Isolering av Viral Replication Fack-berikade underkärn Fraktioner från adenovirus-infekterade Normal humana celler

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenovirus innehåller ett dubbelsträngat DNA-genom som replikerar i den infekterade cellkärnan. När viralt DNA in i kärnan, lokaliserar det i anslutning till PML nukleära organ 1. Efter viral tidigt genuttryck, är kärn arkitekturen dramatiskt omorganiseras, inducera bildning av virala mikromiljöer, kallas virusreplikation Fack (RC) 2. Eftersom adenovirus (Ad) RC är platser där virusgenom replikation och uttryck av virala sena gener sker, de ger en miljö för rekrytering av alla nödvändiga virala och cellulära faktorer som deltar i dessa processer. Intressant, en mängd olika cellulära proteiner som är ansvariga för det cellulära antivirala svaret, såsom DNA-skada svaret, det medfödda immunförsvaret och tumörsuppression är adjungerad till dessa virus platser 2. Därför kan Ad RC anses regel nav som främjar en effektiv virusreplikation medan samtidigt regleracellulär antiviralt svar, vilket indikerar att dessa strukturer är nyckeln till förståelsen av virusvärdcellinteraktioner. Ändå, de molekylära mekanismerna för RC bildning, deras sammansättning och därmed förenlig verksamhet är dåligt förstådd.

Adenoviral RC, samt RC från andra DNA-virus som replikerar i kärnan är inte förknippade till membran, i motsats till cytoplasmisk RC 3. Dessutom är dessa virusinducerade strukturerna sannolikt kommer att helt bestå av proteiner och nukleinsyror. RC bildas i celler infekterade med RNA-virus (brukar benämnas virusfabriker) har isolerats, att dra nytta av deras cytoplasmiska lokalisering och membranbundna status, vilket har underlättat deras detaljerade morfologiska, funktionella och biokemisk karakterisering 4.

Såvitt vi vet, har kärn viral RC inte isolerats, kanske på grund av komplexiteten i kärn arkitektur och frånvaro av intranukleär membranes som skulle underlätta deras isolering. Deras studie har förlitat sig i stället på immunfluorescensmikroskopi, FISH och transmissionselektronmikroskop. Trots komplikationer inneboende isolera subnukleära strukturer, andra kärnområden såsom nukleoler och Cajal organ har isolerats före 5,6. Eftersom nukleoler och RC är båda består av proteiner och nukleinsyror, och har en diameter mellan 0,5 till 5 pm, hypotes vi att RC också bör vara möjligt att isolering. Därför, för att mer exakt karakterisera den molekylära sammansättning och funktioner associerade till RC har vi etablerat en ny metod för att isolera subnukleära fraktioner berikade med fjärrstyrning. För detta ändamål, beredda vi under nukleära fraktioner med hjälp hastighetsgradienter och sackaros kuddar liknande metoder som används för att isolera nukleolerna 7 eller andra kärnområden 6 och etablerade ett cellfritt system som tillåter studiet av molekylära sammansättning och tillhörande verksamhetRC. Denna teknik bör därför utveckla förståelsen av virus-värdcellinteraktioner och representerar ett kraftfullt verktyg som även bör underlätta detaljerad analys av RC från andra virus som replikerar i kärnan och inducera bildning av replikationsutrymmena i liknande dimensioner till de som bildas i adenovirus- infekterade-celler, såsom, herpesvirus, papillomavirus eller polyomavirus.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Cell Culture och Ad-infektion

  1. Propagera Ad5 WT virus i monoskikt av HEK-293-celler och titer som fluorescerande bildande enheter (FFU) på HFF-celler som beskrivits tidigare 8.
  2. Grow humana förhudsfibroblaster (HFF) i 10 ml DMEM / 10% fetalt bovint serum (FBS) i sterila kultur 100 mm skålar vid 37 ° C och 5% CO2 i en fuktad inkubator. Bestäm mobilnummer med hjälp av en Neubauer kammare genom att räkna celler i de fyra 16-kvadratiska uppsättningar. Cellantalet per ml erhålls genom att beräkna det genomsnittliga antalet celler i de fyra 16-kvadratiska apparater och multiplicera detta antal med 10 4. För varje gång efter infektion i steg 1.3, använda 1 x 10 7 HFF-celler.
  3. Mock-smitta eller infektera HFF-celler med adenovirus typ 5 (Ad5) vildtyp (WT) (H5pg4100 8) i 100 mm vävnadsodlingsskålar med hjälp av 1 ml Ad5 i DMEM per fat vid ett MOI av 30 Focus Forming Unit, eller FFU , per cell. Inkubera under 2 timmar i ahumidified cellodlings inkubator vid 37 ° C och 5% CO2, försiktigt gungande rätter varje 15 min för att säkerställa en jämn fördelning av viruset inokulatet över cellerna. Efter denna tid, avlägsna mediet och tillsätt färskt DMEM kompletterat med 10% FBS och inkubera i 16, 24 eller 36 h i en fuktad cellodling inkubator vid 37 ° C och 5% CO2. Gå vidare till steg 2.1.

2. Framställning av under nukleära fraktioner Berikad med Adenovirus RC

  1. Harvest Ad5-infekterade eller skeninfekterade HFF-celler med cell scrapper och samla cellerna i sterila centrifugrör. Bestäm mobilnummer som i steg 1.2. Använd 1 x 10 7 celler för varje gång efter infektion som anges i steg 1.3.
  2. Centrifugera cellerna vid 220 xg, 4 ° C i 5 minuter.
  3. Resuspendera cellpelleten i iskall PBS (137 mM NaCI, 2,7 mM KCI, 10 mM Na 2 HPO 4 och 1,8 mM KH 2 PO 4). Tvätta cellpelletens 3 gånger med 5 ml iskall PBS per tvätt. För detta ändamål, centrifugera cellerna vid 220 xg, 4 ° C i 5 minuter, dekantera och kassera supernatanten (SN), och resuspendera cellpelleten genom försiktig pipettering.
  4. Att störa plasmamembranet, resuspendera cellpelleten i 700 | il iskall hypoton buffert (10 mM HEPES pH 7,9, 10 mM KCl, 1,5 mM MgCl2, 0,5 mM DTT, 20 μ g / ml fenylmetylsulfonylfluorid (PMSF) , en blandning av cystein, serin, treonin och aspartylproteasinhibitorer inklusive 10 μ g / ml bovint pankreatiskt trypsininhibitor, 10 μ g / ml pepstatin A och 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L -argininal) och låt cellerna svälla på is under 3 h.
  5. Lyse cellerna med hjälp av en homogenisator med en löst sittande En typ teflonmortelstöt. Utför 80 dounce stroke och övervaka prover var 20 slag efter ljusfältsmikroskopi för att säkerställa att alla celler har lyserats, men att kärnor har not skadats eller brustit.
  6. Centrifugera cellhomogenatet vid 300 x g, 4 ° C i 5 minuter. Förvara SN som cytoplasmafraktionen vid -20 ºC i ett centrifugrör.
  7. För att ta bort cellulärt skräp från kärnor, resuspendera pelleten i 750 μ liter lösning 1 (S1) (0,25 M sackaros, 10 mM MgCl2 20 | ig / ml PMSF, en blandning av cystein, serin, treonin och aspartylproteasinhibitorer inklusive 10 μ g / ml bovint pankreatiskt trypsininhibitor, 10 μ g / ml pepstatin A och 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal) och lager över en lika stor volym lösning 2 (S2) (0,35 M sackaros, 0,5 mM MgCl2, 20 μ g / ml PMSF, en blandning av cystein, serin, treonin och aspartylproteasinhibitorer inklusive 10 μ g / ml bovint pankreatiskt trypsininhibitor, 10 μ g / ml pepstatin A och 10 μ g / ml N-acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge vid 1400 xg, 4 ° C i 5 minuter.
  8. Kasta SN med hjälp av en mikropipett. Undvik att störa pelleten.
  9. Resuspendera pelleten innehållande isolerade kärnor i 750 μ liter S2.
  10. För att isolera subnukleära fraktioner anrikade med adenovirus RC (RCF), sonikera återsuspenderades kärnor med ett ultraljudbad med användning av två 5 min pulser, eller tills alla kärnor lyseras såsom observeras genom ljusfältsmikroskopi. Använd is i ultraljudsbad som behövs för att hålla prover vid eller under 4 ° C.
  11. Skikta de sonikerade kärnor över en lika stor volym lösning 3 (S3) (0,88 M sackaros, 0,5 mM MgCl2) och centrifugera vid 3000 xg, 4 ° C i 10 minuter. Förvara 1,5 ml supematant som nucleoplasmic fraktionen (NPL) vid -70 ° C. Återsuspendera pelleten i 700 μ liter S2 och lagrar som RCF vid -70 ° C.

3. Western Blot Analyser av returfiber

OBS: För Western blot-analys av NPL och RCF fraktioner set undan 640 ul för Npl och 300 μ l för RCF från den totala volymen erhållits i steg 2.11.

  1. Blanda 15 μ il av varje subnuclear fraktion i Laemmli-buffert 2x (4% SDS, 20% glycerol, 10% 2-merkaptoetanol, 0,004% bromfenolblått, 0,125 M Tris HCl, pH 6,8) och kokar vid 95 ° C i 5 minuter. Ladda proverna i en 10% natriumdodecylsulfat-polyakrylamidgelelektrofores (SDS-PAGE) denaturerande gel och separata proteiner för 1,5 timmar, vid 20 milliampere (mA).
  2. Överför proteiner genom elektro för 1,5 h vid 400 mA på polyvinylidendifluorid (PVDF) membran.
  3. Blockera membran för 2 timmar vid rumstemperatur med användning av 3% fettfri torrmjölk i PBS.
  4. Inkubera O / N vid 4 ° C med primär antikropp mot viralt E2A DNA-bindande protein (B6-8 9) vid en 1: 500 spädning i PBS / 0,3% fettfri torrmjölk.
  5. Tvätta membranet 3 gånger med PBS / 0,1% Tween 20 under 10 min.
  6. Inkubera membranet med mus-anti-IgG sekundär entibody kopplad till pepparrotsperoxidas (HRP) vid en 1: 10 tusen utspädning i PBS under 2 h vid RT.
  7. Tvätta membranet 3 gånger med PBS / 0,1% Tween 20 under 10 min.
  8. Utveckla membranet med användning av förstärkt kemiluminescens och röntgenfilmer.

4. Viral DNA Detection i RCF

OBS: För DNA-isolering från båda NPL och RCF-fraktioner, använda 210 μ l för Npl och 100 μ l för RCF av den totala volymen som erhållits i steg 2,11.

  1. Inkubera sub-nukleära fraktioner under en timme vid 55 ° C med 1 mg / ml proteinas K och 0,5% Tween 20.
  2. Inaktivera proteinas K genom inkubering av prover för 10 min vid 95 ° C.
  3. Centrifugera proverna vid 20 tusen xg vid RT i 2 minuter.
  4. Samla SN. Fälla ut DNA med 1/10 volym av 3 M natriumacetat och en volym isopropanol, O / N vid 4 ° C.
  5. Centrifugera proverna vid 20 tusen xg vid RT under 10 minuter.
  6. Kasta SN usjunga en mikropipett. Tvätta pelleten med 70% etanol och centrifugera vid 20 tusen xg, 4 ° C under 5 minuter.
  7. Resuspendera DNA i 10 μ liter 10 mM Tris-HCl, pH 7,4
  8. Kvantifiera DNA med användning av en spektrofotometer genom mätning av den optiska densiteten (OD) vid 260 nm.
  9. För att amplifiera virus-DNA, använda 100 ng DNA från varje subnuclear fraktion i en standard PCR-reaktion med användning av Taq-DNA-polymeras i 25 μ liter reaktionsvolym med primrar som medger amplifiering av en region inom den större sena transkriptionsenheten, från nukleotid 7273 till nukleotid 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Använd följande cykelbetingelser: Initial denaturering under 3 min vid 95 ° C, följt av 20 cykler av amplifiering (1 min vid 95 ° C, hybridisering under 1 min vid 62 ° C och förlängning för 30 sek vid 72 ° C) och en slutlig förlängning steg för 3 minuter vid 72 ° C.
  10. Kör PCR-produkten i 2% agarosgeler, vid 90 V. Stain med etidiumbromid på 0,5 μ g / ml slutlig koncentration och visualisera DNA för att styrka viralt DNA anrikning i RCF. Hantera etidiumbromid med yttersta försiktighet och alltid se till att bära handskar, eftersom denna förening är en potent mutagen. Kassera etidiumbromid enligt institutionella riktlinjer.

5. sen viral mRNA Detektion av RCF

OBS: För RNA isolering från både NPL och RCF fraktioner, använd 640 μ l för Npl och 300 μ l för RCF från den totala volymen erhållits i steg 2.11.

  1. Isolera RNA från subnukleära fraktioner med hjälp av Trizol enligt tillverkarens anvisningar. Resuspendera RNA i 50 μ l DEPC (diethilpyrocarbonate) -behandlat vatten.
  2. Kvantifiera RNA med hjälp av en spektrofotometer för att mäta OD vid 260 nm (ca 3 μ g erhålls). Förvara RNA i 50 ng / | j, l alikvoter vid -70 ° C.
  3. Kontrollera renat RNAför frånvaron av DNA-förorening genom att utföra en kontroll PCR-reaktion i frånvaro av omvänt transkriptas (RT) med användning av 5 ng av totalt RNA och cykeln betingelser som beskrivs i steg 4,9.
    1. Om DNA-kontamination är frånvarande ingen amplikon ska produceras. Om DNA-kontaminering är närvarande, inkubera proverna med 10 U DNas I, 10 U av RNas-inhibitor, 0,1 M Tris-HCl, pH 8,3, 0,5 M KCl och 15 mM MgCl2 under 30 min vid 37 ° C. Fortsätt att åter isolera RNA såsom i steg 5,1.
  4. För att analysera viralt mRNA associerade till RCF, amplifiera 100 ng RNA från varje subnuclear fraktion genom RT-PCR med användning av primrar utformade att detektera adenoviral sent mRNA från olika genfamiljer (tabell 1).
    1. För omvänd transkription (RT), använda 100 ng RNA, från varje subnuclear fraktion i en standard RT-reaktion med M-MuLV RT enzym i 20 μ l reaktionsvolym under 1 timme vid 42 ° C och 10 minuter vid 70 ° C.
    2. För förstärkning, använd enμ l av cDNA i PCR-reaktioner, såsom i steg 4,9. Använd följande cykelbetingelser: Initial denaturering under 3 minuter vid 95 ° C, följt av 25 amplifieringscykler (1 min vid 95 ° C, hybridisering under 1 min vid den temperatur som anges i tabell 1 och förlängning för 30 sekunder vid 72 ° C) och en slutligt förlängningssteg under 3 minuter vid 72 ° C.
  5. Kör RT-PCR-produkter i 2% agarosgeler, på 90 V. Stain geler med etidiumbromid vid 0,5 μ g / ml slutkoncentration och visualisera att bekräfta viralt sen mRNA-associering med RCF. Hantera etidiumbromid enligt vad som anges i steg 4.10.

6. Immunofluorescens visualisering av returfiber

OBS: Carry-out detta förfarande under ett skåp med laminärt flöde för att undvika kontaminering av proverna med eventuella dammpartiklar och filtrera alla lösningar före användning.

  1. Ställe 5 fil av RCF-fraktionen erhållen i steg 2,10 directly på en silan-belagda objektglas.
  2. Låt fläcken torka i ca 5 min vid RT.
  3. Återfukta genom att långsamt och indirekt pipettera 500 μ l PBS i en droppe bredvid RCF plats och låta det flöda genom att luta bilden. Tappa av överskottet PBS från sidan.
  4. Block genom att täcka provet med 500 μ liter PBS / 5% bovint serumalbumin (BSA) under 2 h vid RT.
  5. Tvätta sliden 3 gånger genom att försiktigt och indirekt pipettera 500 μ l PBS på provet. Luta bilden för att dränera bort överskottet PBS.
  6. Inkubera provet med primär antikropp mot viralt E2A DNA-bindande protein (B6-8 9) vid en 1: 500 utspädning i PBS under 2 h vid RT. Täck spotted provet med 20 μ il av antikropplösningen och inkubera i en fuktkammare för att undvika uttorkning.
  7. Tvätta provet 3 gånger med PBS / 0,02% Tween 20 genom att försiktigt och indirekt pipettering 500 μ liter PBS på provet. Luta bilden rinna av frittcess tvättlösningen.
  8. Inkubera proverna med mus-anti-IgG sekundär antikropp kopplad till en fluorofor som exciteras vid 488 nm vid en 1: 2000 spädning i PBS, under 1 timme vid 4 ° C. Täck spotted provet med 20 μ il av antikropplösningen och inkubera i en fuktkammare för att undvika uttorkning.
  9. Tvätta provet 3 gånger med PBS / 0,02% Tween 20 genom att försiktigt och indirekt pipettering 500 μ liter PBS på provet. Luta bilden för att dränera bort överskottet tvättlösning.
  10. Täck fläckig provet på bilden med en täck användning av 2 μ l PBS / 10% glycerol som monteringsmedel. Täta med tydlig nagellack och lagra al -20 ºC.
  11. Analysera prover med användning av ett fluorescensmikroskop, med en 63x objektiv och en 1,4 Numerisk apertur (NA) vid en våglängd av 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Eftersom virusreplikation fack (RC) är subnukleära virusinducerad strukturer bestående av proteiner och nukleinsyror, som liknar andra kärnområden, visade de att vara mottagliga för isolering genom hastighetsgradienter baserade på biokemiska funktioner. Kritiska steg i fraktioneprotokoll illustreras i fig 1. Vid varje steg proverna måste övervakas genom ljusfältsmikroskopi att säkerställa integriteten hos de olika subcellulära fraktioner. Till exempel, när svullnad cellerna, inkubationstid i hypoton buffert behöver standardiseras för att svälla cytoplasman undvika skador på kärnor. Efter cell homogenisering, intakta kärnor, fri från cytoplasmatiska komponenter innefattande endoplasmatiska retiklet membran, måste erhållas. Dessutom måste sonikeringstid standardiseras för att spräcka den nukleära membranet i alla celler utan att störa RC.

Efter att ha fått under kärnkraft fraktioner, nyckelkontroller måste inkluderas för att bestämma föreningen och anrikning av bona fide RC markörer i RCF. Adenoviral RC vanligen visualiseras i infekterade celler genom immunofluorescens med användning av antikroppar mot det virala E2A-72k protein (DBP). DBP är ett virusprotein som deltar direkt i virusgenom replikation; därför, närvaron av DBP i partiklar anrikad på RCF demonstrerar den direkta associationen av denna virala proteinet med de isolerade partiklarna, såsom visas i fig 1. Vidare detektion av DBP i RCF genom Western blot bekräftar associationen av detta protein till den isolerade RC. I figur 2 visas det att genom sena tidpunkter efter infektion (36 HPI), är DBP anrikad på RCF jämfört med nucleoplasmic fraktionen (NPL), vilket visar att RC erhålles med detta förfarande vid olika tidpunkter efter infektion återspeglar den förväntade temporala mönster av DBP association till RC. En väsentlig viral komponent RC är den virala DNA itself. I experiment som det som visas i figur 3 visar vi att ökande mängder av virus-DNA förknippar med RCF som replikationscykeln av viruset fortskrider, vilket tyder på att, som för DBP, också kan studeras den temporala mönstret av DNA-replikation i dessa fraktioner.

Förutom innehåller virusproteiner och virala genomet, RC finns också platser av viral sent genuttryck. I fig 4 presenterar vi representativa resultat av experiment utformade för att mäta med RT-PCR nivån av olika arter av viralt sen mRNA och deras segregation mellan RCF och Npl vid 36 HPI. Viral sena mRNA syntetiseras i RC och deras postranscriptional bearbetning initierar i dessa platser; senare dessa virala mRNA avstånd från RC, är befriad att nukleoplasman, och därefter exporteras till cytoplasman. Den totala pool av mogna virala sena mRNA (ML-mRNA) mättes med användning av primrar som amplifierar en exon korsningen av tripartitledaren, ensekvens som utgör den 5 'av alla adenovirala sent mRNA (fig 4A). Exon korsningar i mRNA särskilda mogna transkript av L2, var L4 och L5 familjer också mätas. Det har fastställts att när den sena fasen av den virala replikationscykeln fortskrider, är ökande mängder av virala sena mRNA exporteras till cytoplasman; Men i slutet av gånger produktionen av L5 mRNA ökar ytterligare i jämförelse med de andra familjerna sen mRNA. I representativa resultat som såtts i figur 4 en cirka 2,5-faldig skillnad i ML-mRNA observeras i Npl jämfört med RCF, som förväntat. Intressant när vi jämför mRNA från specifika familjer, både L2 och L4-mRNA tycks distribueras i liknande nivåer mellan de båda subnukleära fraktioner (figur 4B och C, respektive), medan däremot L5 mRNA visade en nästan 2-faldig ökning av Npl jämfört med RCF. Dessa resultat tyder på en differentialmönster i sy nthesis och befrielsen av de olika virala sent mRNA från adenovirus RC (som har föreslagits före 10). Betecknande nog visar dessa resultat också att exakta mätningar av de olika stegen i biogenes av det virala mRNA kan utföras med användning av isolerade RC med detta nya förfarande.

Figur 1
Figur 1. ljusfältsmikroskopi olika steg under fraktioneringsförfarandet. Under isoleringen av RC, proven måste övervakas av ett optiskt mikroskop för att säkerställa integriteten hos sub-cellulära fraktioner. Figuren visar de steg som används i förfarandet för att erhålla RCF, från svullnad av HFF-celler, för separation av kärnor och isolering av returfiber genom sackaros kuddar. 40x micrographs: skala bar 50 μ m; 63x micrographs: skala bar 5 μ m; DBP visas i grönt.TPS: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2. Western Blöt mot DBP. Proverna analyseras genom SDS-PAGE och behandlades för western blöt mot DBP, en bona fide markör av viral RC. För att bestämma anrikning av proteinet i RCF, är det lämpligt att jämföra förekomsten och relativ förekomst av DBP i både RCF och Npl vid olika tidpunkter efter infektion. I HFF-celler 16 hpi representerar en tidig tidpunkt under adenovirala replikeringscykeln; 24 HPI markerar övergången till den sena fasen av infektion som viral DNA-syntes börjar; 36 HPI betecknar en sen tidpunkt efter infektion. Den förväntade molekylvikt DBP visas. Vänligen CLICk här för att se en större version av denna siffra.

Figur 3
Figur 3. PCR-analys för att detektera viral-DNA (vDNA) i RCF. DNA renades från RCF och Npl vid 24 och 36 HPI. Viralt DNA förstärktes med PCR med användning av primrar som är specifika för det virala genomet. Diagrammet visar anrikningen av virus-DNA i RCF på 36 hpi. Klicka här för att se en större version av denna siffra.

Figur 4
.. Figur 4. Analys av viralt sen mRNA-RNA isolerades från RCF och Npl och analyserades med RT-PCR för att detektera specifika virus sena mRNA (A) Totalt Viral Sen-mRNA (ML: Major Late), (B) mRNA från L2 Familj, (C) mRNA från L4 Familj, (D) mRNA från L5 familjen. Värden representerar medelvärde ± standardavvikelse för trippelprover. Klicka här för att se en större version av denna siffra.

Namn Framåt primersekvens (5'-3 ') Omvänd primer sekvens (5'-3 ') Glödgningstemperatur
ML-mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2-mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4-mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5-mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tabell 1. Primers som används för Viral Late mRNA Amplification ML mRNA: dessa primers tillåter förstärkning av en region inom den tredelade ledaren, 5 'sekvens som är gemensam för alla viral sent mRNA; L2 mRNA primers tillåter förstärkning av en specifik region inom PV mRNA; L4 mRNA primers tillåter förstärkning av en specifik region inom 100 K mRNA; L5-mRNA medger amplifiering av en region inom fiber mRNA. Ordningsföljden och glödgningstemperaturer för varje primer visas.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics