Aislamiento de fracciones Sub-nuclear enriquecido compartimentos viral de replicación de infectados por adenovirus células normales Humanos

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Los adenovirus contienen un genoma de doble cadena de ADN que se replica en el núcleo de la célula infectada. Cuando el ADN viral entra en el núcleo, se localiza adyacente a cuerpos nucleares de PML 1. Después de la expresión génica viral temprana, la arquitectura nuclear se reorganiza de manera espectacular, inducir la formación de microambientes virales, denominado compartimentos de replicación viral (RC) 2. Desde adenovirus (Ad) RC son sitios donde la replicación del genoma viral y la expresión de genes tardíos virales tienen lugar, que proporcionan un entorno para el reclutamiento de todos los factores virales y celulares necesarias que participan en estos procesos. Curiosamente, una variedad de proteínas celulares responsables de la respuesta antiviral celular, tales como la respuesta al daño del ADN, la respuesta inmune innata y la supresión de tumores son cooptados a estos sitios virales 2. Hubs reguladoras Por lo tanto, Ad RC se puede considerar que promueven la replicación viral eficaz, mientras que de forma concomitante la regulación de larespuesta antiviral celular, lo que indica que estas estructuras son la clave para la comprensión de las interacciones de células virus-huésped. Sin embargo, los mecanismos moleculares de la formación de RC, su composición y actividades asociadas, son poco conocidos.

Adenoviral RC, así como RC de otros virus de ADN que se replican en el núcleo no están asociados a las membranas, en contraste con RC citoplasmática 3. Por otra parte, estas estructuras inducidas por virus son susceptibles de ser compuesto en su totalidad de proteínas y ácidos nucleicos. RC formado en las células infectadas con los virus de ARN (generalmente denominado fábricas víricas) han sido aislados, tomando ventaja de su localización citoplasmática y el estado unido a la membrana, que ha facilitado su morfológica detallada, caracterización funcional y bioquímico 4.

Para nuestro conocimiento, nuclear viral RC no se han aislado, tal vez debido a la complejidad de la arquitectura nuclear y la ausencia de m intranuclearembranes que facilitarían su aislamiento. Su estudio se ha basado más bien en microscopía de inmunofluorescencia, FISH y microscopía electrónica de transmisión. Sin embargo, a pesar de las complicaciones inherentes a aislar estructuras subnuclear, otros ámbitos nucleares como nucleolos y Cuerpos de Cajal se han aislado antes de 5,6. Desde nucleolos y RC están ambas compuestas de proteínas y ácidos nucleicos, y tienen un diámetro entre 0.5 - 5 micras, la hipótesis de que RC también debe ser susceptible de aislamiento. Por lo tanto, con el fin de caracterizar con más precisión la composición molecular y funciones asociadas a RC, establecimos un nuevo método para aislar fracciones enriquecidas con subnuclear RC. Con este fin, hemos preparado fracciones sub-nuclear utilizando gradientes de velocidad y cojines de sacarosa similares a los procedimientos utilizados para aislar nucleolos 7 u otros dominios nucleares 6 y establecimos un sistema libre de células que permite el estudio de la composición molecular y actividades asociadas deRC. Por tanto, esta técnica debe avanzar en la comprensión de las interacciones celulares virus-huésped y representa una poderosa herramienta que también debe facilitar el análisis detallado de RC de otros virus que se replican en el núcleo e inducir la formación de compartimentos de replicación de dimensiones similares a las formadas en adenovirus las células infectadas, como, herpesvirus, papilomavirus o poliomavirus.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Cultivo Celular y Ad-infección

  1. Propagar virus Ad5 WT en monocapas de células HEK-293 y título como unidades formadoras de fluorescentes (FFU) sobre las células HFF tal como se describe anteriormente 8.
  2. Crecer fibroblastos de prepucio humano (HFF) en 10 ml de DMEM / 10% suero bovino fetal (FBS) en placas estériles de cultivo de 100 mm a 37 ºC y 5% de CO 2 en un incubador humidificado. Determinar el número de células usando una cámara de Neubauer contando las células en los cuatro conjuntos de 16 cuadrados. El número de células por ml se obtiene mediante el cálculo del número medio de células en los cuatro conjuntos de 16 cuadrados y multiplicando este número por 10 4. Para cada tiempo después de la infección incluido en el paso 1.3, use 1 x 10 7 células HFF.
  3. Mock-infectar o infectar células HFF con adenovirus tipo 5 (Ad5) de tipo salvaje (WT) (H5pg4100 8) en 100 mm platos de cultivo de tejidos utilizando 1 ml de Ad5 en DMEM por plato en una MOI de 30 Focus Forming Unidad o FFU , por célula. Incubar durante 2 horas en ahumidified incubadora de cultivo celular a 37 ºC y 5% de CO 2, meciéndose cuidadosamente los platos cada 15 minutos para asegurar la distribución homogénea del inóculo del virus sobre las células. Después de este tiempo, retirar el medio y añadir DMEM suplementado con 10% de SFB y se incuba durante 16, 24 o 36 horas en una incubadora de cultivo celular humidificado a 37 º C y 5% de CO 2. Continúe con el paso 2.1.

2. Preparación de las fracciones Sub-nuclear Enriquecido con adenovirus RC

  1. Infectados Ad5-cosecha o células HFF falsamente infectadas con un raspador de células y recoger las células en tubos de centrífuga estériles. Determinar el número de células como en el paso 1.2. Utilice 1 x 10 7 células por cada vez que después de la infección se especifica en el paso 1.3.
  2. Centrifugar las células a 220 xg, 4 ° C durante 5 min.
  3. Resuspender el sedimento celular en PBS enfriado con hielo (NaCl 137 mM, 2,7 mM KCl, 10 mM Na 2 HPO 4 y 1,8 mM KH 2 PO 4). Sedimento celular Washs 3 veces con 5 ml de helado de PBS por lavado. Para ello, centrifugar las células a 220 xg, 4 ° C durante 5 minutos, decantar y desechar el sobrenadante (SN), y volver a suspender el sedimento celular por pipeteo suave.
  4. Para interrumpir la membrana plasmática, resuspender el sedimento celular en 700 mu l de tampón hipotónico enfriado con hielo (10 mM HEPES pH 7,9, 10 mM KCl, 1,5 mM de MgCl 2, DTT 0,5 mM, 20 μ g / ml fluoruro de fenilmetilsulfonilo (PMSF) , una mezcla de cisteína, serina, treonina y los inhibidores de la aspartil proteasa incluyendo 10 μ g / ml de inhibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A y 10 μ g / ml N acetil-L-leucil-L-leucil-L -argininal) y dejar que las células se hinchan en hielo durante 3 horas.
  5. Lyse las células usando un homogeneizador con una mano de mortero tipo teflón holgada. Realizar 80 Dounce golpes y muestras del monitor cada 20 golpes por microscopía de campo claro para garantizar que todas las células se han lisado, pero que los núcleos tienen not sido dañado o roto.
  6. Centrifugar el homogeneizado celular a 300 xg, 4 ° C durante 5 min. Almacenar el SN como la fracción citoplasmática a -20 ºC en un tubo de centrífuga.
  7. Para eliminar los desechos celulares a partir de núcleos, resuspender el precipitado en 750 μ l de solución 1 (S1) (0,25 M de sacarosa, 10 mM de MgCl 2 20 mu g / ml PMSF, una mezcla de cisteína, serina, inhibidores de la treonina y la aspartil proteasa incluyendo 10 μ g / ml de inhibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A y 10 μ g / ml N acetil-L-leucil-L-leucil-L-argininal) y la capa sobre un volumen igual de solución de 2 (S2) (0,35 M de sacarosa, 0,5 mM de MgCl 2, 20 μ g / ml PMSF, una mezcla de cisteína, serina, inhibidores de la treonina y la aspartil proteasa incluyendo 10 μ g / ml de inhibidor de tripsina pancreática bovina, 10 μ g / ml de pepstatina A y 10 μ g / ml N acetil-L-leucil-L-leucil-L-argininal). Centrifuge a 1.400 xg, 4 ° C durante 5 min.
  8. Deseche el SN utilizando una micropipeta. Evite perturbar el sedimento.
  9. Resuspender el sedimento que contiene núcleos aislados en 750 μ l de S2.
  10. Para aislar fracciones subnucleares enriquecidos con adenovirus RC (RCF), sonicado se volvieron a suspender los núcleos con un baño de ultrasonidos, utilizando dos pulsos 5 min, o hasta que todos los núcleos son lisadas como se observa por microscopía de campo claro. Utilice hielo en baño ultrasónico, según sea necesario para mantener las muestras en o por debajo de 4 ° C.
  11. Capa de los núcleos sonicadas sobre un volumen igual de solución de 3 (S3) (0,88 M de sacarosa, 0,5 mM de MgCl 2) y centrifugar a 3000 xg, 4 ° C durante 10 min. Guarde el 1,5 ml de sobrenadante como la fracción nucleoplasmic (NPL) a -70 ºC. Resuspender el precipitado en 700 μ l de S2 y tienda como RCF a -70 ºC.

3. Los análisis Western Blot de RCF

NOTA: Para el análisis Western Blot de morosidad y RCF fracciones set lado 640 mu l para Npl y 300 μ l de RCF a partir del volumen total obtenido en el paso 2.11.

  1. Mezclar 15 μ l de cada fracción subnuclear en 2x tampón de Laemmli (4% SDS, 20% de glicerol, 10% de 2-mercaptoetanol, 0,004% de azul de bromofenol, 0,125 M Tris HCl pH 6,8) y se deja hervir a 95 ºC durante 5 min. Cargar las muestras en una electroforesis en 10% de sodio dodecil sulfato-poliacrilamida gel (SDS-PAGE) gel desnaturalizante y las proteínas separadas durante 1,5 h, a 20 miliamperios (mA).
  2. Transferencia de proteínas por electrotransferencia durante 1,5 horas a 400 mA en difluoruro de polivinilideno (PVDF) membranas.
  3. Bloquear la membrana durante 2 horas a RT utilizando leche seca sin grasa 3% en PBS.
  4. Incubar O / N a 4 ºC con el anticuerpo primario contra la proteína viral de unión al ADN E2A (B6-8 9) a una dilución 1: 500 en leche en polvo PBS / 0,3% sin grasa.
  5. Membrana Lavar 3 veces con PBS / Tween 20 0,1% durante 10 min.
  6. Incubar la membrana con un ratón anti IgG secundariatibody acoplado a peroxidasa de rábano picante (HRP) a una dilución 1: 10.000 en PBS durante 2 horas a RT.
  7. Lavar la membrana 3 veces con PBS / Tween 20 0,1% durante 10 min.
  8. Desarrollar la membrana mediante un aumento de quimioluminiscencia y películas de rayos X.

4. Viral Detección de ADN en el marco de cooperación regional

NOTA: Para el aislamiento de ADN de ambas fracciones de morosidad y RCF, utilice 210 μ l para Npl y 100 μ l de RCF del volumen total obtenido en el paso 2.11.

  1. Incubar fracciones sub-nucleares durante 1 hora a 55 ºC con 1 mg / ml de proteinasa K y 0,5% de Tween 20.
  2. Inactivar proteinasa K mediante incubación de las muestras durante 10 min a 95 ° C.
  3. Centrifugar las muestras a 20.000 xg, a temperatura ambiente durante 2 min.
  4. Recoger el SN. Precipitar el DNA con 1/10 de volumen de acetato de sodio 3M y un volumen de isopropanol, O / N a 4 ° C.
  5. Centrifugar las muestras a 20.000 xg, a temperatura ambiente durante 10 min.
  6. Deseche la u SNcantar una micropipeta. Lavar el sedimento con etanol al 70% y centrifugar a 20.000 xg, 4 ° C durante 5 min.
  7. Resuspender el ADN en 10 μ l de 10 mM Tris-HCl pH 7,4
  8. Cuantificar el ADN usando un espectrofotómetro mediante la medición de la densidad óptica (DO) a 260 nm.
  9. Para amplificar el ADN viral, utilice 100 ng de ADN de cada fracción subnuclear en una reacción de PCR estándar usando ADN polimerasa Taq en 25 μ l de volumen de reacción con los cebadores que permiten la amplificación de una región dentro de la unidad de transcripción tardía Major, desde el nucleótido 7273 a nucleótido 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Use las siguientes condiciones de ciclo: desnaturalización inicial de 3 min a 95 ºC, seguido de 20 ciclos de amplificación (1 min a 95 ºC, recocido durante 1 min a 62 ºC y extensión durante 30 segundos a 72 ºC) y una etapa de extensión final de 3 min a 72 ºC.
  10. Ejecute el producto de PCR en geles de agarosa al 2%, a 90 V. manchas con etidiobromuro de 0,5 μ g / ml concentración final y visualizar el ADN para corroborar el enriquecimiento de ADN viral en el marco de cooperación regional. Maneje bromuro de etidio con extrema precaución y siempre asegúrese de usar guantes, ya que este compuesto es un mutágeno potente. Deseche bromuro de etidio de acuerdo con las directrices institucionales.

5. Late Viral Detección de mRNA en RCF

NOTA: Para el aislamiento de ARN de las dos fracciones de morosidad y RCF, utilice 640 μ l para Npl y 300 μ l de RCF a partir del volumen total obtenido en el paso 2.11.

  1. Aislar el ARN a partir de fracciones subnuclear utilizando Trizol de acuerdo con las instrucciones del fabricante. Resuspender el ARN en 50 μ l de DEPC (diethilpyrocarbonate) de agua tratada.
  2. Cuantificar el ARN utilizando un espectrofotómetro para medir la DO a 260 nm (se obtienen aproximadamente 3 μ g). Guarde el ARN en 50 ng / mu l alícuotas a -70 ºC.
  3. Compruebe ARN purificadopor la ausencia de contaminación de ADN mediante la realización de una reacción de PCR de control en ausencia de transcriptasa inversa (RT), usando 5 ng de ARN total y las condiciones de ciclo descrito en el paso 4.9.
    1. Si la contaminación de ADN está ausente no amplicón debe ser producido. Si la contaminación de ADN está presente, incubar las muestras con 10 U de DNasa I, 10 U de inhibidor de RNasa, 0,1 M Tris-HCl pH 8,3, 0,5 M KCl y 15 mM de MgCl 2 durante 30 min a 37 ºC. Proceda para volver a aislar el ARN como en el paso 5.1.
  4. Para analizar mRNA viral asociado al RCF, amplificar 100 ng de RNA de cada fracción subnuclear por RT-PCR usando cebadores diseñados para detectar mRNA tarde adenoviral de diferentes familias de genes (Tabla 1).
    1. Para la transcripción inversa (RT), utilice 100 ng de ARN, de cada fracción subnuclear en una reacción estándar utilizando la enzima RT M-MuLV RT en 20 μ l de volumen de reacción durante 1 hora a 42 ºC y 10 min a 70 ºC.
    2. Para la amplificación, utilizar 1μ l del cDNA en las reacciones de PCR, como en el paso 4.9. Use las siguientes condiciones de ciclo: desnaturalización inicial de 3 min a 95 ºC, seguido de 25 ciclos de amplificación (1 min a 95 ºC, recocido durante 1 min a la temperatura especificada en la Tabla 1 y la extensión durante 30 segundos a 72 ºC) y una paso de extensión final durante 3 minutos a 72 ºC.
  5. Ejecute los productos de RT-PCR en geles de agarosa al 2%, en 90 geles V. mancha con bromuro de etidio a 0,5 μ g / ml concentración final y visualizar corroborar viral asociación finales ARNm al RCF. Maneje bromuro de etidio como se indica en el paso 4.10.

6. La inmunofluorescencia Visualización de RCF

NOTA: El equipaje de este procedimiento bajo una campana de flujo laminar para evitar la contaminación de las muestras con las partículas de polvo, y filtrar todas las soluciones antes de su uso.

  1. Spot 5 mu l de la fracción RCF obtenido en el paso 2.10 gravectly en un portaobjetos recubiertos con silano.
  2. Deje que el punto seco durante aproximadamente 5 minutos a temperatura ambiente.
  3. Re-hidratar lentamente e indirectamente pipetear 500 μ l de PBS en una gota al lado del punto de RCF y dejar que fluya por la inclinación del tobogán. Escurrir el exceso de PBS desde el lado.
  4. Bloquear cubriendo la muestra con 500 μ l de PBS / 5% de albúmina de suero bovino (BSA) durante 2 horas a RT.
  5. Lave la diapositiva 3 veces suavemente e indirectamente pipetear 500 l μ de PBS sobre la muestra. Incline la diapositiva para drenar el exceso de PBS.
  6. Incubar la muestra con el anticuerpo primario contra la proteína de unión al ADN viral E2A (B6-8 9) a una dilución 1: 500 en PBS durante 2 horas a RT. Cubrir la muestra manchada con 20 μ l de la solución de anticuerpo y se incuba en una cámara húmeda para evitar el secado.
  7. Lavar la muestra 3 veces con PBS / 0,02% de Tween 20 por suavemente e indirectamente pipeteando 500 μ l de PBS sobre la muestra. Incline la diapositiva para drenar el exsolución de lavado proceso.
  8. Se incuban las muestras con el ratón anti anticuerpo secundario IgG acoplado a un fluoróforo que se excita a 488 nm en una dilución 1: 2000 en PBS, durante 1 hora a 4 ºC. Cubrir la muestra manchada con 20 μ l de la solución de anticuerpo y se incuba en una cámara húmeda para evitar el secado.
  9. Lavar la muestra 3 veces con PBS / 0,02% de Tween 20 por suavemente e indirectamente pipeteando 500 μ l de PBS sobre la muestra. Incline la diapositiva para drenar el exceso de solución de lavado.
  10. Cubrir la muestra manchada sobre el portaobjetos con un cubreobjetos usando 2 μ l de PBS / 10% de glicerol como medio de montaje. Selle con esmalte de uñas transparente y almacenar al -20 ºC.
  11. Analizar las muestras usando un microscopio de fluorescencia, con un objetivo 63x y un 1,4 Apertura numérica (NA) a una longitud de onda de 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Puesto que los compartimentos de replicación viral (RC) son estructuras inducidas por virus subnuclear compuestas de proteínas y ácidos nucleicos, similar a otros dominios nucleares, que resultó ser susceptible de aislamiento mediante gradientes de velocidad en base a características bioquímicas. Los pasos críticos en el protocolo de fraccionamiento se ilustran en la figura 1. En cada paso las muestras deben ser supervisados ​​por microscopía de campo claro para garantizar la integridad de las diferentes fracciones subcelulares. Por ejemplo, cuando la hinchazón de las células, tiempo de incubación en el tampón hipotónico necesita ser estandarizado con el fin de hinchar el citoplasma evitando daños a los núcleos. Después de la homogeneización de células, núcleos intactos, libre de componentes citoplasmáticos incluyendo membranas del retículo endoplásmico, necesitan ser obtenido. También, el tiempo de sonicación necesita ser estandarizado con el fin de romper la membrana nuclear de todas las células sin interrumpir RC.

Después de obtener las fracciones sub-nuclear, clavecontroles deben ser incluidos para determinar la asociación y el enriquecimiento de los marcadores de buena fe de RC en el marco de cooperación regional. Adenoviral RC se visualizan normalmente en las células infectadas por inmunofluorescencia utilizando anticuerpos contra la proteína E2A-72K viral (DBP). DBP es una proteína viral que participa directamente en la replicación del genoma viral; Por lo tanto, la presencia de DBP en partículas enriquecido en el RCF demuestra la asociación directa de esta proteína viral con las partículas aisladas, como se muestra en la Figura 1. Además, la detección de DBP en RCF por Western Blot confirma la asociación de esta proteína a la aislado RC. En la Figura 2 se muestra que por tiempos tardíos después de la infección (36 hpi), DBP se enriquece en la RCF en comparación con la fracción nucleoplasmic (NPL), demostrando que la RC obtiene con este procedimiento en diferentes momentos después de la infección refleje la espera temporal patrón de DBP asociación a RC. Un componente viral esencial de RC es el itse ADN virallf. En experimentos como la que se muestra en la Figura 3 se demuestra que cantidades crecientes de ADN viral asociado con RCF como el ciclo de replicación del virus progresa, lo que indica que, como para DBP, el patrón temporal de la replicación del ADN en estas fracciones puede también ser estudiado.

Además de contener proteínas virales y el genoma viral, RC también son sitios de expresión de genes virales tarde. En la Figura 4 se presentan los resultados representativos de experimentos diseñados a medida por RT-PCR en el nivel de varias especies de ARNm finales viral y su segregación entre RCF y Npl a 36 hpi. ARNm tardíos virales se sintetizan en RC y su procesamiento postranscripcional inicia en estos sitios; posteriores estos ARNm virales se disocian de RC, se liberan al nucleoplasma, y ​​posteriormente se exportan al citoplasma. El conjunto total de ARNm maduro finales viral (ARNm ML) se midió utilizando cebadores que amplifican una unión exón del líder tripartita, unsecuencia que constituye el 5 'de todos los ARNm tardío adenoviral (Figura 4A). Uniones exón en el ARNm de las transcripciones maduras específicas de la L2, también se midieron las familias L4 y L5. Se ha establecido que a medida que la fase tardía del ciclo de replicación viral progresa, cantidades crecientes de ARNm tardíos virales se exportan al citoplasma; sin embargo, por los tiempos de producción tardía de las especies de ARNm L5 aumenta aún más en comparación con las otras familias ARNm tardío. En los resultados representativos sembradas en la Figura 4 se observa una diferencia de aproximadamente 2,5 veces en ML ARNm en comparación con Npl RCF, como se esperaba. Curiosamente cuando comparamos mRNA de familias específicas, tanto L2 y L4 mRNA parecen estar distribuidos en niveles similares entre ambas fracciones subnuclear (Figura 4B y C, respectivamente), mientras que en contraste, el ARNm L5 mostró un aumento de casi 2 veces en la Npl en comparación con el RCF. Estos resultados sugieren un patrón diferencial en el SY nthesis y la liberación de las diferentes especies de ARNm virales desde finales adenoviral RC (como se ha sugerido antes 10). De manera significativa, estos resultados también demuestran que las mediciones precisas de los diferentes pasos en la biogénesis del ARNm viral se pueden realizar utilizando aislado RC con este nuevo procedimiento.

Figura 1
Figura 1. Brillante Campo Microscopia de diferentes pasos durante el procedimiento de fraccionamiento. Durante el aislamiento de RC, las muestras deben ser supervisados ​​por un microscopio óptico para asegurar la integridad de las fracciones subcelulares. La figura muestra los pasos utilizados en el procedimiento para obtener RCF, de la hinchazón de las células HFF, a la separación de los núcleos y el aislamiento de RCF a través de cojines de sacarosa. 40x micrografías: bar escala de 50 μ m; 63x micrografías: bar escala de 5 μ m; DBP se muestra en verde.TPS: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Western Blot contra DBP. Las muestras se analizaron por SDS-PAGE y se procesaron para transferencia de western contra DBP, un marcador de buena fe de RC viral. Para determinar el enriquecimiento de la proteína en RCF, es útil comparar la presencia y abundancia relativa de DBP en tanto RCF y Npl en diferentes momentos después de la infección. En las células HFF 16 hpi representa un tiempo temprano durante el ciclo de replicación de adenovirus; 24 hpi marca la transición a la fase tardía de la infección como comienza la síntesis de ADN viral; 36 hpi representa un post-infección el tiempo de retraso. Se muestra el peso molecular esperado de la PAD. Por favor CLICk aquí para ver una versión más grande de esta figura.

Figura 3
Figura 3. Ensayo de PCR para detectar el ADN viral (ADNv) en RCF ADN. Se purificó a partir RCF y Npl a las 24 y 36 hpi. El ADN viral fue amplificado por PCR usando cebadores específicos para el genoma viral. El gráfico muestra el enriquecimiento de ADN viral en RCF a las 36 hpi. Por favor haga clic aquí para ver una versión más grande de esta figura.

Figura 4
.. Figura 4. Análisis de ARNm viral tardía RNA fue aislado de RCF y Npl y se analizó por RT-PCR para detectar ARNm viral tardía específica (A) Total Viral ARNm tardío (ML: Major Late); (B) mRNA de la L2 Familia; (C) mRNA de la familia L4; (D) mRNA de la familia L5. Los valores representan la media ± desviación estándar de muestras por triplicado. Por favor haga clic aquí para ver una versión más grande de esta figura.

Nombre Secuencia del cebador hacia adelante (5'-3 ') Secuencia del cebador inverso (5'-3 ') La temperatura de hibridación
ML ARNm GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
ARNm L2 GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 ARNm CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 ARNm GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tabla 1. Los cebadores usados ​​para la amplificación viral tardía ARNm ARNm ML: estos cebadores permiten la amplificación de una región en el líder tripartita, la secuencia 5 'que es común a todos los ARNm finales viral; Cebadores de ARNm de L2 permiten la amplificación de una región específica dentro del mRNA pV; Cebadores L4 de ARNm permiten la amplificación de una región específica dentro de la K mRNA 100; L5 mRNA permite la amplificación de una región dentro del mRNA de la fibra. La secuencia y recocido temperaturas para cada primer se muestran.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics