Isolamento di frazioni sub-nucleare virale replica Vano-arricchite da Adenovirus-infetti cellule normali umane

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenovirus contengono un genoma a doppio filamento di DNA che si replica nel nucleo della cellula infetta. Quando il DNA virale entra nel nucleo, localizza adiacente PML corpi nucleari 1. A seguito di espressione genica virale precoce, l'architettura nucleare è drammaticamente riorganizzato, inducendo la formazione di microambienti virali, chiamato Compartimenti replicazione virale (RC) 2. Dal adenovirus (Ad) RC sono i siti dove la replicazione virale e l'espressione del genoma di geni virali in ritardo si svolgono, forniscono un ambiente per l'assunzione di tutti i fattori virali e cellulari necessari che partecipano a questi processi. È interessante notare che una varietà di proteine ​​cellulari responsabili per la risposta antivirale cellulare, come risposta al danno del DNA, la risposta immunitaria innata e soppressione del tumore sono co-scelto di questi siti virali 2. Mozzi normativi Quindi, Annuncio RC può essere considerato che promuovono la replicazione virale efficiente, in concomitanza regolazione delrisposta antivirale cellulare, indicando che queste strutture sono la chiave per la comprensione delle interazioni delle cellule virus-ospite. Tuttavia, i meccanismi molecolari della formazione di RC, la loro composizione e le attività connesse sono poco conosciute.

Adenovirale RC, nonché RC da altri virus DNA che si replicano nel nucleo non sono associati alle membrane, in contrasto con RC citoplasmatica 3. Inoltre, queste strutture virus indotta sono suscettibili di essere composto interamente di proteine ​​e acidi nucleici. RC formata in cellule infettate con virus a RNA (di solito chiamato fabbriche virali) sono stati isolati, approfittando della loro localizzazione citoplasmatica e lo status di membrana, che ha facilitato il loro morfologica dettagliata, caratterizzazione funzionale e biochimico 4.

A nostra conoscenza, RC virale nucleare non sono stati isolati, forse a causa della complessità dell'architettura nucleare e assenza di m intranucleariembranes che potrebbero agevolare il loro isolamento. Il loro studio si è basata invece su immunofluorescenza, FISH e microscopia elettronica a trasmissione. Tuttavia, nonostante le complicazioni inerenti a isolare strutture subnucleari, altri domini nucleari come nucleoli ed Enti Cajal sono stati isolati prima di 5,6. Poiché nucleoli e RC sono entrambi composti di proteine ​​e acidi nucleici, e hanno un diametro compreso tra 0,5 - 5 micron, abbiamo ipotizzato che RC dovrebbe anche essere suscettibili di isolamento. Pertanto, al fine di caratterizzare più precisamente la composizione molecolare e funzioni associate RC, abbiamo stabilito un nuovo metodo per isolare frazioni subnucleari arricchite con telecomando. A tal fine, abbiamo preparato sub-nucleare frazioni utilizzando gradienti di velocità e cuscini saccarosio simili a procedure utilizzate per isolare nucleoli 7 o altri domini nucleari 6 e stabilito un sistema non cellulare che permette lo studio della composizione molecolare e le attività connesse diRC. Questa tecnica dovrebbe quindi avanzare la comprensione delle interazioni delle cellule virus e ospite e rappresenta un potente strumento che dovrebbe anche facilitare l'analisi dettagliata di RC da altri virus che si replicano nel nucleo e indurre la formazione di compartimenti replica di dimensioni simili a quelle costituite in adenovirus- cellule infettate, come, herpesvirus, papillomavirus o poliomavirus.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF coltura cellulare e Ad-infezione

  1. Propagare virus Ad5 WT in monostrati di cellule HEK-293 e titolo come fluorescenti unità formanti (FFU) sulle cellule HFF come descritto in precedenza 8.
  2. Crescere fibroblasti Foreskin umana (HFF) in 10 ml di DMEM / 10% siero fetale bovino (FBS) in sterile cultura 100 mm piatti a 37 ° C e 5% di CO 2 in un incubatore umidificato. Determinare il numero di cellulare utilizzando una camera Neubauer contando cellule nei quattro set di 16 quadrati. Il numero di cellule per ml si ottiene calcolando il numero medio di cellule nei quattro set di 16 quadri e moltiplicando questo numero per 10 4. Per ogni volta dopo l'infezione inclusa nella fase 1.3, utilizzare 1 x 10 7 cellule HFF.
  3. Mock-infettare o infettare le cellule HFF con il tipo di adenovirus 5 (AD5) wild-type (WT) (H5pg4100 8) a 100 mm piastre di coltura dei tessuti utilizzando 1 ml di Ad5 in DMEM al piatto con un MOI di 30 focus Forming Unit, o FFU , per cella. Incubare per 2 ore a ahumidified coltura cellulare incubatore a 37 ° C e 5% CO 2, dondolo accuratamente i piatti ogni 15 minuti per assicurare una distribuzione omogenea del virus inoculo sulle celle. Trascorso questo tempo, rimuovere il supporto e aggiungere DMEM fresco supplementato con 10% FBS e incubare per 16, 24 o 36 ore in un incubatore umidificato coltura cellulare a 37 ° C e 5% CO 2. Passare al punto 2.1.

2. Preparazione di frazioni sub-nucleare arricchito con Adenovirus RC

  1. Raccolto Ad5-infetti o cellule HFF mock-infettati con scrapper cellule e raccogliere le cellule in provette sterili. Determinare il numero di cellulare come al punto 1.2. Utilizzare 1 x 10 7 cellule per ogni tempo di post-infezione specificato al punto 1.3.
  2. Centrifugare le cellule a 220 xg, 4 ° C per 5 min.
  3. Risospendere il pellet di cellule in PBS freddo (137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 e 1,8 mm KH 2 PO 4). Pellet Washs 3 volte utilizzando 5 ml di PBS ghiacciato a lavaggio. A tal fine, centrifugare le cellule a 220 xg, 4 ° C per 5 minuti, decantare e scartare il surnatante (SN), e risospendere il pellet cellulare delicatamente pipettando.
  4. Per interrompere la membrana plasmatica, risospendere il pellet cellulare in 700 μ l di tampone ipotonico ghiacciata (10 mM HEPES pH 7.9, KCl 10 mM, MgCl 1,5 mm 2, DTT 0,5 mM, 20 μ g / ml phenylmethylsulfonyl fluoruro (PMSF) , una miscela di cisteina, serina, treonina e inibitori della proteasi aspartil compresi 10 μ g / ml inibitore della tripsina pancreatica bovina, 10 μ g / ml pepstatina A e 10 μ g / ml N-acetil-L-leucil-L-leucil-L -argininal) e lasciare che le cellule si gonfiano in ghiaccio per 3 ore.
  5. Lyse le cellule utilizzando un omogeneizzatore con larghi Un pestello tipo teflon. Eseguire 80 Dounce ictus e campioni di monitoraggio ogni 20 colpi, mediante microscopia a campo chiaro per garantire che tutte le cellule sono state lisato, ma che i nuclei hanno not stato danneggiato o rotto.
  6. Centrifugare l'omogeneizzato cellulare a 300 xg, 4 ° C per 5 minuti. Conservare il SN come frazione citoplasmatica a -20 ° C in una provetta da centrifuga.
  7. Per rimuovere i detriti cellulari dai nuclei, risospendere il pellet in 750 μ l di soluzione 1 (S1) (0,25 M di saccarosio, 10 mM MgCl 2 20 mcg / ml PMSF, una miscela di cisteina, serina, inibitori treonina e aspartil proteasi di cui 10 μ g / ml inibitore della tripsina pancreatica bovina, 10 μ g / ml pepstatina A e 10 μ g / ml N-acetil-L-leucil-L-leucil-L-argininal) e strato sopra un volume uguale di soluzione 2 (S2) (0,35 M di saccarosio, 0,5 mM MgCl 2, 20 μ g / ml PMSF, una miscela di cisteina, serina, inibitori treonina e aspartil proteasi di cui 10 μ g / ml inibitore della tripsina pancreatica bovina, 10 μ g / ml pepstatina A e 10 μ g / ml N-acetil-L-leucil-L-leucil-L-argininal). Centrifuge a 1.400 xg, 4 ° C per 5 minuti.
  8. Eliminare il SN con una micropipetta. Evitare di disturbare il pellet.
  9. Risospendere il pellet contenente nuclei isolati in 750 μ l di S2.
  10. Per isolare le frazioni subnucleari arricchiti con adenovirus RC (RCF), ultrasuoni risospeso nuclei con un bagno ad ultrasuoni, per mezzo di due 5 min impulsi, o fino a quando tutti i nuclei vengono lisati come osservato in microscopia in campo chiaro. Utilizzare ghiaccio in bagno a ultrasuoni come necessario per mantenere i campioni pari o inferiore a 4 ° C.
  11. Strato nuclei sonicati su un volume uguale di soluzione di 3 (S3) (0,88 M di saccarosio, 0,5 mM MgCl 2) e centrifugare a 3000 xg, a 4 ° C per 10 min. Conservare il surnatante 1,5 ml come frazione nucleoplasmic (NPL) a -70 ° C. Risospendere il pellet in 700 μ l di S2 e negozio come RCF a -70 ° C.

3. Western Blot analisi di RCF

NOTA: Per l'analisi Western Blot NPL e RCF frazioni set oltre 640 μ l per Npl e 300 μ l per RCF dal volume totale ottenuto al punto 2.11.

  1. Mescolare 15 μ l di ogni frazione subnucleare in 2x tampone Laemmli (4% SDS, 20% glicerolo, 10% 2-mercaptoetanolo, 0,004% blu di bromofenolo, 0,125 M Tris HCl pH 6.8) e far bollire a 95 ° C per 5 min. Caricare i campioni in un elettroforesi 10% di sodio dodecil solfato-poliacrilammide gel (SDS-PAGE) e gel proteine ​​separati denaturazione per 1,5 ore, a 20 milliampere (mA).
  2. Trasferimento proteine ​​da elettroblotting per 1,5 ore a 400 mA su di polivinile (PVDF) membrane.
  3. Bloccare membrana per 2 ore a temperatura ambiente usando latte in polvere 3% senza grassi in PBS.
  4. Incubare O / N a 4 ° C con anticorpo primario contro E2A DNA-binding proteina virale (B6-8 9) ad una diluizione 1: 500 in latte in polvere PBS / 0,3% senza grassi.
  5. Membrana Lavare 3 volte con PBS / Tween 20 0,1% per 10 min.
  6. Incubare la membrana con topo anti IgG un secondariotibody accoppiato alla perossidasi di rafano (HRP) ad una diluizione 1: 10.000 in PBS per 2 ore a temperatura ambiente.
  7. Lavare la membrana 3 volte con PBS / Tween 20 0,1% per 10 min.
  8. Sviluppare la membrana utilizzando chemiluminescenza e pellicole radiografiche.

4. virale rilevamento del DNA a RCF

NOTA: per l'isolamento del DNA da entrambe le frazioni Npl e RCF, utilizzare 210 μ l per Npl e 100 μ l per RCF del volume totale ottenuto nel passaggio 2.11.

  1. Incubare frazioni sub-nucleari per 1 ora a 55 ° C con 1 mg / ml di proteinasi K e 0,5% Tween 20.
  2. Inattivare proteinasi K incubando i campioni per 10 min a 95 ° C.
  3. Centrifugare i campioni a 20.000 xg, a temperatura ambiente per 2 min.
  4. Raccogliere la SN. Precipitare il DNA con 1/10 volume di 3M acetato di sodio e un volume di isopropanolo, O / N a 4 ° C.
  5. Centrifugare i campioni a 20.000 xg, a temperatura ambiente per 10 min.
  6. Gettare la u SNcantare una micropipetta. Lavare il pellet con 70% etanolo e centrifugare a 20.000 xg, a 4 ° C per 5 min.
  7. Risospendere il DNA in 10 μ l di 10 mM Tris-HCl pH 7.4
  8. Quantificare DNA utilizzando uno spettrofotometro misurando la densità ottica (OD) a 260 nm.
  9. Per amplificare DNA virale, utilizzare 100 ng di DNA da ogni frazione subnucleare in una reazione standard di PCR utilizzando DNA polimerasi Taq in 25 μ l di volume di reazione con primers che permettono l'amplificazione di una regione all'interno del maggiore unità Dopo la trascrizione, dal nucleotide 7273 al nucleotide 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Ap: GGATGCGACGACACTGACTTCA). Utilizzare le seguenti condizioni ciclo: denaturazione iniziale per 3 min a 95 ° C, seguiti da 20 cicli di amplificazione (1 min a 95 ° C, ricottura per 1 min a 62 ° C ed estensione per 30 sec a 72 ° C) e una fase di estensione finale per 3 min a 72 ° C.
  10. Eseguire il prodotto di PCR in 2% gel di agarosio, a 90 V. Macchia con etidiobromuro a 0,5 μ g / ml concentrazione finale e visualizzare il DNA per corroborare l'arricchimento del DNA virale nel RCF. Maneggiare il bromuro di etidio con estrema cautela e assicurarsi sempre di indossare i guanti, come questo composto è un potente mutageno. Smaltire bromuro di etidio secondo le linee guida istituzionali.

5. Fine virale mRNA rilevamento in RCF

NOTA: Per l'RNA isolamento da entrambe le frazioni Npl e RCF, utilizzare 640 μ l per Npl e 300 μ l per RCF dal volume totale ottenuto al punto 2.11.

  1. Isolare RNA da frazioni subnucleari utilizzando Trizol accordo con le istruzioni del produttore. Risospendere l'RNA a 50 μ l di DEPC (diethilpyrocarbonate) acqua -treated.
  2. Quantificare l'RNA utilizzando uno spettrofotometro per misurare la densità ottica a 260 nm (circa 3 μ g si ottengono). Conservare l'RNA a 50 ng / μ l aliquote a -70 ° C.
  3. Controllare RNA purificatoper l'assenza di contaminazione DNA eseguendo un controllo di reazione PCR in assenza di trascrittasi inversa (RT), utilizzando 5 ng di RNA totale e le condizioni del ciclo descritto al punto 4.9.
    1. Se la contaminazione del DNA è assente non amplicone dovrebbe essere prodotto. Se la contaminazione del DNA è presente, incubare i campioni con 10 U DNasi I, 10 U di RNasi inibitore, 0,1 M Tris-HCl pH 8,3, 0,5 M KCl e 15 mM MgCl 2 per 30 minuti a 37 ° C. Procedere alla ri-isolare l'RNA come al punto 5.1.
  4. Per analizzare mRNA virale associato alla RCF, amplificare i 100 ng di RNA da ogni frazione subnucleare mediante RT-PCR utilizzando primer disegnati per rilevare adenovirale mRNA tardi da diverse famiglie di geni (Tabella 1).
    1. Per la trascrizione inversa (RT), utilizzare 100 ng di RNA, da ogni frazione subnucleare in una reazione standard di RT utilizzando M-MuLV RT enzima in 20 μ l di volume di reazione per 1 ora a 42 ° C e 10 min a 70 ° C.
    2. Per l'amplificazione, usare 1μ l di cDNA in reazioni di PCR, come al punto 4.9. Utilizzare le seguenti condizioni del ciclo: denaturazione iniziale per 3 minuti a 95 ° C, seguita da 25 cicli di amplificazione (1 min a 95 ° C, ricottura per 1 min alla temperatura indicata nella tabella 1 e l'estensione per 30 sec a 72 ° C) e una passo estensione finale per 3 minuti a 72 ° C.
  5. Eseguire i prodotti di RT-PCR in 2% gel di agarosio, a 90 V. gel macchia con etidio bromuro a 0,5 μ g / ml concentrazione finale e visualizzare per corroborare virale tardi mRNA associazione al RCF. Maneggiare il bromuro di etidio come indicato al punto 4.10.

6. immunofluorescenza Visualizzazione di RCF

NOTA: Carry-questa procedura sotto una cappa a flusso laminare per evitare la contaminazione dei campioni con le particelle di polvere, e filtrare tutte le soluzioni prima dell'uso.

  1. Spot 5 μ l della frazione RCF ottenuto nel passaggio 2.10 terribilectly su un vetrino rivestito silano.
  2. Lasciate che la macchia asciugare per circa 5 minuti a temperatura ambiente.
  3. Reidratare lentamente e indirettamente pipettaggio 500 μ l di PBS in una goccia accanto al posto RCF e lasciando fluire inclinando il vetrino. Scaricare l'eccesso di PBS dal lato.
  4. Block coprendo il campione con 500 μ l di PBS / 5% di albumina sierica bovina (BSA) per 2 ore a temperatura ambiente.
  5. Lavare il vetrino 3 volte da delicatamente e indirettamente pipettando 500 l μ di PBS sul campione. Inclinare il vetrino per drenare l'eccesso di PBS.
  6. Incubare il campione con l'anticorpo primario contro E2A virale DNA-binding protein (B6-8 9) ad una diluizione 1: 500 in PBS per 2 ore a temperatura ambiente. Coprire il campione macchiato con 20 μ l di soluzione di anticorpo e incubare in una camera umida per evitare l'essiccamento.
  7. Lavare il campione 3 volte con PBS / 0,02% di Tween 20 da delicatamente e indirettamente pipettando 500 μ l di PBS sul campione. Inclinare il vetrino per scaricare l'exsoluzione di lavaggio processo.
  8. Incubare i campioni con topo anti IgG anticorpo secondario accoppiato ad un fluoroforo che viene eccitato a 488 nm in una diluizione 1: 2000 in PBS, per 1 ora a 4 ° C. Coprire il campione macchiato con 20 μ l di soluzione di anticorpo e incubare in una camera umida per evitare l'essiccamento.
  9. Lavare il campione 3 volte con PBS / 0,02% di Tween 20 da delicatamente e indirettamente pipettando 500 μ l di PBS sul campione. Inclinare il vetrino per lo scarico della soluzione di lavaggio in eccesso.
  10. Coprire il campione individuato sul vetrino con un coprioggetto utilizzando 2 μ l PBS / 10% di glicerolo come mezzo di montaggio. Sigillare con smalto trasparente e conservare al -20 ºC.
  11. Analizzare i campioni utilizzando un microscopio a fluorescenza, con un obiettivo 63x e 1.4 Aperture numerico (NA) alla lunghezza d'onda di 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Poiché compartimenti di replicazione virale (RC) sono strutture virale indotta subnucleari composte da proteine ​​e acidi nucleici, in modo simile ad altri domini nucleari, hanno dimostrato di essere suscettibili di isolamento dai gradienti di velocità basati su caratteristiche biochimiche. Passaggi critici nel protocollo di frazionamento sono illustrati nella Figura 1. Ad ogni passo i campioni devono essere monitorati mediante microscopia in campo chiaro per garantire l'integrità delle diverse frazioni sub-cellulari. Ad esempio, quando le cellule gonfiore, tempo di incubazione in tampone ipotonico necessita l'essere standardizzato per gonfiarsi citoplasma evitando danni ai nuclei. Dopo omogeneizzazione delle cellule, nuclei intatti, privo di componenti citoplasmatici tra cui membrane reticolo endoplasmatico, devono essere ottenuti. Inoltre, il tempo sonicazione deve essere standardizzato per rompere la membrana nucleare di tutte le cellule senza distruggere RC.

Dopo aver ottenuto le frazioni subnucleari, chiavecontrolli devono essere inclusi per determinare l'associazione e l'arricchimento di bona fide marcatori RC in RCF. Adenovirale RC sono comunemente visualizzati nelle cellule infette mediante immunofluorescenza utilizzando anticorpi contro la proteina E2A-72K virale (DBP). DBP è una proteina virale che partecipa direttamente nella replicazione genoma virale; Pertanto, la presenza di DBP in particelle arricchito in RCF dimostra l'associazione diretta di questa proteina virale con le particelle isolate, come mostrato in Figura 1. Inoltre, il rilevamento di DBP in RCF mediante Western Blot conferma l'associazione di questa proteina per l'isolato RC. In figura 2 è mostrato che tardo post-infezione (36 HPI), DBP è arricchito nella RCF rispetto alla frazione nucleoplasmic (Npl), dimostrando che RC ottenuta con questa procedura in tempi diversi dopo l'infezione riflettono l'atteso temporale modello di DBP associazione a RC. Una componente essenziale virale del RC è il itse DNA viralelf. In esperimenti come quello mostrato in Figura 3 dimostriamo che quantità crescenti di DNA virale associato con rcf come ciclo di replicazione del virus progredisce, indicando che, come per DBP, il pattern temporale della replicazione del DNA in queste frazioni può anche essere studiato.

Oltre a contenere proteine ​​virali e il genoma virale, RC sono anche siti di espressione genica virale in ritardo. Nella Figura 4 presentiamo risultati rappresentativi di esperimenti progettati per misurare mediante RT-PCR il livello di varie specie di mRNA virale in ritardo e loro segregazione tra RCF e Npl a 36 HPI. MRNA fine virali sono sintetizzati in RC e la loro lavorazione postranscriptional iniziati in questi siti; successivamente questi mRNA virale dissociano da RC, sono liberato di nucleoplasma, e successivamente esportati al citoplasma. L'intero gruppo di maturi virale tardi mRNA (ML mRNA) è stata misurata utilizzando primer che amplificano una giunzione esone del leader tripartita, unsequenza che costituisce il 5 'di tutti adenovirale ritardo mRNA (Figura 4A). Giunzioni esone nel mRNA di specifici trascritti maturi del L2, L4 e L5 famiglie sono state anche misurate. È stato stabilito che la fase tardiva del ciclo di replicazione virale progredisce, quantità crescenti di mRNA virale fine vengono esportati al citoplasma; tuttavia, da tempi tardi produzione delle specie L5 mRNA aumenta ulteriormente in confronto con le altre famiglie ritardo mRNA. Nei risultati rappresentativi seminati in figura 4 una differenza di circa 2,5 volte in ML mRNA è osservata in Npl rispetto a RCF, come previsto. È interessante notare che quando si confronta mRNA da famiglie specifiche, sia L2 e L4 mRNA sembrano essere distribuita in livelli simili fra le due frazioni subnucleari (Figura 4B e C, rispettivamente), mentre al contrario, la L5 mRNA mostrava quasi 2 volte maggiore Npl rispetto al RCF. Questi risultati suggeriscono un modello differenziale nel sy nthesis e la liberazione delle diverse specie ritardo mRNA virali da adenovirale RC (come è stato suggerito prima 10). Significativamente, questi risultati dimostrano anche che le misurazioni precise delle diverse fasi del biogenesi del mRNA virale possono essere eseguite utilizzando isolato RC con questa nuova procedura.

Figura 1
Figura 1. Luminoso Campo Microscopia dei diversi passaggi durante la procedura di frazionamento. Durante l'isolamento di RC, i campioni devono essere monitorati da un microscopio ottico per garantire l'integrità delle frazioni sub-cellulari. La figura mostra i passi utilizzati nella procedura per ottenere RCF dal gonfiore delle cellule HFF, alla separazione dei nuclei e l'isolamento di RCF attraverso cuscini saccarosio. 40x microscopio: bar scala 50 μ m; 63x microscopio: bar scala 5 μ m; DBP è mostrato in verde.TPS: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

Figura 2
Figura 2. Western Blot contro DBP. I campioni vengono analizzati mediante SDS-PAGE e trattati per western blot contro DBP, un marker in buona fede di RC virale. Per determinare l'arricchimento della proteina in RCF, è utile confrontare la presenza e l'abbondanza relativa di DBP sia RCF e Npl in tempi diversi dopo l'infezione. Nelle cellule HFF 16 HPI rappresenta un tempo precoce durante il ciclo di replica adenovirale; 24 hpi segna il passaggio alla fase tardiva di infezione, come inizia la sintesi del DNA virale; 36 hpi rappresenta un post-infezione da tempo in ritardo. Viene mostrata la massa molecolare atteso di DBP. Si prega CLICk qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. PCR test di rilevare il DNA del virus (vDNA) in RCF. DNA è stato purificato da RCF e Npl a 24 e 36 HPI. DNA virale è stato amplificato mediante PCR utilizzando primer specifici per il genoma virale. Il grafico mostra l'arricchimento del DNA virale a RCF a 36 HPI. Clicca qui per vedere una versione più grande di questa figura.

Figura 4
.. Figura 4. Analisi dei Viral tardo mRNA RNA è stato isolato da RCF e Npl e analizzato mediante RT-PCR per rilevare specifiche tardi mRNA virale (A) Totale virale tarda mRNA (ML: Maggiore Fine), (B) mRNA da L2 Famiglia; (C) mRNA dalla famiglia L4; (D) mRNA dalla famiglia L5. I valori rappresentano media ± deviazione standard dei campioni in triplicato. Cliccate qui per vedere una versione più grande di questa figura.

Nome Sequenza primer forward (5'-3 ') Sequenza primer reverse (5'-3 ') Temperatura di ricottura
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ° C
L2 mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ° C
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ° C
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ° C

. Tabella 1. primer utilizzati per Viral tardo mRNA Amplification ML mRNA: questi primer consentono l'amplificazione di una regione all'interno del leader tripartita, la 'sequenza di 5 che è comune a tutti virale tardi mRNA; Primer L2 mRNA consentono l'amplificazione di una regione specifica all'interno del pV mRNA; Primers L4 mRNA permettono l'amplificazione di una regione specifica ai 100 K mRNA; L5 mRNA permette l'amplificazione di una regione all'interno del mRNA fibra. Le temperature di sequenza e di ricottura per ogni primer sono mostrati.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics