Isolering af Viral Replication Rum-berigede underentreprise nukleare fraktioner fra Adenovirus-inficerede Normal humane celler

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenovirus indeholde en dobbeltstrenget DNA-genom, der replikerer i den inficerede cellekerne. Når den virale DNA ind i kernen, det lokaliserer støder op til PML nukleare organer 1. Efter viral tidlig genekspression, er den nukleare arkitektur dramatisk reorganiseret, overtalelse dannelse af virale mikromiljøer, kaldet viral replikation Rum (RC) 2. Eftersom adenovirus (Ad) RC er steder, hvor virale genom replikation og ekspression af virale sene gener finder sted, de giver et miljø for rekruttering af alle de nødvendige virale og cellulære faktorer, der deltager i disse processer. Interessant, en række cellulære proteiner, der er ansvarlige for den cellulære antiviralt respons, såsom DNA beskadigelse respons, responset medfødte immunforsvar og tumor suppression co-valgt til disse virale steder 2. Derfor kan Ad RC betragtes regulatoriske hubs, der fremmer en effektiv viral replikation, mens samtidig at regulerecellulære antiviralt respons, hvilket indikerer, at disse strukturer er nøglen til forståelsen af ​​virus-værts celle-interaktioner. Ikke desto mindre er de molekylære mekanismer i RC dannelse, deres sammensætning og tilhørende aktiviteter er dårligt forstået.

Adenoviral RC, samt RC fra andre DNA-vira, som replikerer i kernen er ikke forbundet til membraner, i modsætning til cytoplasmatiske RC 3. Endvidere vil sandsynligvis være sammensat udelukkende af proteiner og nukleinsyrer disse virusinducerede strukturer. RC dannet i celler inficeret med RNA-virus (betegnes normalt virale fabrikker) er blevet isoleret, at drage fordel af deres cytoplasmatiske lokalisering og membranbundne status, hvilket har lettet deres detaljerede morfologiske, funktionelle og biokemisk karakterisering 4.

Så vidt vi ved, har nukleare virale RC ikke er blevet isoleret, måske på grund af kompleksiteten af ​​den nukleare arkitektur og fravær af intranucleær membranes som ville lette deres isolation. Deres undersøgelse har påberåbt i stedet på immunfluorescensmikroskopi, FISH og transmission elektronmikroskopi. Men på trods af komplikationer er forbundet med at isolere inde i kernen strukturer, andre nukleare områder som nucleoli og Cajal organer er blevet isoleret før 5,6. Da nucleoli og RC er begge sammensat af proteiner og nukleinsyrer, og har en diameter på mellem 0,5 - 5 um, vi den hypotese, at RC bør også være muligt at foretage en isolering. Derfor med henblik på at mere præcist at karakterisere den molekylære sammensætning og funktioner i tilknytning til RC, vi etableret en hidtil ukendt fremgangsmåde til isolering inde i kernen fraktioner beriget med RC. Til dette formål har vi fremstillet sub-nukleare fraktioner ved hjælp af hastighedsgradienter og saccharose puder svarende til procedurer, der anvendes til at isolere nucleoli 7 eller andre nukleare domæner 6 og etablerede et cellefrit system, der tillader undersøgelse af den molekylære sammensætning og associerede aktiviteterRC. Denne teknik bør derfor fremme forståelsen af ​​virus-værts celle-interaktioner og repræsenterer et kraftfuldt værktøj, der bør også lette detaljeret analyse af RC fra andre virus, der replikerer i kernen og inducerer dannelsen af ​​replikation rum af lignende dimensioner til dem, der dannes i adenovirus- inficerede-celler, såsom herpesvira, papillomvirus eller polyomaviruses.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Cell Kultur og Ad-infektion

  1. Udbrede Ad5 WT virus i monolag af HEK-293-celler og titer fluorescerende dannende enheder (FFU) på HFF-celler som beskrevet tidligere 8.
  2. Grow humane forhudsfibroblaster (HFF) i 10 ml DMEM / 10% kalvefosterserum (FBS) i sterile kultur 100 mm skåle ved 37 ºC og 5% CO2 i en fugtig inkubator. Bestem celle nummer ved hjælp af en Neubauer kammer ved at tælle celler i de fire 16-firkantede sæt. Celleantallet pr ml fås ved at beregne det gennemsnitlige antal af celler i de fire 16-square sæt og multiplicere dette tal med 10 4. For hver gang efter infektion inkluderet i trin 1.3, bruger 1 x 10 7 celler HFF.
  3. Mock-inficere eller inficere HFF-celler med adenovirus type 5 (Ad5) vildtype (WT) (H5pg4100 8) i 100 mm vævskulturskåle ved anvendelse af 1 ml Ad5 i DMEM pr skålen ved en MOI på 30 fokusdannende enhed, eller FFU , per celle. Inkuber i 2 timer i ahumidified cellekultur inkubator ved 37 ºC og 5% CO2, omhyggeligt rokkende retter hver 15 min for at sikre homogen fordeling af virusinokulum over cellerne. Efter denne tid, fjernes mediet, og der tilsættes frisk DMEM suppleret med 10% FBS og inkuberes i 16, 24 eller 36 timer i en befugtet cellekultur inkubator ved 37 ° C og 5% CO2. Fortsæt til trin 2.1.

2. Udarbejdelse af Sub-nukleare Brøker Beriget med adenovirus RC

  1. Harvest Ad5-inficerede eller mock-inficerede HFF celler med en celle scrapper og indsamle cellerne i sterile centrifugerør. Bestem celletallet som i trin 1.2. Brug 1 x 10 7 celler for hver gang efter infektion angivet i trin 1.3.
  2. Centrifuger cellerne ved 220 xg, 4 ºC i 5 min.
  3. Resuspender cellepelleten i iskold PBS (137 mM NaCl, 2,7 mM KCI, 10 mM Na 2 HPO 4 og 1,8 mM KH 2 PO 4). Vask cellepelletens 3 gange med 5 ml iskold PBS per vask. Til dette formål, centrifugeres cellerne ved 220 xg, 4 ºC i 5 min, dekanteres og kassér supernatanten (SN), og resuspender cellepelleten ved forsigtig pipettering.
  4. At forstyrre plasmamembranen, resuspender cellepelleten i 700 pi iskold hypotonisk puffer (10 mM HEPES pH 7,9, 10 mM KCI, 1,5 mM MgCl2, 0,5 mM DTT, 20 μ g / ml phenylmethylsulfonylfluorid (PMSF) en blanding af cystein, serin, threonin og aspartylproteaseinhibitorer herunder 10 μ g / ml bovin pancreatisk trypsininhibitor, 10 μ g / ml pepstatin A og 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L -argininal) og lad cellerne svulme på is i 3 timer.
  5. Lyse cellerne under anvendelse af en homogenisator med en løstsiddende En type teflonstøder. Udfør 80 dounce slagtilfælde og overvåge prøver hver 20 slag ved lysfeltmikroskopi at sikre, at alle celler er blevet lyseret, men kerner har not blevet beskadiget eller bristede.
  6. Centrifugeres cellehomogenatet ved 300 xg, 4 ° C i 5 min. Opbevar SN som cytoplasmatiske fraktion ved -20 ºC i et centrifugeglas.
  7. For at fjerne cellerester fra kerner, pellet resuspenderes i 750 μ l opløsning 1 (S1) (0,25 M sucrose, 10 mM MgCl2 20 ug / ml PMSF, en blanding af cystein, serin, threonin og aspartylproteaseinhibitorer herunder 10 μ g / ml bovin pancreatisk trypsininhibitor, 10 μ g / ml pepstatin A og 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal) og lag over et lige så stort volumen af opløsning 2 (S2) (0,35 M saccharose, 0,5 mM MgCl2, 20 μ g / ml PMSF, en blanding af cystein, serin, threonin og aspartylproteaseinhibitorer herunder 10 μ g / ml bovin pancreatisk trypsininhibitor, 10 μ g / ml pepstatin A og 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge på 1.400 xg, 4 ºC i 5 min.
  8. Kassér SN anvendelse af en mikropipette. Undgå at forstyrre bundfaldet.
  9. Resuspender pellet indeholdende isolerede kerner i 750 μ l S2.
  10. For at isolere inde i kernen fraktioner beriget med adenovirus RC (RCF), soniker resuspenderes kerner med et ultralydsbad, ved hjælp af to 5 min impulser, eller indtil alle kerner lyseres som observeret af lysfeltmikroskopi. Brug is i ultralydsbad efter behov for at opbevare prøver ved eller under 4 ° C.
  11. Lag de sonikerede kerner i et lige så stort volumen af opløsning 3 (S3) (0,88 M saccharose, 0,5 mM MgCl2) og centrifugeres ved 3.000 xg, 4 ° C i 10 minutter. Supernatanten opbevares 1,5 ml som nucleoplasmic fraktion (Npl) ved -70 ° C. Pellet resuspenderes i 700 μ l S2 og opbevares som RCF ved -70 ºC.

3. Western Blot Analyser af RCF

BEMÆRK: Western blot analyse af NPL og RCF fraktioner set afsat 640 pi for Npl og 300 μ l for RCF fra den samlede mængde opnået i trin 2.11.

  1. Bland 15 μ l af hver subnuclear fraktion i Laemmli buffer 2x (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0,004% bromphenolblåt, 0,125 M Tris-HCI pH 6,8) og koges ved 95 ºC i 5 minutter. Læg prøverne i en 10% natriumdodecylsulfat-polyacrylamidgelelektroforese (SDS-PAGE) denatureringsgel og separate proteiner i 1,5 timer, ved 20 milliampere (mA).
  2. Overfør proteiner ved elektroblotting i 1,5 time ved 400 mA på polyvinylidendifluorid (PVDF) membraner.
  3. Blokere membranen i 2 timer ved stuetemperatur under anvendelse af 3% fedtfri tørmælk i PBS.
  4. Inkuber O / N ved 4 ° C med primært antistof mod viral E2A DNA-bindende protein (B6-8 9) ved en 1: 500 fortynding i PBS / 0,3% fedtfri tørmælk.
  5. Vask membranen 3 gange med PBS / 0,1% Tween 20 i 10 minutter.
  6. Inkuber membranen med muse-anti-IgG sekundært entibody koblet til peberrodsperoxidase (HRP) ved en 1: 10.000 fortynding i PBS i 2 timer ved stuetemperatur.
  7. Vask membranen 3 gange med PBS / 0,1% Tween 20 i 10 minutter.
  8. Udvikler membranen under anvendelse af forøget kemiluminescens og røntgenfilm.

4. Viral DNA Detection i RCF

BEMÆRK: DNA-isolering fra både NPL og RCF fraktioner bruge 210 μ l for Npl og 100 μ l for RCF af den samlede mængde er opnået i trin 2.11.

  1. Inkuber sub-nukleare fraktioner i 1 time ved 55 ° C med 1 mg / ml proteinase K og 0,5% Tween 20.
  2. Inaktivere proteinase K ved at inkubere prøver i 10 minutter ved 95 ° C.
  3. Centrifugeres prøverne ved 20.000 xg ved stuetemperatur i 2 min.
  4. Saml SN. Udfælde DNA'et med 1/10 volumen 3M natriumacetat og ét volumen isopropanol, O / N ved 4 ° C.
  5. Centrifugeres prøverne ved 20.000 xg ved stuetemperatur i 10 minutter.
  6. Kassér SN usynge en mikropipette. Vask pelleten med 70% ethanol og centrifugeres ved 20.000 xg, 4 ° C i 5 minutter.
  7. Resuspender DNA i 10 μ l 10 mM Tris-HCI pH 7,4
  8. Kvantificere DNA under anvendelse af et spektrofotometer ved at måle den optiske densitet (OD) ved 260 nm.
  9. At opformere virus-DNA, bruger 100 ng DNA fra hver subnuclear fraktion i en standard PCR-reaktion ved anvendelse af Taq DNA-polymerase i 25 μ l reaktionsvolumen med primere, som tillader amplifikation af en region i Major Late transkriptionsenhed, fra nukleotid 7273 til nukleotid 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC Rv: GGATGCGACGACACTGACTTCA). Brug følgende cyklus betingelser: Indledende denaturering i 3 minutter ved 95 ºC efterfulgt af 20 amplifikationscykler (1 min ved 95 ºC, udglødning i 1 min ved 62 ºC og forlængelse i 30 sekunder ved 72 ºC) og en afsluttende forlængelse skridt for 3 minutter ved 72 ° C.
  10. Kør PCR-produktet i 2% agarosegeler, ved 90 V. Stain med ethidiumbromid på 0,5 μ g / ml endelig koncentration og visualisere DNA at bekræfte viralt DNA berigelse i RCF. Håndtag ethidiumbromid med ekstrem forsigtighed og altid sørge for at bære handsker, da dette stof er en potent mutagen. Bortskaf ethidiumbromid efter institutionelle retningslinier.

5. Sent Viral mRNA Detection i RCF

BEMÆRK: RNA isoleret fra både NPL og RCF fraktioner bruge 640 μ l for Npl og 300 μ l for RCF fra den samlede mængde er opnået i trin 2.11.

  1. Isoler RNA fra inde i kernen fraktioner ved hjælp af Trizol henhold til fabrikantens anvisninger. Resuspender RNA i 50 μ l DEPC (diethilpyrocarbonate) -behandlet vand.
  2. Kvantificere RNA under anvendelse af et spektrofotometer til måling af OD ved 260 nm (ca. 3 μ g opnås). Opbevar RNA i 50 ng / pi alikvoter ved -70 ° C.
  3. Tjek renset RNAfor fravær af DNA-kontaminering ved at udføre en kontrol PCR-reaktion i fravær af revers transkriptase (RT), ved anvendelse af 5 ng total RNA og cyklus, der er beskrevet i trin 4.9.
    1. Hvis DNA-kontaminering er fraværende ingen amplikon skal produceres. Hvis DNA-kontaminering er til stede, inkuberes prøverne med 10 U DNase I, 10 U RNase-inhibitor for, 0,1 M Tris-HCI pH 8,3, 0,5 M KCI og 15 mM MgCl2 i 30 minutter ved 37 ° C. Fortsæt til re-isolere RNA som i trin 5.1.
  4. At analysere viral mRNA associeret med RCF, amplificere 100 ng RNA fra hver fraktion subnuclear ved RT-PCR under anvendelse af primere designet til at detektere adenovirale sene mRNA fra forskellige genfamilier (tabel 1).
    1. Til revers transkription (RT), bruger 100 ng RNA, fra hver subnuclear fraktion i en standard RT-reaktionen under anvendelse af M-MuLV RT enzymet i 20 μ l reaktionsvolumen i 1 time ved 42 ° C og 10 min ved 70 ºC.
    2. Til amplifikation, bruge 1μ l af cDNA'et i PCR-reaktioner, som i trin 4.9. Brug følgende cyklus betingelser: Indledende denaturering i 3 minutter ved 95 ºC, efterfulgt af 25 amplifikationscykler (1 min ved 95 ºC, udglødning i 1 min ved den temperatur, der er angivet i tabel 1 og forlængelse i 30 sekunder ved 72 ºC) og en sidste forlængelsestrin i 3 minutter ved 72 ° C.
  5. Kør RT-PCR-produkter i 2% agarose geler, ved 90 V. Stain geler med ethidiumbromid ved 0,5 μ g / ml endelig koncentration og visualisere at bekræfte viral sent mRNA association til RCF. Håndtag ethidiumbromid som angivet i trin 4.10.

6. Immunofluorescens Visualisering af RCF

BEMÆRK: Carry-out denne procedure under en laminar strømning skab for at undgå forurening af prøverne med eventuelle støvpartikler, og filtrere alle løsninger inden brug.

  1. Spot 5 pi RCF fraktion opnået i trin 2.10 directly på en silan-belagt objektglas.
  2. Lad den tørre stedet for ca. 5 minutter ved stuetemperatur.
  3. Re-hydrat ved langsomt og indirekte pipettering 500 μ l PBS i en dråbe ved siden af RCF stedet og lade det flyde ved at vippe dias. Tøm det overskydende PBS fra siden.
  4. Block ved at dække prøven med 500 μ l PBS / 5% bovint serumalbumin (BSA) i 2 timer ved stuetemperatur.
  5. Vask slæden 3 gange ved forsigtigt og indirekte pipettering 500 μ l PBS på prøven. Vip dias for at dræne det overskydende PBS.
  6. Inkubere prøven med primært antistof mod viral E2A DNA-bindende protein (B6-8 9) ved en 1: 500 fortynding i PBS i 2 timer ved stuetemperatur. Dæk plettet prøve med 20 μ l af antistoffet opløsning og inkuber i et fugtigt kammer for at undgå udtørring.
  7. Vask prøven 3 gange med PBS / 0,02% Tween 20 ved forsigtigt og indirekte pipettering 500 μ l PBS ned på prøven. Vip dias for at dræne væk fra exces vaskeopløsning.
  8. Inkuber prøverne med muse-anti-IgG sekundært antistof koblet til en fluorofor, der exciteres ved 488 nm i en 1: 2.000 fortynding i PBS, i 1 time ved 4 * C. Dæk plettet prøve med 20 μ l af antistoffet opløsning og inkuber i et fugtigt kammer for at undgå udtørring.
  9. Vask prøven 3 gange med PBS / 0,02% Tween 20 ved forsigtigt og indirekte pipettering 500 μ l PBS ned på prøven. Vip dias for at dræne det overskydende vaskeopløsning.
  10. Dæk spottet prøve på objektglasset med et dækglas hjælp 2 μ l PBS / 10% glycerol som montering medium. Seal med klar neglelak og gemme al -20 ºC.
  11. Prøverne analysere ved hjælp af et fluorescensmikroskop med et 63x objektiv og en 1,4 Numerisk Aperture (NA) ved en bølgelængde på 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Da virusreplikation rum (RC) er inde i kernen virusinduceret strukturer sammensat af proteiner og nukleinsyrer, der svarer til andre nukleare område, men viste sig at være modtagelige for isolering ved hastighedsgradienter baseret på biokemiske træk. Kritiske trin i fraktionering protokollen er illustreret i figur 1. På hvert trin prøverne skal overvåges af lysfeltmikroskopi at sikre integriteten af de forskellige sub-cellulære fraktioner. For eksempel, når hævelse cellerne, inkubationstid i hypotonisk puffer skal standardiseres med henblik på at kvælde cytoplasmaet undgå beskadigelse af kernerne. Efter celle homogenisering intakte kerner, fri af cytoplasmatiske komponenter, herunder endoplasmatisk reticulum membraner, skal opnås. Også, skal standardiseres med henblik på at sprænge kernemembranen af ​​alle celler uden at forstyrre RC sonication tid.

Efter opnåelse af de sub-nukleare fraktioner, nøglekontroller skal medtages for at bestemme foreningen og berigelse af bona fide RC markører i RCF. Adenoviral RC er almindeligt visualiseret i inficerede celler ved immunofluorescens ved anvendelse af antistoffer mod den virale E2A-72k protein (DBP). DBP er et viralt protein, som deltager direkte i viral genomreplikation; Derfor er tilstedeværelsen af DBP i partikler beriget i RCF viser den direkte forbindelse af denne virale protein med de isolerede partikler, som vist i figur 1. Endvidere påvisning af DBP i RCF ved Western blot bekræfter sammenslutningen af dette protein til den isolerede RC. I figur 2 er det vist, at ved sene tidspunkter post-infektion (36 HPI), er DBP beriget med RCF forhold til nucleoplasmic fraktion (Npl), hvilket viser, at RC opnået med denne fremgangsmåde på forskellige tidspunkter efter infektion afspejler den forventede tidsmæssige mønster af DBP association til RC. En væsentlig bestanddel af viral RC er det virale DNA itseLF. I eksperimenter som det vist i figur 3 demonstrerer vi, at stigende mængder af viral DNA associeret med RCF som replikationscyklus virus skrider frem, hvilket indikerer, at, som for DBP, den tidsmæssige mønster af DNA-replikation i disse fraktioner kan også undersøges.

Udover indeholder virale proteiner og det virale genom, RC er også steder af viral sen genekspression. I figur 4 præsenterer vi repræsentative resultater af forsøg designet til at måle ved hjælp af RT-PCR indholdet af de forskellige arter af viral sen mRNA og deres adskillelse mellem RCF og Npl ved 36 hpi. Virale sene mRNA syntetiseres i RC og deres postranscriptional behandling indleder i disse steder; senere disse virale mRNA dissocierer fra RC, er befriet for den nukleoplasma, og efterfølgende eksporteres til cytoplasmaet. Den samlede pulje af modent viral sen mRNA (ML mRNA) blev målt ved anvendelse af primere, der forstærker en exon krydset af den tredelte leder, ensekvens, der udgør 5'af alle adenovirale sene mRNA (figur 4A). -Forbindelsespunkter i mRNA'et af specifikke modne transkripter af L2, blev L4 og L5 familier også målt. Det er blevet fastslået, at når den sene fase af den virale replikationscyklus skrider frem, er stigende mængder af virale sene mRNA eksporteres til cytoplasmaet; Men ved sene tidspunkter produktion af L5 mRNA-species stiger yderligere i sammenligning med de øvrige sene mRNA familier. I de repræsentative resultater sået i figur 4 ses en ca. 2,5 gange forskel i ML mRNA i Npl forhold til RCF, som forventet. Interessant når vi sammenligner mRNA fra specifikke familier, både L2 og L4 mRNA synes at være fordelt i tilsvarende niveauer mellem de to inde i kernen fraktioner (figur 4B og C), mens derimod L5 mRNA viste en næsten 2-fold stigning i Npl sammenlignet med RCF. Disse resultater tyder på en differentieret mønster i sy nthesis og frigørelse af de forskellige virale sene mRNA-arter fra adenoviral RC (som det er blevet foreslået før 10). Betydeligt disse resultater viser også, at præcise målinger af de forskellige trin i biogenesen af ​​det virale mRNA kan udføres under anvendelse af isoleret RC med denne nye procedure.

Figur 1
Figur 1. lysfeltmikroskopi af forskellige trin under Fraktionering Procedure. Under isoleringen af RC, prøverne skal overvåges af et optisk mikroskop for at sikre integriteten af sub-cellulære fraktioner. Figuren viser de trin, der anvendes i proceduren for at opnå RCF, fra hævelse af HFF celler, til adskillelse af kerner og isolering af RCF gennem sucrose puder. 40x mikrografier: skala bar 50 μ m; 63x mikrografier: skala bar 5 μ m; DBP er vist i grøn.TPS: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Western Blot mod DBP. Prøverne analyseres ved SDS-PAGE og forarbejdet til western blot mod DBP, en bona fide markør for viral RC. For at bestemme berigelsen af ​​proteinet i RCF, er det nyttigt at sammenligne tilstedeværelsen og den relative overflod af DBP i både RCF og Npl på forskellige tidspunkter efter infektion. I HFF celler 16 hpi repræsenterer et tidligt tidspunkt i den adenovirale replikationscyklus; 24 hpi markerer overgangen til den sene fase af infektion som viral DNA-syntese begynder; 36 hpi repræsenterer et sent tidspunkt efter infektion. Den forventede molekylmasse af DBP vises. Venligst klikk her for et større version af dette tal.

Figur 3
Figur 3. PCR-analyse til Detect Viral DNA (vDNA) i RCF. DNA blev oprenset fra RCF og Npl ved 24 og 36 hpi. Viral DNA blev amplificeret ved PCR under anvendelse af primere specifikke for det virale genom. Grafen viser berigelsen af viralt DNA i RCF ved 36 HPI. Klik her for at se en større version af dette tal.

Figur 4
.. Figur 4. Analyse af Viral Late mRNA RNA blev isoleret fra RCF og Npl og analyseret ved RT-PCR til påvisning af specifik viral sen mRNA (A) Total Viral Late mRNA (ML: Major Late), (B) mRNA fra L2 Familie (C) mRNA fra L4 familie (D) mRNA fra L5 familie. Værdier repræsenterer middelværdier ± standardafvigelse for tredobbelte prøver. Klik her for at se en større version af dette tal.

Navn Forward primer sekvensen (5'-3 ') Reverse primer sekvensen (5'-3 ') Annealingstemperatur
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2-mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tabel 1. Primere Bruges til Viral Late mRNA Amplification ML mRNA: disse primere tillader amplifikation af en region i den tredelte leder, 5 'sekvens, som er fælles for alle virale sene mRNA; L2 mRNA primere tillader amplifikation af en specifik region i PV mRNA; L4 mRNA primere tillader amplifikation af en specifik region i 100 K mRNA; L5 mRNA tillader amplifikation af en region i fiberen mRNA. Rækkefølgen og annealeringstemperaturer for hver primER er vist.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics