) 2. Adenovirüs (Ad) RC viral genomun replikasyonu ve viral geç genlerinin sentezlenmesi gerçekleşecek siteleri olduğundan, bu süreçlere katılmak için gerekli tüm viral ve hücresel faktörlerin alımı için bir ortam sağlar. İlginç bir şekilde, örneğin DNA hasar cevap olarak hücresel antiviral yanıt sorumlu olan hücresel proteinlerin, çeşitli doğal immün cevabı ve tümör bastırma yandaşlaştırılmıştır bu viral sitelerinin 2 için vardır. Eş zamanlı olarak düzenlenmesi sırasında etkin viral replikasyon teşvik Dolayısıyla, Reklam RC kabul edilebilir düzenleyici hubBu yapıların virüs konak hücre etkileşimleri anlamak için anahtar olduğunu belirten hücresel antiviral yanıt. Bununla birlikte, RC oluşumunun moleküler mekanizmalar, bunların kompozisyonu ve ilgili faaliyetler tam olarak anlaşılamamıştır.

Çekirdeğin içinde replike diğer DNA virüslerinden adenoviral RC, hem de RC sitoplazmik RC 3 aksine, membranlara ilişkili değildir. Ayrıca, bu virüs kaynaklı yapıların protein ve nükleik asitlerin bütünüyle oluşan olması muhtemeldir. RNA virüsleri ile enfekte edilmiş hücrelerde oluşan RC, ayrıntılı morfolojik ve fonksiyonel ve biyokimyasal karakterizasyonu 4 kolaylaştırmıştır sitoplazmik lokalizasyonu ve membrana bağlı durum, yararlanarak, izole edilmiştir (genellikle viral fabrikaları olarak da adlandırılır).

Bildiğimiz kadarıyla, nükleer viral RC belki de intranükleer m nükleer mimarisi ve yokluğu karmaşıklığı, izole edilmemişOnların izolasyon kolaylaştıracak embranes. Onların çalışma yerine mikroskobik, FISH ve transmisyon elektron mikroskobu güvendi. Ancak, subnuclear yapıların izole doğasında komplikasyonları rağmen, bu tür nukleoli ve Cajal Organları gibi diğer nükleer etki 5,6 öncesinde izole edilmiştir. Çekirdekçikler ve RC her iki protein ve nükleik asitten oluşan ve 0.5 arasında bir çapa sahip olması nedeniyle - 5 um, RC de izolasyon için uygun olmalıdır varsayıldı. Bu nedenle, daha kesin olarak RC ilişkili moleküler bileşim ve fonksiyonlarını karakterize etmek amacıyla biz RC ile zenginleştirilmiş çekirdek içi kısımlar izole etmek için yeni bir yöntem kurulmuştur. Bu amaçla, nükleollü 7 ya da diğer nükleer etki 6 izole etmek için kullanılan prosedürlerin benzer hız gradyanları ve sükroz yastıkları kullanılarak çekirdek altı fraksiyonlar hazırlandı ve moleküler bileşimin çalışma ve ilişkili aktiviteleri sağlayan bir hücre içermeyen bir sistem kurulmuşturRC. Bu teknik, bu nedenle virüs konak hücre etkileşimleri anlayışı ilerletmek ve aynı zamanda çekirdeğinde çoğaltmak diğer virüslerden RC ayrıntılı analizini kolaylaştırmak ve adenovirüs- oluşan benzer boyutlardaki çoğaltma bölmelerinin oluşumuna neden gereken güçlü bir araç temsil etmelidir örneğin, herpes, papilloma ya polyomavirusları olarak enfekte olmuş hücreleri.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Hücre Kültürü ve Ad-enfeksiyon

  1. Daha önce tarif edildiği gibi, 8 HFF hücreleri üzerinde floresan oluşturucu birim (FFU) halinde HEK-293 hücrelerinden ve titre mono tabakaları Ad5 WT virüsü yayar.
  2. Nemlendirilmiş bir kuluçka makinesi içinde DMEM /% 10 fetal sığır 37 ° C'de steril kültür 100 mm'lik tabaklar içerisinde serum (FBS) ve% 5 CO2, 10 ml insan alın derisi fibroblastları (HFF) büyütün. Dört 16 kare setleri hücreleri sayılarak bir Neubauer odasına kullanarak hücre sayısını belirler. Ml başına hücre sayısı dört 16-kare setleri hücrelerin ortalama sayısını hesaplamak ve 10 4 ile bu sayı çarpımı ile elde edilir. Adımda 1.3 dahil her zaman sonrası enfeksiyon için, 1 x 10 7 HFF hücreleri kullanın.
  3. Mock-enfekte oluşturucu birim 30 odak MOl'de tabak başına DMEM Ad5 1 ml ile 100 mm doku kültürü çanakları içinde adenovirüs tip 5 (Ad5) vahşi-tipi (WT) (H5pg4100 8) ile HFF hücreleri enfekte veya FFU veya hücre başına. Ah 2 saat süreyle inkübe edindikkatle yemeklere her 15 dakikada bir sallanan umidified 37 ° C'de hücre kültürü inkübatörü% 5 CO2, hücreleri üzerinde virüs aşı maddesi homojen bir dağılım sağlamak için. Bu süre sonunda, ortam çıkarın ve% 10 FBS ile desteklenmiş taze DMEM ve CO2 37 ° C'de nemlendirilmiş bir hücre kültürü inkübatöründe 16, 24 ya da 36 saat süreyle inkübe edilir ve% 5. 2.1 adıma geçin.

Adenovirüs RC ile zenginleştirilmiştir Alt nükleer Kesirler 2. Hazırlık

  1. Hasat Ad5-enfekte veya hücre kavgacı ile sahte enfekte HFF hücreleri ve steril santrifüj tüplerine hücreleri toplamak. Adım 1.2 olarak hücre sayısını belirler. Adım 1.3 'de belirtilen her zaman sonrası enfeksiyon için 1 x 10 7 hücre kullanın.
  2. 220 x g'de 5 dakika boyunca 4 ° C'de santrifüj hücreleri.
  3. Buz soğukluğunda PBS hücre pelletini (137 mM NaCI, 2.7 mM KCI, 10 mM Na-2 HPO 4 ve 1,8 mM KH 2 PO 4). Yıkama Hücre peletis, yıkama başına buz soğukluğunda 5 ml PBS ile 3 kez. Bu amaçla, santrifüj 220 x g'de 5 dakika, tortusundan 4 ° C'de hücreleri ve yüzer (SN) atmak ve nazik pipetleme hücre pelletini.
  4. Plazma membranını bozmak için, 700 hücre topağı buz soğukluğunda hipotonik tampon maddesi (10 mM HEPES pH 7.9, 10 mM KCI, 1.5 mM MgCI2, 0.5 mM DTT, 20 μ ug / ml fenilmetilsülfonil florid (PMSF) u tekrar süspansiyon , 10 μ / ml sığır pankreatik tripsin inhibitörü, 10 μ ug / ml pepstatin A ve 10 μ ug / ml N-asetil-L-leusil-L-leusil-L dahil olmak üzere sistein, serin, treonin ve aspartil proteaz inhibitörlerinin bir karışımı, -argininal) ve hücreler 3 saat boyunca buz üzerinde şişmesi sağlar.
  5. Lyse bir gevşek A tipi teflon havan ile homojenleştirici kullanılarak hücreler. Vuruşları ve parlak alan mikroskobu ile her 20 vuruş tüm hücreleri parçalanmış edilmiş olmasını sağlamak için monitör örneklerinin Dounce 80 gerçekleştirin, ancak çekirdekler n varhasarlı veya kopmuş ot.
  6. 300 x g'de 5 dakika boyunca 4 ° C'de, hücre homojenatı santrifüjleyin. Bir santrifüj tüpüne -20 ºC 'de sitoplazmik fraksiyon olarak SN saklayın.
  7. Çözelti 1 (S1) 750 μ l (tekrar süspansiyon, çekirdeklerden pelet, selüler artığın ayrılması için 0.25 M sukroz, 10 mM MgC 10 de dahil olmak üzere 2 ila 20 μ / ml PMSF, sistein, serin, bir treonin ve kanşım aspartil proteaz inhibitörleri μ ug / ml sığır pankreatik tripsin inhibitörü, 10 μ ug / ml pepstatin A ve 10 μ ug / ml N-asetil-L-leusil-L-leusil-L-argininal) ve çözelti, 2 eşit bir hacmi boyunca tabaka (S2) (0.35 M sukroz, 0.5 mM MgCI2, 20 μ / ml PMSF, sistein, serin, 10 μ / ml sığır pankreatik tripsin inhibitörü, 10 μ ug / ml pepstatin A ve 10 μ içeren treonin ve aspartil proteaz inhibitörlerinin bir karışımı, ug / ml N-asetil-L-leusil-L-leusil-L-argininal). Centr1400 x g'de 5 dakika boyunca 4 ° C'de ifuge.
  8. Bir mikropipet kullanarak SN atın. Pelet rahatsız etmemek.
  9. S2 750 μ l izole çekirdek içeren pelletini.
  10. Adenovirüs RC (RCF) ile zenginleştirilmiş çekirdek içi fraksiyonları izole edilmesi için, iki adet 5 dakikalık darbeleri kullanılarak, ultrasonik bir banyoda çekirdekler yeniden süspansiyon haline ses dalgalarına maruz veya parlak alan mikroskopisi ile gözlendiği haliyle, tüm çekirdek lize kadar devam eder. C ya da 4 ° altında örnekleri tutmak için gerektiğinde ultrasonik banyoda buz kullanın.
  11. Çözelti 3 (S3) 3000 xg'de (0.88 M sukroz, 0.5 mM MgCl2) ve santrifüj, 10 dakika boyunca 4 ° C eşit hacimde üzerinde sonike çekirdekleri katman. -70 ºC nucleoplasmic fraksiyonu (Npl) olarak 1.5 ml süpernatant saklayın. -70 ºC RCF olarak S2 700 μ l pelet ve mağaza tekrar.

RCF 3. Western Blot Analizleri

Not: TGA ve RCF fraksiyonlar s Western Blot analizi içinet kenara 640 Npl için l ve adım 2.11 elde edilen toplam hacim gelen RCF 300 μ l u.

  1. 5 dakika boyunca 95 ° C 'de 15 μ Laemmli tamponu 2x, her çekirdek içi fraksiyonun l (% 4 SDS,% 20 gliserol,% 10 2-merkaptoetanol,% 0.004 bromofenol mavisi, 0,125 M Tris-HCl, pH 6.8) ve kaynatın karıştırın. Bir% 10 sodyum dodesil sülfat-poliakrilamid jel elektroforezi (SDS-PAGE) 20 miliamperlik (mA), 1.5 saat için jel ve ayrı proteinleri denatüre örnekleri yükleyin.
  2. Poliviniliden diflorür (PVDF) membran üzerinde 400 mA'da 1.5 saat elektro proteinleri aktarın.
  3. RT PBS içinde% 3 yağsız kuru süt ile 2 saat boyunca zarın bloke eder.
  4. PBS /% 0.3 yağsız kuru süt 500 seyreltme: 1 viral E2A DNA-bağlama proteini (B6-8 9) karşı birincil antikor ile 4 ° C 'de O / N inkübe edin.
  5. 3 kez PBS ile yıkayın membran /% 0.1 Tween 10 dakika boyunca 20.
  6. Fare anti IgG sekonder AN membran inkübeoda sıcaklığında 2 saat süreyle PBS içinde 10.000 seyreltme: tibody Bir 1 at turpu peroksidaz (HRP) bağlanmış.
  7. PBS ile membrana 3 kez yıkayın /% 0.1 Tween 20 10 dakika karıştırıldı.
  8. Gelişmiş kemilüminesans ve X-ışını filmleri kullanılarak membran geliştirin.

RCF 4. Viral DNA tespiti

NOT: Her iki TGA ve RCF fraksiyonlardan, DNA izolasyonu için aşama 2,11 'de elde edilen toplam hacminin RCF için Npl 210 μ l ve 100 μ l kullanın.

  1. Proteinaz K, 1 mg / ml ve% 0.5 Tween 20 ile 55 ° C 'de 1 saat süre ile çekirdek altı fraksiyonlar inkübe edin.
  2. 95 ° C 'de 10 dakika boyunca inkübe edilerek örnekleri proteinaz K inaktive.
  3. 2 dakika boyunca oda sıcaklığında, 20,000 x g'de santrifüjleyin örnekleri.
  4. SN toplayın. 4 ° C 'de 3M sodyum asetatın 1/10 hacmi ve bir izopropanol hacminin, O / N-DNA çökeleği.
  5. 10 dakika boyunca oda sıcaklığında, 20,000 x g'de santrifüjleyin örnekleri.
  6. SN u atınmikropipet şarkı. 20.000 x g'de 5 dakika boyunca 4 ° C 'de% 70 etanol ve santrifüj ile pelet yıkayın.
  7. 10 mM, 10 μ l DNA yeniden süspanse Tris-HCI pH 7.4
  8. 260 nm'de optik yoğunluğu (OD) ölçmek suretiyle bir spektrofotometre kullanılarak DNA ölçmek.
  9. Viral DNA'yı büyütmek için, nükleotid 7273 ile ilgili, Geç Temel transkripsiyon birimi içindeki bir bölgenin yükseltilmesine olanak sağlayacak primerler ile reaksiyon hacmi 25 μ l, Taq DNA polimeraz kullanılarak, standart bir PCR reaksiyonunda, her çekirdek içi fraksiyondan DNA 100 ng kullanmak için Nükleotid 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). 95 ° C 'de 3 dakika boyunca ilk denatürasyon, 20 amplifikasyon (95 ° C, 72 ° C' de 30 saniye boyunca 62 ° C 'de 1 dakika boyunca tavlama ve uzatma 1 dakika) devirlik bir son uzatma adımı ile takip aşağıdaki döngü koşulları kullanarak 72 ºC'de 3 dak.
  10. Etidyum 90 V. Stain de,% 2 agaroz jelleri içinde PCR ürünü başlat0.5 μ ug / ml son konsantrasyonda bromür ve RCF viral DNA zenginleştirme doğrulamak için DNA görselleştirmek. Bu bileşik güçlü bir mutajen olduğu gibi, eldiven giymek emin olun her zaman çok dikkatli etidyum bromür Kulp ve. Kurumsal kurallarına göre etidyum bromür atınız.

RCF 5. Geç Viral mRNA Algılama

NOT: Her iki Npl ve RCF fraksiyonlardan RNA izolasyonu için, adım 2.11 'de elde edilen toplam hacim gelen RCF için Npl için 640 μ l ve 300 μ l kullanın.

  1. Üreticinin talimatlarına uygun olarak Trizol kullanarak subnuclear fraksiyonlardan RNA izole. DEPC (diethilpyrocarbonate) enjekte edilmiş su 50 μ l RNA süspanse edin.
  2. 260 nm'de OD ölçümü için bir spektrofotometre kullanılarak RNA niceliğini (yaklaşık 3 μ g elde edilir). 50 ng RNA Mağaza / -70 ºC sıcaklıkta l alikotları u.
  3. Saflaştırılmış RNA kontrol5 ng toplam RNA ve aşama 4,9 tarif edilen döngü koşulları kullanılarak, ters transkriptaz (RT) yokluğunda bir kontrol PCR reaksiyonunun gerçekleştirilmesi ile DNA kontaminasyonu yokluğu.
    1. DNA kontaminasyonu yok ise herhangi bir amplikon üretilmelidir. DNA kontaminasyonu mevcut ise, 10 U RNaz inhibitör 10 U DNase I, 0.1 M Tris-HCI pH 8.3, 0.5 M KCl ve 37 ° C 'de 30 dakika boyunca 15 mM MgCl2 ile örnekleri inkübe edin. Adım 5.1 olarak RNA yeniden izole etmek için devam edin.
  4. RCF ilişkili viral mRNA analiz etmek için, farklı gen ailesine (Tablo 1), adenoviral Geç mRNA tespit etmek için tasarlanmış primerler kullanılarak, RT-PCR ile, her çekirdek içi fraksiyondan RNA 100 ng yükseltmek.
    1. Ters transkripsiyon (RT) için, 42 ° C 'de 1 saat boyunca karıştırılır ve 70 ° C' de 10 dakika boyunca, reaksiyon hacmi 20 μ l M-MuLV RT enzim kullanılarak, standart RT reaksiyonunda, her çekirdek içi fraksiyondan, RNA 100 ng kullanımı.
    2. Yükseltilmesi için, 1 kullanınAşama 4.9 PCR reaksiyonları, cDNA μ l. Amplifikasyon 25 döngü izledi 95 ° C 'de 3 dakika boyunca ilk denatürasyon (95 ° C'de 1 dakika, tavlama 72 ° C'de 30 saniye için Tablo 1 ve uzatma belirtilen sıcaklıkta 1 dakika süre ile) ve aşağıdaki döngü koşulları kullanarak 72 ° C 'de 3 dakika boyunca son bir uzatmadan oluşmuştur.
  5. 0.5 μ ug / ml son konsantrasyonda etidyum bromür ile 90 V Leke jeller% 2 agaroz jelleri RT-PCR ürünleri, çalıştırmak ve RCF viral mRNA geç ilişki doğrulayacak görselleştirmek. Adımda 4.10 belirtildiği gibi etidyum bromür tutun.

RCF 6. İmmünofloresan Görselleştirme

NOT: Carry-out bu yordamı bir laminer akış kabini altında herhangi bir toz parçacıkları ile numunelerin kontaminasyonu önlemek ve kullanmadan önce tüm çözümleri filtre.

  1. Nokta 5 adımda korkunç 2.10 elde edilen RCF kısmının l uctly silan kaplı slayt.
  2. Oda sıcaklığında yaklaşık 5 dakika boyunca nokta kurumasını bekleyin.
  3. Yeniden hidrat yavaş ve dolaylı RCF nokta yanında bir damla PBS 500 μ l pipetle ve slayt eğerek akış sağlayarak. Taraftan aşırı PBS boşaltın.
  4. Oda sıcaklığında 2 saat süre ile PBS /% 5 bovin serum albümini 500 μ l (BSA) ile örnek kaplayarak Blok.
  5. Nazikçe ve dolaylı olarak numune üzerine PBS 500 μ l pipetle slayt 3 kez yıkayın. Aşırı PBS tahliye etmek slayt eğin.
  6. Oda sıcaklığında 2 saat süreyle PBS içinde 500 seyreltme bir 1: viral E2A DNA-bağlama proteini (B6-8 9) karşı birincil antikor ile numuneyi inkübe edin. Antikor çözeltisi 20 μ l tespit örnek örtün ve kurumasını önlemek için nemli bir oda içinde inkübe edilir.
  7. Yumuşak ve dolaylı numune üzerine 500 ul PBS μ l pipetleme PBS /% 0.02 Tween 20 ile numune 3 kez yıkayın. Eski kapalı drenaj slayt yatırıncess yıkama çözeltisi.
  8. 4 ° C 'de 1 saat süre ile, PBS içinde 2000 seyreltme: 1 ile 488 nm'de uyarıldı bir flüorofora bağlı fare anti IgG sekonder antikor ile inkübe edin. Antikor çözeltisi 20 μ l tespit örnek örtün ve kurumasını önlemek için nemli bir oda içinde inkübe edilir.
  9. Yumuşak ve dolaylı numune üzerine 500 ul PBS μ l pipetleme PBS /% 0.02 Tween 20 ile numune 3 kez yıkayın. Fazla yıkama solüsyonu boşaltmak için slayt eğin.
  10. Orta montaj olarak 2 μ PBS /% 10 gliserol kullanılarak bir lamel ile slayt üzerine tespit örnek örtün. Net oje ve mağaza el -20 ºC ile mühür.
  11. 63x objektif ve 488 nm'lik bir dalga boyunda bir 1,4 Sayısal açıklık (NA) ile, bir floresans mikroskobu kullanılarak örnekleri analiz edin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Viral replikasyon bölme (RC), protein ve diğer nükleer etki benzer nükleik asitten oluşan çekirdek içi virüslerin neden olduğu yapılar olduğu için, bu biyokimyasal özelliklerine göre hız gradyanları ile izolasyon için uygun olduğu kanıtlanmıştır. Fraksiyonlara protokol Kritik adımlar örnekleri farklı alt-hücresel fraksiyonların bütünlüğünü sağlamak için parlak bir alan mikroskobu ile izlenmesi gereken adım her birinde Şekil 1'de gösterilmiştir. Hücreler şişen Örneğin, hipotonik tampon maddesi içinde inkübasyon süresi çekirdeklere zarar gelmesini de önler sitoplazma şişmeye üzere standardize edilmelidir. Endoplazmik retikulum zarlarını içeren sitoplazmik maddelerden serbest hücre homojenizasyonu, sağlam çekirdekler, sonra, elde edilen gerekmektedir. Ayrıca, sonikasyon süresi RC bozmadan tüm hücrelerin nükleer membran rüptürü için standardize edilmesi gerekmektedir.

Çekirdek altı fraksiyonlarını elde etmek sonra anahtarkontroller RCF içinde dernek ve iyi niyetli bir RC belirteçlerinin zenginleştirme belirlemek için dahil edilmesi gerekir. Adenoviral RC yaygın viral E2A-72K protein (DBP) karşı antikorlar kullanılarak immünofloresans, enfekte olmuş hücreler içinde görülür. DBP viral genomun replikasyonu doğrudan katılan bir viral proteinidir; Şekil 1 'de gösterildiği gibi, bu nedenle, RCF zenginleştirilmiş parçacıklar içinde DBP varlığı, izole edilmiş parçacıklar ile viral proteinin doğrudan ilişki gösterilmiştir. Ayrıca, Western Blot ile RCF DBP tespiti izole bu proteinin bir ilişki olduğunu doğrulamaktadır RC. Şekil 2'de, RC Enfeksiyondan zamansal beklenen yansıtan farklı zamanlarda Bu prosedür ile elde edilen gösteren geç katı enfeksiyondan (36 HPI) ile DBP nucleoplasmic fraksiyonu (Npl) ile karşılaştırıldığında RCF içinde zenginleştirilmiş olan gösterilmiştir RC DBP dernek desen. RC esas teşkil eden bir bileşeni, viral DNA, viral bir itseEğer. Şekil 3'te gösterilen gibi deneylerde virüsün replikasyon döngüsü ilerledikçe RCF viral DNA ilişkilendirmek artan miktarlarda, DBP için olduğu gibi, bu kısımların DNA replikasyonunun zamansal desen de incelenebilir, belirten olduğunu göstermektedir.

Viral proteinleri ve viral genomu ihtiva eden yanında, RC viral geç gen ekspresyonunun siteleri de bulunmaktadır. Şekil 4 biz RT-PCR ile viral geç mRNA ve 36 HPI de RCF ve Npl arasında kendi ayrılığı çeşitli türlerin düzeyini ölçmek için tasarlanmış deneylerin temsilcisi sonuçlarını sunmak. Viral sonlarında mRNA RC sentezlenir ve postranscriptional işleme bu sitelerde başlatır vardır; Daha sonra bu viral mRNA, RC'den ayrışır nükleolazma için serbest kalan ve daha sonra sitoplazmaya ihraç edilmektedir. Olgun viral geç mRNA toplam havuzu (ML mRNA), üçlü lideri bir ekson bağlantısını yükseltmek primerler kullanılarak ölçüldü birTüm adenovirüs Geç mRNA (Şekil 4A) ve 5 'teşkil sekansı. L2 spesifik olgun kopyaların mRNA Ekson birleşimi, L4 ve L5 aileleri de ölçülmüştür. Bu viral replikasyon döngüsünün geç faz ilerledikçe, viral geç mRNA artan miktarlarda sitoplazma ihraç edilmektedir olduğu tespit edilmiştir; Ancak, L5 mRNA türlerinin geç kez üretimi diğer geç mRNA aileleri ile karşılaştırıldığında daha artar tarafından. Beklendiği gibi, Şekil 4 ekilen temsili sonuçlarda ML mRNA'da yaklaşık 2,5 misli bir fark, RCF kıyasla Npl görülmektedir. Spesifik ailesine mRNA karşılaştırmak İlginç bir şekilde, L2 ve L4, mRNA hem de her iki çekirdek içi fraksiyon (Şekil 4B ve C sırasıyla) ile benzer düzeyde dağıtılmak üzere görünür ise aksine, L5 mRNA Npl bir yaklaşık 2 katlık bir artış göstermiştir RCF göre. Bu sonuçlar sy bir diferansiyel model önermek nthesis ve adenoviral RC'den farklı viral Geç mRNA türlerinin serbest bırakılması (10 önce öne sürülmüştür). Önemli bir şekilde, bu sonuçlar aynı zamanda viral mRNA biyogenezine farklı adımlar kesin ölçümler, bu yeni prosedürü ile izole RC kullanılarak gerçekleştirilebilir göstermektedir.

figür 1
Fraksiyonu Prosedür sırasında Farklı Adımlar Şekil 1. Parlak Alan Mikroskopi. RC izolasyonu sırasında numuneler alt hücresel fraksiyonların bütünlüğünü sağlamak için bir optik mikroskop ile izlenmesi gerekir. Şekil sakaroz yastıkları sayesinde çekirdeklerin ayrılması ve RCF izolasyonu için, HFF hücrelerinin şişlik RCF elde etmek prosedüründe kullanılan adımları gösterir. 40x mikrografları: ölçek çubuğu 50 μ m; 63x mikrografları: ölçek çubuğu 5 μ m; DBP yeşil gösterilir.tps: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 2,
Şekil 2. DBP karşı Western Blot. Numuneler, SDS-PAGE ile analiz edildi ve DBP viral RC iyi niyetli bir işaretleyiciye karşı western blot için işlenir. RCF protein zenginleştirme belirlemek için, farklı zamanlarda sonrası enfeksiyon RCF ve Npl hem varlığı ve DBP göreceli olarak karşılaştırmak için faydalıdır. HFF hücreleri 16 hpi adenoviral çoğaltma döngüsü sırasında erken bir zaman temsil eder; 24 hpi enfeksiyonu, viral DNA sentezi başlar geç evresine geçişi işaret; 36 hpi geç bir zaman sonrası enfeksiyon temsil eder. DBP beklenen molekül kütlesi gösterilmiştir. Tiklayiniz lütfenBu rakamın büyük halini görmek için buraya k.

Şekil 3,
Şekil 3. PCR Testi 24 ve 36 HPI de RCF ve Npl saflaştırılan RCF. DNA'daki Viral DNA (vDNA) Algılama. Viral DNA, viral genomun spesifik primerler kullanılarak PCR ile büyütülmüştür. Grafik 36 HPI de RCF viral DNA'nın zenginleştirme gösterir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
.. Şekil 4. Viral Geç mRNA RNA analizi RCF ve Npl izole edilir ve spesifik viral geç mRNA tespit etmek için RT-PCR ile analiz edilmiştir (A) toplam Viral Geç mRNA (ML: Geç Temel); L (B) mRNA2 Aile, L4 Aile (C) mRNA; L5 Aile (D) mRNA. Değerler ortalama ± üçlü örneklerinin standart sapmasını temsil eder. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Isim İleri primer dizisi (5'-3 '), Ters primer sekans (5'-3 '), Tavlama sıcaklığı
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2 mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Viral Geç mRNA Amplifikasyon ML mRNA için kullanılmış Tablo 1. primerler: Bu primerler, üç bölümlü lider olan bir bölgenin yükseltilmesine olanak sağlayacak tüm viral geç mRNA için ortak olan 5 'sekansı; L2 mRNA primerleri pV mRNA içinde belirli bir bölgenin amplifikasyonu izin ver; L4 mRNA primerleri 100 K mRNA içinde belirli bir bölgenin amplifikasyonu izin ver; L5 mRNA lifi mRNA'ya olan bir bölge büyütülmesine olanak tanır. Her bir prim için dizi ve tavlama sıcaklıklarıer gösterilir.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics