Isolatie van virale replicatie compartiment verrijkt Sub-nucleaire fracties uit adenovirus-geïnfecteerde normale menselijke cellen

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenovirussen een dubbelstrengs DNA-genoom, dat repliceert in de geïnfecteerde celkern. Als het virale DNA de kern binnengaat, is gelokaliseerd grenzend aan PML kernlichaampjes 1. Naar aanleiding van de virale vroege genexpressie, wordt de nucleaire architectuur drastisch gereorganiseerd, het induceren van de vorming van virale micro-omgevingen, zogenaamde virale replicatie compartimenten (RC) 2. Sinds adenovirus (Ad) RC zijn sites waar virale genoom replicatie en expressie van virale late genen plaatsvinden, ze bieden een omgeving voor de aanwerving van alle noodzakelijke virale en cellulaire factoren die deelnemen aan deze processen. Interessant is dat een verscheidenheid aan cellulaire eiwitten die verantwoordelijk zijn voor de cellulaire antivirale respons, zoals de DNA-schade reactie de aangeboren immuunrespons en tumorsuppressie samen worden gekozen om deze virale plaatsen 2. Daarom kan Ad RC worden beschouwd regelgeving hubs die een efficiënte virale replicatie te bevorderen, terwijl tegelijkertijd de regulering van decellulaire antivirale respons, wat aangeeft dat deze structuren zijn de sleutel tot het begrip van virus-gastheer cel interacties. Niettemin, de moleculaire mechanismen van RC vorming, de samenstelling en de bijbehorende activiteiten worden slecht begrepen.

Adenovirale RC, en RC uit andere DNA-virussen die repliceren in de kern wordt niet geassocieerd met membranen, in tegenstelling tot cytoplasmatische RC 3. Bovendien zijn deze virus-geïnduceerde structuren waarschijnlijk geheel bestaande uit eiwitten en nucleïnezuren. RC gevormd in cellen geïnfecteerd met RNA-virussen (gewoonlijk aangeduid als virale fabrieken) zijn geïsoleerd, profiteren van hun cytoplasmatische lokalisatie en membraangebonden status waarin de gedetailleerde morfologische, functionele en biochemische karakterisatie 4 is vergemakkelijkt.

Voor zover wij weten, zijn virale kern RC niet geïsoleerd, misschien vanwege de complexiteit van de nucleaire architectuur en afwezigheid van intranucleaire membranes dat hun isolatie zou vergemakkelijken. Hun studie heeft vertrouwd in plaats daarvan op immunofluorescentiemicroscopie, vis en transmissie elektronen microscopie. Echter, ondanks de complicaties die inherent zijn aan het isoleren subnucleaire structuren, andere nucleaire domeinen zoals nucleoli en Cajal organen zijn geïsoleerd voordat 5,6. Aangezien nucleoli en RC zijn beide samengesteld uit eiwitten en nucleïnezuren, en een diameter tussen 0,5 - 5 pm, veronderstelden we dat RC ook vatbaar afzonderlijk te beoordelen. Teneinde de moleculaire samenstelling en functies in verband met RC preciezer te karakteriseren hebben we een nieuwe werkwijze voor subnucleaire fracties verrijkt met RC isoleren. Daartoe hebben we bereid sub-nucleaire fracties behulp snelheidsgradiënten en sucrose kussens Soortgelijke procedures voor nucleoli 7 of andere nucleaire domeinen 6 isoleren en werd een celvrij systeem dat de studie van de moleculaire samenstelling en bijbehorende activiteiten mogelijk maaktRC. Deze techniek dient derhalve vooraf het begrip van virus-gastheer cel interacties en vormt een krachtig instrument dat ook een gedetailleerde analyse van RC dient te vergemakkelijken van andere virussen die repliceren in de kern en induceren de vorming van replicatie compartimenten van soortgelijke afmetingen aan die gevormd in adenovirus geïnfecteerde cellen, zoals herpesvirussen, papillomavirussen en polyomavirussen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Cell Cultuur en Ad-infectie

  1. Propageren Ad5 WT virus in monolagen van HEK-293-cellen en titer als fluorescerende eenheden (FFU) op HFF cellen zoals eerder beschreven 8.
  2. Groei humane voorhuid fibroblasten (HFF) in 10 ml DMEM / 10% foetaal runderserum (FBS) in steriele kweek 100 mm schalen bij 37 ° C en 5% CO2 in een bevochtigde incubator. Bepaal het aantal cellen met een Neubauer kamer door het tellen van cellen in de vier 16-square sets. Het aantal cellen per ml wordt verkregen door het gemiddelde aantal cellen in de vier 16-square sets en dit aantal te vermenigvuldigen met 10 4. Voor iedere keer na infectie in stap 1,3, gebruik 1 x 10 7 HFF cellen.
  3. Mock-infecteren infecteren HFF cellen met adenovirus type 5 (Ad5) wild-type (WT) (H5pg4100 8) in 100 mm weefselkweekplaten gebruik 1 ml van Ad5 in DMEM per schaaltje met een MOI van 30 Focus Forming Unit of FFU per cel. Incubeer 2 uur in ahumidified celkweek incubator bij 37 ° C en 5% CO 2 voorzichtig schommelen van de gerechten elke 15 min een homogene verdeling van het virus inoculum over de cellen te waarborgen. Hierna verwijdert het medium vervangen door vers DMEM aangevuld met 10% FBS en incubeer gedurende 16, 24 of 36 uur in een bevochtigde celkweek incubator bij 37 ° C en 5% CO2. Ga verder met stap 2.1.

2. Voorbereiding van de Sub-nucleaire Fracties verrijkt met Adenovirus RC

  1. Oogst Ad5-besmet of mock-geïnfecteerde HFF cellen met een cel scrapper en het verzamelen van de cellen in steriele centrifugebuizen. Bepaal het aantal cellen zoals in stap 1,2. Gebruik 1 x 10 7 cellen voor elke keer na infectie opgegeven in stap 1.3.
  2. Centrifugeer de cellen bij 220 xg, 4 ° C gedurende 5 min.
  3. Resuspendeer de celpellet in ijskoud PBS (137 mM NaCl, 2,7 mM KCI, 10 mM Na 2 HPO 4 en 1,8 mM KH 2PO 4). Was celpellets 3 maal gebruik 5 ml ijskoude PBS per wasbeurt. Daartoe centrifuge de cellen bij 220 xg, 4 ° C gedurende 5 min De bovendrijvende vloeistof (SN) weggooien en resuspendeer de celpellet door voorzichtig pipetteren.
  4. Om het plasmamembraan verstoren, resuspendeer de celpellet in 700 pl ijskoude hypotonische buffer (10 mM HEPES pH 7,9, 10 mM KCI, 1,5 mM MgCl2, 0,5 mM DTT, 20 μ g / ml fenylmethylsulfonylfluoride (PMSF) een mengsel van cysteïne, serine, threonine en aspartyl protease remmers waaronder 10 μ g / ml runder alvleesklier trypsine inhibitor, 10 μ g / ml pepstatine A en 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L -argininal) en laat de cellen zwellen op ijs gedurende 3 uur.
  5. Lyse van de cellen met behulp van een homogenisator met een loszittende Een type teflon stamper. Voer 80 dounce beroertes en beeldscherm monsters per 20 slagen per helderveld microscopie zodat alle cellen zijn gelyseerd, maar nuclei not is beschadigd of gescheurd.
  6. Centrifugeer de cel homogenaat bij 300 xg, 4 ° C gedurende 5 min. Bewaar de SN de cytoplasmatische fractie bij -20 ºC in een centrifugebuis.
  7. Om celresten uit kernen te verwijderen, resuspendeer de pellet in 750 μ l oplossing 1 (S1) (0,25 M sucrose, 10 mM MgCl2 20 μ g / ml PMSF, een mengsel van cysteïne, serine, threonine en aspartyl protease remmers waaronder 10 μ g / ml runder alvleesklier trypsine inhibitor, 10 μ g / ml pepstatine A en 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal) en laag over een gelijk volume van oplossing 2 (S2) (0,35 M sucrose, 0,5 mM MgCl2, 20 μ g / ml PMSF, een mengsel van cysteïne, serine, threonine en aspartyl protease remmers waaronder 10 μ g / ml runder alvleesklier trypsine inhibitor, 10 μ g / ml pepstatine A en 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge bij 1400 xg, 4 ° C gedurende 5 minuten.
  8. Gooi de SN met behulp van een micropipet. Vermijd de pellet te verstoren.
  9. Resuspendeer de pellet met geïsoleerde kernen in 750 μ l van S2.
  10. Om subnucleaire fracties verrijkt met adenovirus RC (RCF) isoleren Sonificeer geresuspendeerd kernen met een ultrasoon bad, 5 min met twee pulsen, of totdat alle kernen zijn gelyseerd zoals waargenomen met helderveld microscopie. Gebruik ijs in ultrasoon bad nodig om monsters op of onder 4 ° C houden.
  11. Laag het gesoniceerd kernen over een gelijk volume oplossing 3 (S3) (0,88 M sucrose, 0,5 mM MgCl2) en centrifugeer bij 3000 xg, 4 ° C gedurende 10 min. Bewaar de 1,5 ml supernatant als nucleoplasmatische fractie (Npl) bij -70 ° C. Resuspendeer de pellet in 700 μ l van S2 en opslag als RCF bij -70 ° C.

3. Western Blot Analyse van RCF

LET OP: Voor de Western Blot analyse van Npl en RCF fracties set opzij 640 pi voor Npl en 300 μ l voor RCF uit de totale verkregen in stap 2.11 volume.

  1. Meng 15 μ l van elk subnucleaire fractie in Laemmli buffer 2x (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0,004% broomfenolblauw, 0,125 M Tris-HCl pH 6,8) en koken bij 95 ° C gedurende 5 min. Plaats de monsters in een 10% natriumdodecylsulfaat-polyacrylamide gelelektroforese (SDS-PAGE) denaturerende gel en gescheiden eiwitten gedurende 1,5 uur bij 20 milliampère (mA).
  2. Overdracht eiwitten door elektroblotten gedurende 1,5 uur bij 400 mA op polyvinylideendifluoride (PVDF) membranen.
  3. Blok membraan gedurende 2 uur bij KT middels 3% magere droge melk in PBS.
  4. Incubeer O / N bij 4 ° C met primair antilichaam tegen virale E2A-DNA-bindend eiwit (B6-8 9) bij een 1: 500 verdunning in PBS / 0,3% magere melkpoeder.
  5. Was membraan 3 maal met PBS / 0,1% Tween 20 gedurende 10 minuten.
  6. Incubeer het membraan met de muis anti-IgG een secundairetibody gekoppeld aan mierikswortelperoxidase (HRP) bij een 1: 10.000 verdunning in PBS gedurende 2 uur bij KT.
  7. Was het membraan 3 maal met PBS / 0,1% Tween 20 gedurende 10 minuten.
  8. Ontwikkel het membraan met behulp van versterkte chemiluminescentie en röntgenfilms.

4. Virale DNA Detection in RCF

LET OP: Voor DNA isolatie van zowel Npl en RCF fracties, gebruiken 210 μ l voor Npl en 100 μ l voor RCF van het totaal verkregen in stap 2.11 volume.

  1. Incubeer sub-nucleaire fracties gedurende 1 uur bij 55 ° C met 1 mg / ml proteïnase K en 0,5% Tween 20.
  2. Inactiveer proteinase K door de monsters te incuberen gedurende 10 min bij 95 ° C.
  3. Centrifugeer de monsters bij 20.000 x g bij kamertemperatuur 2 min.
  4. Verzamel de SN. Precipiteren van het DNA met 1/10 volume 3M natriumacetaat en één volume isopropanol O / N bij 4 ° C.
  5. Centrifugeer de monsters bij 20.000 x g bij kamertemperatuur gedurende 10 min.
  6. Gooi de SN uzingen een micropipet. Was de pellet met 70% ethanol en centrifugeer bij 20.000 xg, 4 ° C gedurende 5 min.
  7. Resuspendeer het DNA in 10 μ l 10 mM Tris-HCl pH 7,4
  8. Kwantificeren DNA met een spectrofotometer door het meten van de optische dichtheid (OD) bij 260 nm.
  9. Viraal DNA amplificeren, gebruik 100 ng DNA uit elke subnucleaire fractie in een standaard PCR-reactie met gebruikmaking van Taq DNA-polymerase in 25 μ l reactievolume met primers die de amplificatie van een gebied binnen de major late transcriptie-eenheid toe, van nucleotide 7273 tot nucleotide 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Gebruik de volgende cyclusomstandigheden: Initiële denaturatie gedurende 3 minuten bij 95 ° C, gevolgd door 20 cycli van amplificatie (1 min bij 95 ° C, hybridisatie gedurende 1 minuut bij 62 ° C en verlenging gedurende 30 seconden bij 72 ° C) en een laatste verlenging stap 3 min bij 72 ° C.
  10. Voer het PCR product in 2% agarose gels, bij 90 V. Stain met ethidiumbromide in 0,5 μ g / ml eindconcentratie en visualiseren DNA viraal DNA verrijking bevestigen in de RCF. Handvat ethidiumbromide met uiterste voorzichtigheid en zorgen er altijd voor om handschoenen te dragen, aangezien deze verbinding is een krachtige mutagene stof. Gooi ethidiumbromide volgens de institutionele richtlijnen.

5. Laat Viraal mRNA detectie in RCF

LET OP: Voor de RNA-isolatie van zowel Npl en RCF fracties, gebruiken 640 μ l voor Npl en 300 μ l voor RCF uit de totale verkregen in stap 2.11 volume.

  1. Isoleren RNA uit subnucleaire fracties Trizol gebruik volgens de instructies van de fabrikant. Resuspendeer de RNA in 50 μ l DEPC (diethilpyrocarbonate) behandelde water.
  2. Kwantificeren van de RNA met behulp van een spectrofotometer de OD bij 260 nm te meten (ongeveer 3 μ g worden verkregen). Bewaar het RNA in 50 ng / gl aliquots bij -70 ° C.
  3. Controleer gezuiverd RNAde afwezigheid van DNA-contaminatie door het uitvoeren van een controle-PCR reactie in afwezigheid van reverse transcriptase (RT), gebruik 5 ng totaal RNA en cyclusomstandigheden in stap 4.9 beschreven.
    1. Als DNA verontreiniging afwezig geen amplicon worden geproduceerd. Als DNA verontreiniging aanwezig is, incubeer de monsters met 10 U DNase I, 10 U RNase inhibitor, 0,1 M Tris-HCl pH 8,3, 0,5 M KCl en 15 mM MgCl2 gedurende 30 minuten bij 37 ° C. Ga opnieuw isoleren RNA zoals in stap 5,1.
  4. Virale mRNA geassocieerd met RCF analyseren amplificeren 100 ng RNA uit elke fractie subnucleaire door RT-PCR met behulp van primers ontworpen om adenovirale late mRNA van verschillende genfamilies (tabel 1) te detecteren.
    1. Voor reverse transcriptie (RT), gebruikt 100 ng RNA uit elke fractie subnucleaire in een standaard RT-reactie met M-MuLV RT enzym in 20 μ l reactievolume gedurende 1 uur bij 42 ° C en 10 min bij 70 ° C.
    2. Voor versterking, gebruik 1μ l van het cDNA in PCR-reacties, zoals in stap 4,9. Gebruik de volgende cyclusomstandigheden: Initiële denaturatie gedurende 3 minuten bij 95 ° C, gevolgd door 25 cycli van amplificatie (1 min bij 95 ° C, hybridisatie gedurende 1 min bij de in tabel 1 en de verlenging 30 seconden bij 72 ° C temperatuur) en een laatste verlenging stap gedurende 3 min bij 72 ° C.
  5. Voer de RT-PCR-producten in 2% agarosegels, op 90 V. Stain gels met ethidiumbromide bij 0,5 μ g / ml uiteindelijke concentratie en visualiseren om virale late mRNA associatie met het RCF bevestigen. Behandel ethidiumbromide zoals in stap 4.10.

6. Immunofluorescentie Visualisatie van RCF

Opmerking: Voer nu deze procedure onder een laminaire stroming kast contaminatie van monsters met eventuele stofdeeltjes te voorkomen, en alle oplossingen filteren vóór gebruik.

  1. Spot 5 gl van de RCF fractie verkregen in stap 2.10 directly een silaan beklede slide.
  2. Laat de vlek drogen gedurende ongeveer 5 minuten bij kamertemperatuur.
  3. Rehydrateren door langzaam en indirect pipetteren 500 μ l PBS in een druppel naast de RCF plek en te laten stromen door het kantelen van de dia. Afvoer van het overtollige PBS vanaf de zijkant.
  4. Blok door het bedekken van het monster met 500 μ l van PBS / 5% runderserumalbumine (BSA) gedurende 2 uur bij KT.
  5. Was de dia 3 keer door voorzichtig en indirect pipetteren 500 μ l PBS op het monster. Kantel de dia voor de afvoer van het overtollige PBS.
  6. Incubeer het monster met het primaire antilichaam tegen virale E2A-DNA-bindend eiwit (B6-8 9) bij een 1: 500 verdunning in PBS gedurende 2 uur bij KT. Bedek de bevlekte monster met 20 μ l van de antilichaamoplossing en incuberen in een vochtige kamer om uitdrogen te voorkomen.
  7. Was het monster 3 keer met PBS / 0,02% Tween 20 door voorzichtig en indirect pipetteren 500 μ l PBS op het monster. Kantel de dia tap de exproces wasoplossing.
  8. Incubeer de monsters met muizen anti-IgG secundair antilichaam gekoppeld aan een fluorofoor die wordt geëxciteerd bij 488 nm in een 1: 2000 verdunning in PBS, gedurende 1 uur bij 4 * C. Bedek de bevlekte monster met 20 μ l van de antilichaamoplossing en incuberen in een vochtige kamer om uitdrogen te voorkomen.
  9. Was het monster 3 keer met PBS / 0,02% Tween 20 door voorzichtig en indirect pipetteren 500 μ l PBS op het monster. Kantel de dia voor de afvoer van het overtollige wasoplossing.
  10. Bedek de gespot monster op de dia met een dekglaasje met behulp van 2 μ l PBS / 10% glycerol als montage medium. Seal met duidelijke nagellak en slaan al -20 ºC.
  11. Analyseer de monsters met behulp van een fluorescentiemicroscoop met een 63x objectief en een 1,4 numerieke apertuur (NA) bij een golflengte van 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Aangezien virale replicatie compartimenten (RC) zijn subnucleaire viraal geïnduceerde structuren bestaande uit eiwitten en nucleïnezuren, vergelijkbaar met andere nucleaire domeinen, bleken zij vatbaar voor isolatie te worden door snelheidsgradiënten gebaseerd op biochemische kenmerken. Kritische stappen van de fractionering protocol worden geïllustreerd in figuur 1. Bij elke stap de monsters moeten worden gevolgd met helderveld microscopie om de integriteit van de verschillende subcellulaire fracties waarborgen. Wanneer bijvoorbeeld zwelling van de cellen, incubatietijd in hypotone buffer moet worden genormaliseerd om het cytoplasma schade aan de kernen vermijden zwellen. Na homogeniseren cellen intacte kernen, zonder cytoplasmatische bestanddelen zoals endoplasmatisch reticulum membranen moeten worden verkregen. Ook, moet sonicatie tijd worden genormaliseerd om het kernmembraan van alle cellen scheuren zonder verstoring RC.

Na het behalen van de sub-nucleaire fracties, sleutelcontroles moeten worden opgenomen om de vereniging en verrijking van bonafide RC markers in de RCF bepalen. Adenovirale RC worden gewoonlijk gevisualiseerd in geïnfecteerde cellen door immunofluorescentie met behulp van antilichamen tegen het virale E2A-72K eiwit (DBP). DBP is een viraal eiwit dat direct deelneemt aan virale genoom replicatie; Daarom is de aanwezigheid van DBP in deeltjes verrijkt in de RCF toont de directe associatie van dit virale eiwit met de geïsoleerde deeltjes, zie figuur 1. Bovendien detectie van DBP in RCF door Western Blot bevestigt de associatie van het eiwit aan het geïsoleerde RC. In figuur 2 wordt getoond dat eind tijden na infectie (36 HPI), DBP is verrijkt in de RCF opzichte van de nucleoplasmatische fractie (Npl), waaruit blijkt dat RC verkregen met deze procedure op verschillende tijdstippen na infectie het vooropgestelde temporele patroon van de DBP vereniging RC. Een essentieel onderdeel van virale RC is het virale DNA Itself. In experimenten zoals getoond in figuur 3 tonen we aan dat toenemende hoeveelheden viraal DNA associëren met RCF de replicatiecyclus van het virus vordert, wat aangeeft dat, zoals DBP, het tijdspatroon van DNA replicatie in deze fracties kunnen worden onderzocht.

Naast die virale eiwitten en het virale genoom, RC zijn ook sites van virale late genexpressie. In figuur 4 presenteren we representatieve resultaten van experimenten ontworpen voor het meten van RT-PCR het niveau van verschillende soorten virale late mRNA en de scheiding tussen RCF en Npl op 36 hpi. Virale late mRNA worden gesynthetiseerd in RC en hun postranscriptional verwerking initieert in deze sites; later deze virale mRNA distantiëren RC, bevrijd de nucleoplasma en vervolgens geëxporteerd naar het cytoplasma. De totale pool van volwassen virale late mRNA (ML mRNA) werd gemeten met behulp van primers die een exon kruispunt van de tripartiete leider versterken, eensequentie die de 5 vormt 'van alle adenovirale late mRNA (Figuur 4A). Exonverbindingen in het mRNA van specifieke rijpe transcripten van de L2, L4 en L5 werden families gemeten. Vastgesteld is dat als de late fase van de virale replicatiecyclus vordert, toenemende hoeveelheden virale late mRNA geëxporteerd naar het cytoplasma; Maar eind tijden productie van L5 mRNA-soorten verder toeneemt in vergelijking met de andere late mRNA families. In de representatieve resultaten gezaaid in figuur 4 een ongeveer 2,5-voudig verschil in ML mRNA wordt waargenomen in vergelijking met Npl RCF, zoals verwacht. Interessant Wanneer we mRNA van specifieke families, zowel L2 en L4 mRNA blijken te verdelen vergelijkbare niveaus tussen beide subnucleaire fracties (Figuur 4B en C, respectievelijk), terwijl daarentegen de L5 mRNA vertoonde een bijna 2-voudige toename Npl vergeleken met RCF. Deze resultaten suggereren een differentiële patroon in de sy nthesis en bevrijding van de verschillende virale late mRNA-species van adenovirale RC (zoals voorgesteld voor 10). Aanzienlijk tonen deze resultaten aan dat nauwkeurige metingen van de verschillende stappen in de biogenese van het virale mRNA kan worden uitgevoerd met geïsoleerde RC met deze nieuwe procedure.

Figuur 1
Figuur 1. Helder microscopie van verschillende stappen tijdens de fractionering. Tijdens de isolatie van RC moeten de monsters gecontroleerd door een optische microscoop om de integriteit van subcellulaire fracties waarborgen. De figuur toont de stappen die in de procedure RCF verkrijgen van de verheffing van HFF cellen, scheiding van kernen en isolatie van RCF door middel sucrose kussens. 40x micrografen: schaal bar 50 μ m; 63x micrografen: schaal bar 5 μ m; DBP wordt getoond in groen.TPS: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. Western blot tegen DBP. De monsters worden geanalyseerd met SDS-PAGE en verwerkt voor Western blot tegen DBP, een bona fide merker van virale RC. Om de verrijking van de eiwitten in RCF bepalen, is het nuttig om de aanwezigheid en relatieve overvloed van DBP in zowel RCF en Npl vergelijken op verschillende tijdstippen na infectie. In HFF cellen vertegenwoordigt 16 hpi een vroeg moment tijdens de adenovirale replicatie cyclus; 24 HPI markeert de overgang naar de late fase van de infectie virale DNA-synthese begint; 36 HPI vertegenwoordigt een laat tijdstip na infectie. De verwachte moleculaire massa van DBP wordt getoond. Gelieve click hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3. PCR-test voor virale DNA (vDNA) Detect in RCF. DNA werd gezuiverd uit RCF en Npl op 24 en 36 hpi. Viraal DNA werd geamplificeerd met PCR met gebruik van primers die specifiek zijn voor het virale genoom. De grafiek toont de verrijking van viraal DNA in RCF op 36 hpi. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 4
.. Figuur 4. Analyse van virale late mRNA RNA werd geïsoleerd uit RCF en Npl en door RT-PCR geanalyseerd om specifieke virale late mRNA te detecteren (A) Totaal virale late mRNA (ML: Major Late), (B) mRNA van het L2 Familie, (C) mRNA van de L4 Family; (D) mRNA van de L5 Family. Waarden vertegenwoordigen gemiddelde ± standaarddeviatie van drievoudige monsters. Klik hier om een grotere versie van deze figuur te bekijken.

Naam Voorwaartse primer sequentie (5'-3 ') Reverse primer sequentie (5'-3 ') Uitgloeitemperatuur
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2-mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tabel 1. Primers gebruikt voor virale late mRNA Amplification ML mRNA: deze primers kan de amplificatie van een gebied binnen de tripartite leader De 5'-sequentie die voor alle virale late mRNA; L2 mRNA primers kan de amplificatie van een specifiek gebied in de pV mRNA; L4 mRNA primers kan de amplificatie van een specifiek gebied binnen de 100 K mRNA; L5 mRNA maakt de amplificatie van een gebied binnen de vezel mRNA. De sequentie en annealing temperaturen voor elke primer worden getoond.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics