C57BL / 6 चूहों में प्रणालीगत एक प्रकार का वृक्ष की bm12 inducible मॉडल (एसएलई)

JoVE Journal
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

प्रणालीगत एक प्रकार का वृक्ष (एसएलई) परमाणु विरोधी एंटीबॉडी (एएनए) के उत्पादन और स्तवकवृक्कशोथ द्वारा prototypically विशेषता एक जटिल ऑटोइम्यून रोग है। कई अन्य त्वचीय सहित sequelae, कार्डियो-फेफड़े, यकृत और घावों कुछ व्यक्तियों में रोग के साथ जुड़े रहे हैं। अमेरिका में व्यापकता का अनुमान महिलाओं और अल्पसंख्यकों 3 में विशेष रूप से उच्च घटना के साथ, 150,000-1,500,000 1,2 से व्यापक रूप से भिन्न। एसएलई के एटियलजि विचार करने के लिए मुश्किल हो गया है, यद्यपि यह प्रणालीगत औतोइम्मुिनित में culminate जो विभिन्न आनुवांशिक और पर्यावरणीय कारकों की परस्पर क्रिया से पैदा करने के लिए सोचा है।

कई पशु मॉडल रोग की शुरुआत और प्रगति के लिए अग्रणी कारकों का अध्ययन करने के लिए नियोजित किया गया है। एसएलई की क्लासिक माउस मॉडल ऐसे पी के रूप में NZW F1 मॉडल और उसके NZM डेरिवेटिव, एमएलआर / LPR तनाव, और BXSB / Yaa तनाव, और inducible सिस्टम निजामाबाद एक्स सहित आनुवंशिक रूप से संवेदनशील माउस उपभेदों शामिलristane और पुरानी भ्रष्टाचार बनाम मेजबान रोग (cGVHD) मॉडल 4। GVHD मॉडल में स्वप्रतिपिण्ड उत्पादन की प्रारंभिक रिपोर्ट एफ 1 स्थानान्तरण 5 में माता पिता के लिए विभिन्न माउस उपभेदों या हम्सटर उपभेदों इस्तेमाल किया - 8; एक प्रकार का वृक्ष की तरह इस रोग का अध्ययन करने के लिए इस्तेमाल किया और अधिक आम तरीकों वर्तमान में डीबीए / 2 माता पिता → (C57BL / 6 एक्स डी बी / 2) एफ 1, और यहाँ वर्णित bm12 हस्तांतरण मॉडल शामिल हैं। प्रत्येक मॉडल अपने आप ही निरंतर है, लेकिन वे आम तौर पर मानव रोग के नैदानिक ​​सुविधाओं के साथ संबंध स्थापित कि सुविधाओं की एक आम सेट का हिस्सा है। माउस मॉडल में सबसे अधिक बार सूचना दी मापदंडों, तिल्ली का बढ़ना lymphadenopathy, नेफ्रैटिस, एना उत्पादन में शामिल हैं, और सेलुलर स्तर पर, टी कूपिक सहायक कोशिकाओं (Tfh), कीटाणु केंद्र (जीसी) बी कोशिकाओं, और प्लाज्मा कोशिकाओं के विस्तार।

एच 2 - - AB1 bm12 / KhEgJ (bm12) चूहों, एक तनाव मैं inducible bm12 मॉडल आइए bm12 बी -6 (सी) से लिम्फोसाइट के दत्तक हस्तांतरण द्वारा हासिल की हैMHC वर्ग द्वितीय पर 3 एमिनो एसिड प्रतिस्थापन के लिए छोड़कर C57BL 6 / करने के लिए dentical, आइए में C57BL / 6 (बी -6) चूहों बी। प्राप्तकर्ता APCs द्वारा दाता सीडी 4 टी कोशिकाओं की Alloactivation लक्षण बारीकी एसएलई दिखने के साथ cGVHD की ओर जाता है। विशेष रूप से, इन दाता व्युत्पन्न Tfh के विस्तार, प्राप्तकर्ता व्युत्पन्न जीसी बी कोशिकाओं और प्लाज्मा कोशिकाओं के विस्तार, और विरोधी dsDNA, विरोधी ssDNA, विरोधी क्रोमेटिन, और विरोधी आरबीसी एंटीबॉडी 9 सहित अनस के उत्पादन में शामिल हैं। समय के साथ, प्राप्तकर्ता चूहों केशिकागुच्छीय, मध्य में आईजीजी जमा है, और गुर्दे 10 की नाड़ी क्षेत्रों के साथ जुड़े स्तवकवृक्कशोथ का विकास। हमने हाल ही में मानव रोग के लिए भी इसी तरह, मैं इस मॉडल 11 में IFN प्रकार के लिए एक महत्वपूर्ण भूमिका है, वहाँ भी कर दिखाया है। विशेष रूप से, मानव एसएलई के लिए परिभाषित मापदंड विरोधी dsDNA की उपस्थिति में एसएलई के साथ संगत नेफ्रैटिस के विकास के इस माउस मॉडल की प्रमुख विशेषताएं हैं, जो दोनों के 12 एंटीबॉडी शामिल हैं।

वहाँ से कर रहे हैंसहज अधिक मॉडल bm12 मॉडल की veral लाभ। अनायास एसएलई-तरह के संकेत हैं कि विकसित क्लासिक मॉडल पीटकर या अन्यथा आनुवंशिक रूप से संशोधित चूहों कठिन और समय लेने के लिए पार करने जो संकर माउस उपभेदों, नहीं -6 पृष्ठभूमि पर बी -6 पृष्ठभूमि, या बड़े आनुवंशिक लोकी पर जन्मजात माउस उपभेदों, या तो पर भरोसा करते हैं। Bm12 inducible मॉडल के साथ, आनुवंशिक रूप से संशोधित चूहों विशेष जीन की बीमारी के लिए महत्वपूर्ण हो सकता है, जिसमें सेलुलर डिब्बे के और अधिक तेजी से पहचान की अनुमति, दाता या प्राप्तकर्ता या तो के रूप में काम कर सकते हैं। इसके अलावा, bm12 मॉडल में रोग विकास सबसे सहज मॉडल के लिए कई महीनों की तुलना में, अनस की उपस्थिति तक केवल 2 सप्ताह की आवश्यकता होती है, बहुत तेजी से होता है। इसके अलावा, अलग अलग समय बिंदुओं पर रोग का विकास है कि सहज मॉडल के विपरीत, bm12 → बी -6 मॉडल में रोग की शुरुआत और प्रगति अत्यधिक सिंक्रनाइज़ है। इस ख कर सकते हैं कि उचित आकार साथियों की पीढ़ी के लिए अनुमति देता हैई रोग के विकास के किसी भी स्तर पर हस्तक्षेप या चिकित्सीय रणनीतियों के लिए इस्तेमाल किया।

क्या इस प्रकार बी -6 की पृष्ठभूमि पर C57BL / 6 चूहों में bm12 लिम्फोसाइटों के दत्तक हस्तांतरण, या आनुवंशिक वेरिएंट द्वारा एसएलई-तरह औतोइम्मुिनित की शुरुआत के लिए एक विस्तृत प्रोटोकॉल है। इसके अतिरिक्त, हम Tfh, जीसी बी कोशिकाओं की गणना के लिए एक प्रवाह cytometric धुंधला प्रोटोकॉल का वर्णन है, और प्लाज्मा कोशिकाओं सेल प्रकार मानव रोग के साथ जुड़े। महत्वपूर्ण बात है, इन प्रोटोकॉल भी एसएलई के सबसे माउस मॉडल में रोग विशेषताएँ और अन्य रोग मॉडल में Tfh, जीसी बी कोशिकाओं और प्लाज्मा कोशिकाओं की पहचान करने के लिए इस्तेमाल किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

पशु काम आकलन और प्रयोगशाला पशु केयर इंटरनेशनल के प्रत्यायन और हमारे संस्थागत पशु की देखभाल और उपयोग समिति के लिए एसोसिएशन (IACUC) द्वारा निर्धारित दिशा निर्देशों के अनुसार विशिष्ट रोगज़नक़ मुक्त शर्तों के तहत किया गया था।

नोट: इस तरह के दाता या प्राप्तकर्ता जानवरों यदि संभव हो तो किसी पर CD45.1 के रूप में एक congenic मार्कर व्यक्त शामिल चूहों, यह दाता भ्रष्टाचार दक्षता और दाता सीडी 4 टी सेल की आबादी के विशिष्ट विस्तार की निगरानी के लिए अनुमति देता है। दाता या प्राप्तकर्ता के रूप में अन्यथा आनुवंशिक रूप से संशोधित चूहों के उपयोग पर विचार करते हैं, तो तनाव ठीक से बी -6 पृष्ठभूमि को backcrossed है, या स्थानांतरित कर कोशिकाओं को खारिज कर दिया-यह हो सकता प्रतिनिधि परिणाम और चर्चा वर्गों में अधिक से अधिक विस्तार में संबोधित किया जाएगा करता है।

नोट: 12-16 चूहों इंजेक्षन करने के लिए पर्याप्त कक्षों उपज चाहिए जो चूहों bm12 कटाई 4 दाता, निम्नलिखित प्रक्रियाओं विस्तार संस्करणों। छक्काबारह सप्ताह पुरानी bm12 चूहों को लगभग 25% सीडी 4 टी कोशिकाओं के साथ मोटे तौर पर 100-140.000.000 लिम्फोसाइट निकलेगा। ऊपर या नीचे के हिसाब से चूहों की संख्या अलग है, या अलग माउस उपभेदों, पैमाने संस्करणों के साथ शुरू होने वाले हैं। C57BL / 6 चूहों आम तौर पर केवल 20% सीडी 4 टी कोशिकाओं के करीब के साथ इसी तरह की पैदावार दे।

नोट: आरटी पर सभी चरणों को पूरा करने और लंबी अवधि के लिम्फोसाइट व्यवहार्यता ख़राब कर सकते हैं, जो गर्मी और सर्दी के झटके से बचने के लिए आर टी मीडिया का उपयोग करें। ऊतक कटाई और सड़न रोकनेवाला तकनीक का उपयोग कर एक टिशू कल्चर हुड में ऊतक प्रसंस्करण चरणों का प्रदर्शन। इस प्रोटोकॉल में सभी मीडिया के साथ IMDM है 10% गर्मी निष्क्रिय जब तक अन्यथा इंगित, FBS, और बस के रूप में करने के लिए भेजा जाएगा "पूरा मीडिया।"

1. उपन्यास विधि जीनोटाइपिंग bm12 चूहे के लिए

नोट: जीनोटाइपिंग के लिए एक संक्षिप्त प्रतिबंध पचाने आधारित प्रोटोकॉल वर्तमान में केवल प्रकाशित जीनोटाइपिंग विधि है जो अनुक्रमण के लिए एक सरल और सस्ता विकल्प के रूप में, यहां प्रदान की गई हैइन चूहों के लिए।

  1. माउस पूंछ से जीनोमिक डीएनए अलग। माउस पूंछ कतरन पर विस्तृत प्रोटोकॉल के लिए पिछले एक जौव लेख और पूंछ से सीडीएनए की पीढ़ी के लिए कृपया देखें 13 हज़म।
  2. 1 टेबल में सूचीबद्ध प्राइमरों और thermocycling शर्तों का उपयोग bm12 एमएचसी-द्वितीय आइए और आइए से एक आम 474 बीपी डीएनए टुकड़ा बढ़ाना एक रिवर्स ट्रांसक्रिपटेस polymerized चेन रिएक्शन (पीसीआर) 14 कार्य करें।
  3. प्रतिबंध एंजाइम PsuI, या जंगली प्रकार आइए कटौती है, जो अपने isoschizomers (BstX2I, BstYI, MflI, या XhoII), में से एक है, लेकिन नहीं आइए bm12 उत्परिवर्ती का उपयोग पीसीआर उत्पाद के ~ 7 μl पर पचाने प्रदर्शन करते हैं। , पानी का मिश्रण निर्दिष्ट बफर और एंजाइम जाएगा जो निर्माता, और 5 मिनट की एक ऊष्मायन द्वारा प्रदान प्रोटोकॉल को पचाने का पालन करें। 37 डिग्री सेल्सियस 15 पर कई घंटे के लिए।
  4. लोड उत्पाद को पचाने और 30-45 मिनट के लिए ethidium ब्रोमाइड के साथ 14 1% polyacrylamide जेल पर चलाते हैं। 1 पर50V-हालांकि इष्टतम वोल्टेज और समय सेटिंग्स उपयोग पीसीआर जेल तंत्र के आधार पर अलग अलग होंगे। एक यूवी प्रकाशक के साथ डीएनए बैंड कल्पना। प्रतिनिधि परिणाम चित्रा 1 में दिखाया जाता है।

चित्र 1
जीनोटाइपिंग परिणाम bm12 चित्रा 1. प्रतिनिधि।
आइए bm12 / bm12 के लिए समयुग्मक चूहों की पहचान करने के लिए, पूंछ डीएनए पीसीआर द्वारा bm12 के लिए दिखाई गई / प्रतिबंध जीनोटाइपिंग (चरण 1) पचाने। Homozygous जंगली प्रकार (आइए बी / बी) डीएनए 227 पर दो बैंड और (~ 250 बीपी पर एक मोटी बैंड के रूप में कल्पना की) 247 बीपी पैदावार; समयुग्मक bm12 (आइए bm12 / bm12) डीएनए पैदावार 474 बीपी पर एक बैंड; और विषमयुग्मजी (आइए bm12 / बी) डीएनए ~ 250 और 474 बीपी पर दो बैंड अर्जित करता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

2. फसल काटने वाले डोनरप्रकोष्ठों

  1. संस्थागत पशु की देखभाल और उपयोग समिति (IACUC) का उपयोग बलिदान दाता चूहों प्राथमिक और माध्यमिक इच्छामृत्यु तरीकों अनुमोदित। उदाहरण के लिए, ग्रीवा अव्यवस्था के बाद सीओ 2 के साथ asphyxiation द्वारा चूहों euthanize।
  2. 11-13 में के रूप में 10 मिलीलीटर पूरा मीडिया वाले 15 मिलीलीटर ट्यूबों में सड़न रोकनेवाला तकनीक, फसल spleens और लिम्फ नोड्स (सतही ग्रीवा, जबड़े, बाहु, कक्षा, mesenteric, और वंक्षण) का उपयोग करना।
    नोट: विस्तृत लिम्फ नोड विच्छेदन प्रोटोकॉल 16 के लिए पिछली रिपोर्टों को देखें - 18। यह मॉडल हस्तांतरण के लिए केवल माउस splenocytes का प्रयोग भी सफल रहा है, लेकिन लिम्फ नोड्स के अलावा काफी दाता चूहों की अपेक्षित संख्या कम कर देता है।
  3. एक सिरिंज से सवार का उपयोग कर 70 माइक्रोन सेल झरनी के माध्यम से 2.2 कदम में एकत्र लसीकावत् ऊतकों mashing द्वारा एक एकल कोशिका निलंबन उत्पन्न करता है। हर 4 के लिए बेहतर पैदावार के लिए, अधिभार नहीं है झरनी के लिए उपयोग ~ 6 झरनीचूहों संसाधित, और प्रसंस्करण अक्सर जबकि झरनी कुल्ला। 400 XG पर 5 मिनट के लिए तो दो 50 मिलीलीटर शंक्वाकार ट्यूब में 4 चूहों से सेंट्रीफ्यूज कोशिकाओं ऊतकों का मिश्रण है और सतह पर तैरनेवाला छानना।
  4. 50 मिलीलीटर पूरा मीडिया और नए शंक्वाकार ट्यूब को हस्तांतरण में दोनों शंक्वाकार ट्यूब से Resuspend कोशिकाओं। आरटी पर इस ट्यूब रखें।
    नोट: फैट ट्यूब के पक्षों का पालन करता है, और ट्यूब की जगह नहीं है, तो अंतिम सेलुलर पैदावार ग्रस्त कर सकते हैं।

3. डोनर सेल गिनती

नोट: पूरे नमूना के उच्चतम व्यवहार्यता, लाल रक्त कोशिका (आरबीसी) सेल को संरक्षित करने के लिए सिफारिश नहीं है।

  1. , अच्छी तरह से 2.4 कदम से एकल कक्ष निलंबन मिक्स 1 मिलीलीटर हटाने और एक अलग 50 मिलीलीटर शंक्वाकार को हस्तांतरण। गिनती एक तरफ जब आरटी पर, अछूता कोशिकाओं (49 एमएल) शेष निर्धारित किया है।
  2. 1 मिलीलीटर दाता सेल नमूना करने के लिए एक अमोनियम क्लोराइड आधारित लाल रक्त सेल बफर के 3 मिलीलीटर जोड़ें। 1 मिनट के लिए धीरे मिलाएं। कमाल द्वारा, तो पूरा मीडिया, एक साथ 50 मिलीलीटर को भरनेएन डी 5 मिनट के लिए अपकेंद्रित्र। 400 XG और छानना सतह पर तैरनेवाला।
  3. Resuspend (एक hemocytometer का उपयोग trypan नीले रंग के साथ जैसे,) 10 मिलीलीटर पूरा मीडिया और गिनती में कोशिकाओं आरबीसी lysed। से गुणा परिणाम 49-इस तरफ स्थापित किया गया था कि गैर-lysed नमूने में शेष कोशिकाओं की कुल संख्या है। त्यागें कोशिकाओं आरबीसी lysed।

और / या सीडी 4 टी सेल शुद्धि 4. डोनर सेल लेबलिंग

  1. अगर वांछित यह आवश्यक नहीं है, हालांकि, इस स्तर पर सीडी 4 टी कोशिकाओं को शुद्ध। 19 में के रूप में CFSE के साथ लेबल कोशिकाओं, या अन्य सेल ट्रैकिंग रंजक, अगर वांछित, साथ ही, जिनमें से एक उदाहरण प्रतिनिधि परिणाम खंड के 4 चित्र में दिखाया गया है।
    नोट: यह उच्च शुद्धता को प्राप्त करने और 20 में वर्णित के रूप में उच्च व्यवहार्यता के साथ अछूता कोशिकाओं के पत्तों के रूप में सीडी 4 टी सेल शुद्धि के लिए, नकारात्मक चुंबकीय चयन की सिफारिश की है। यह endotoxin मुक्त बफ़र्स इस्तेमाल कर रहे हैं कि महत्वपूर्ण है; इसलिए, बजाय बीएसए की, जुदाई बफर बुद्धि बनानाएच 2% FBS और EDTA के लिए सिफारिश की एकाग्रता।

दाता bm12 प्रकोष्ठों के 5. इंजेक्शन

  1. 400 x जी पर 5 मिनट के लिए चरण 3 (और शुद्ध या वांछित के रूप में, चरण 4 में लेबल के रूप में), में सेंट्रीफ्यूज कोशिकाओं दाता लिम्फोसाइट गिनती के बाद। मिलीग्राम प्रति 120 मिलियन लिम्फोसाइटों (या मिलीलीटर प्रति 30 लाख शुद्ध सीडी 4 टी कोशिकाओं) पीबीएस में सतह पर तैरनेवाला और resuspend कोशिकाओं छानना। एक बाँझ 5 मिलीलीटर आसानी से एक 27.5 जी x 13 मिमी सुई के साथ लगे एक 1 मिलीलीटर सिरिंज accommodates कि दौर नीचे ट्यूब, या अन्य बाँझ ट्यूब कोशिकाओं स्थानांतरण।
  2. दाता नमूने के भीतर सीडी 4 टी कोशिकाओं का प्रतिशत निर्धारित करने के लिए प्रवाह धुंधला के लिए 4 डिग्री सेल्सियस पर एक तरफ कदम 5.1 से दाता कोशिकाओं का एक छोटा सा नमूना सेट, इंजेक्शन से पहले। न्यूनतम एंटीबॉडी पैनल (तालिका 2) का उपयोग चरण 8 में वर्णित के रूप में इन नमूनों के दाग।
    नोट: विभिन्न माउस उपभेदों से कोशिकाओं को अलग दाताओं के रूप में उपयोग किया जाता है, तो यह एक महत्वपूर्ण विचार है, और सीडी 4 टी सेल प्रतिशत काफी हद तक, पुर अलग-अलग हो, तोवर्गीकरण आवश्यक हो सकता है।
  3. धीरे, लेकिन अच्छी तरह से कोशिकाओं मिलाएं। यह ऊपर कोशिकाओं pipetting द्वारा और एक संलग्न सुई के बिना एक 1 मिलीलीटर सिरिंज का उपयोग कर नीचे किया जा सकता है। मिश्रण के बाद, 1 मिलीलीटर सिरिंज में कोशिकाओं को आकर्षित। किसी भी हवाई बुलबुले को हटाने के बाद सुई संलग्न। सिरिंज भड़काना है, जबकि बंद सुई रखते हुए सेल व्यवहार्यता बनाए रखने में मदद करता है।
  4. 21 में वर्णित है, intraperitoneally (30 लाख लिम्फोसाइट, या माउस प्रति 75 लाख शुद्ध सीडी 4 टी कोशिकाओं के बराबर होता है), जो माउस प्रति 250 μl इंजेक्षन।
    नोट: यहाँ दिखाया प्रयोगों में और हमारे पूर्व कार्य 11 में, प्रत्येक माउस के बजाय पारंपरिक रूप से इस्तेमाल 100 मिलियन कुल splenocytes से, bm12 दानदाताओं से 30 लाख की कुल लिम्फोसाइटों के साथ इंजेक्शन है। हमारी प्रयोगशाला से अप्रकाशित डेटा में, कोई फर्क माउस प्रति 30 या 100 मिलियन लिम्फोसाइटों के इंजेक्शन के बाद 14 दिन में सीरम विरोधी dsDNA में मनाया गया। यह काफी प्रयोगों के लिए आवश्यक चूहों की संख्या, नेफ्रैटिस बुद्धि के विकास को कम कर देता है, जबकिज कोशिकाओं की इस संख्या का आकलन नहीं किया गया है।

6. क्षमता ग्राफ्टिंग का निर्धारण करें

नोट 1: यह खंड उपअनुकूलित इंजेक्शन प्राप्त हो सकता है जो किसी भी चूहों (जैसे, एक माउस में भ्रष्टाचार में देखा है कि के <10% है पहचान करने के क्रम में 3 दिन में प्राप्तकर्ता में दाता सेल ग्राफ्टिंग की डिग्री का निर्धारण करने के लिए कैसे का वर्णन करेंगे एक ही समूह से अन्य सभी चूहों)। ये आंकड़े यह भी एक आनुवंशिक रूप से संशोधित माउस तनाव से कोशिकाओं (, जानकारी के लिए, प्रतिनिधि परिणाम अनुभाग देखें चित्रा 6) बाद में समय बिंदुओं पर खारिज कर रहे हैं कि क्या यह निर्धारित करने में मदद कर सकते हैं।

नोट 2: इस खंड CD45.1 bm12 दाताओं और CD45.2 C57BL 6 / प्राप्तकर्ताओं का उपयोग करते समय दानदाताओं और प्राप्तकर्ताओं अलग congenic पृष्ठभूमि, जैसे, पर चूहों से कर रहे हैं, तो तभी संभव है, या दाता कोशिकाओं के एक सेल ट्रैकिंग डाई के साथ लेबल रहे हैं। महत्वपूर्ण बात है, 3 दिन बाद इंजेक्शन पर, सीडी 4 टी कोशिकाओं न्यूनतम विस्तार आया है (एसईग्राफ्टिंग की डिग्री में मनाया मतभेद, इंजेक्शन में परिवर्तनशीलता के विस्तार की वजह से नहीं कर रहे हैं तो ई प्रतिनिधि परिणाम अनुभाग, चित्रा 4),।

  1. 4 isoflurane% या अन्य IACUC को मंजूरी दे दी विधि के साथ चूहों anesthetize। ठीक से खून आकर्षित करने के लिए आगे बढ़ने से पहले anesthetized है माउस को सुनिश्चित करने के पीछे के पैर सजगता का परीक्षण करें।
  2. इस तरह 22 के रूप में रेट्रो कक्षीय पंचर के रूप में एक IACUC-विधि को मंजूरी दी, का उपयोग कर फसल 100-200 μl खून। ऐसे lyophilized Dipotassium EDTA के होते हैं, जो सामग्री तालिका में संदर्भित प्लाज्मा संग्रह ट्यूब, के रूप में एक विरोधी कौयगुलांट युक्त व्यक्ति 0.5 मिलीलीटर microcentrifuge ट्यूबों में खून ले लीजिए। रक्त संग्रह के बाद, यह अंतिम ऊतक फसल (चरण 7) जब तक रहेगा, जहां से वापस अपने घर पिंजरे में माउस, फिर खून बह रहा बंद हो जाता है यह सुनिश्चित करने के लिए जगह एक बाँझ तौलिया या धुंध का उपयोग कर माउस आंख कोमल दबाव लागू होते हैं।
    नोट: चूहों के लिए पर्याप्त होश आ गया है की पहुंच से बाहर है, जब तक चूहों मत छोड़ोउदर लेटना बनाए रखने, और पूरी तरह से ठीक है, जब तक दूसरों की कंपनी के लिए चूहों वापस नहीं है।
  3. (फिर धीरे धीरे दो चरणों के बीच मिश्रण को कम से कम करने के लिए सावधान किया जा रहा है, एक 200 μl pipet के साथ 21 डिग्री सेल्सियस उच्च घनत्व सेल जुदाई समाधान के 200 μl बुनियाद, 21 डिग्री सेल्सियस पीबीएस के साथ 500 μl के लिए रक्त की मात्रा ले आओ और शंक्वाकार नीचे microcentrifuge ट्यूब के लिए स्थानांतरण ) की सिफारिश के समाधान के लिए सामग्री तालिका देखें। कम करने के लिए सेट सेंट्रीफ्यूज ब्रेक के साथ 20-25 डिग्री सेल्सियस पर 20 मिनट के लिए 700 XG पर अपकेंद्रित्र कोशिकाओं।
  4. 800 μl ठंड पूरा मीडिया से युक्त एक नया microcentrifuge ट्यूब के लिए एक 1 मिलीलीटर pipet और हस्तांतरण के साथ लिम्फोसाइट युक्त ऊपर परत निकालें। धीरे कोशिकाओं मिश्रण करने के लिए भंवर। 5 4 डिग्री सेल्सियस पर मिनट और छानना सतह पर तैरनेवाला के लिए 700 XG पर अपकेंद्रित्र कोशिकाओं।
  5. 200 μl में Resuspend कोशिकाओं टी निर्धारित करने के लिए एक न्यूनतम एंटीबॉडी पैनल (तालिका 2) का उपयोग चरण 8 में वर्णित cytometry के रूप में प्रवाह के लिए पूरा मीडिया, एक 96 अच्छी तरह से यू-नीचे की थाली को हस्तांतरण, और दागवह PBMCs के प्रतिशत के रूप में सीडी 4 टी सेल भ्रष्टाचार के रिश्तेदार बहुतायत।

7. अंतिम ऊतक फसल

नोट: परिणाम अनुभाग में वर्णित प्रयोगों 14 दिनों दाता कोशिकाओं के इंजेक्शन के बाद काटा गया (या कुछ मामलों में कम समय में), वे Tfh कोशिकाओं और प्लाज्मा कोशिकाओं के प्रारंभिक विकास पर ध्यान केंद्रित करने के रूप में; इस मॉडल एसएलई की एक पुरानी GVHD मॉडल है लेकिन, जब से बीमारी बहुत बाद में समय बिंदुओं पर नजर रखी जा सकती है। इष्टतम समय सीमा प्रत्येक व्यक्ति के लिए प्रयोग में उत्पन्न अनुसंधान सवाल पर निर्भर करेगा।

  1. Bm12 दाता कोशिकाओं (कदम 5.4) के इंजेक्शन के बाद एक पूर्व निर्धारित समय बिंदु पर, इच्छामृत्यु की एक IACUC को मंजूरी दे दी विधि का प्रयोग चूहों बलिदान। Exsanguination द्वारा पीछा सीओ 2 के साथ asphyxiation की सिफारिश की है। सरवाइकल अव्यवस्था इच्छामृत्यु के एक माध्यमिक विधि के रूप में कार्य कर सकते हैं, लेकिन यह रक्त ड्रा उपज कम हो सकता है।
  2. हल्के से 70% से युक्त एक स्प्रे बोतल के साथ माउस के पेट गीलेइथेनॉल। लगभग 1 सेमी जननांग ऊपर शल्य कैंची के साथ एक छोटी सी, सतही चीरा। बरकरार पेरिटोनियल प्रावरणी रखने के लिए सावधान किया जा रहा है, उरोस्थि की ओर पेट की त्वचा वापस खींचना।
    नोट:, यह अभी तक अच्छी तरह से होती नहीं किया गया है, हालांकि मापा जाता है और एक अतिरिक्त रोग पैरामीटर के रूप में विश्लेषण किया जा सकता है, जो 14 दिन में 0.5-3 मिलीलीटर जलोदर, साथ आम तौर पर मौजूद रोगग्रस्त चूहों।
  3. एक 18 जी सुई के साथ एक 5 मिलीलीटर सिरिंज से फिट है। पशु के सिर की ओर और प्रावरणी के विमान को 15 डिग्री के कोण पर निर्देशित सुई के साथ पेट के निचले सही चक्र में सुई डालें। जलोदर aspirating जबकि आंत के साथ भरा जा रहा से सुई को रोकने में मदद करने के लिए सेसम पास सुई की नोक स्थिति।
  4. ध्यान से फिर धीरे धीरे सिरिंज में जलोदर आकर्षित है, उसकी तरफ से माउस को घुमाएगी। जलोदर बरामद किया गया है, सिरिंज को हटाने और syri की तरफ बड़ा चिह्नों पर आधारित महाप्राण मात्रा रिकॉर्डnge।
  5. बाद में प्रसंस्करण के लिए बर्फ पर एक 5 मिलीलीटर दौर नीचे ट्यूब और दुकान में निर्वहन जलोदर।
  6. अनिवार्य रूप से 22 के रूप में अवर रग Cava (आईवीसी) से ड्रा के माध्यम से फसल खून। सुस्त संदंश का प्रयोग, धीरे आईवीसी को उजागर करने के लिए, माउस के बाईं ओर करने के लिए आंतों चलते हैं। आईवीसी में 1 मिलीलीटर सिरिंज के लिए फिट 27.5 जी सुई डालें और धीरे धीरे खून के 400-500 μl आकर्षित।
  7. रक्तापघटन को कम से कम करने के लिए, धीरे धीरे एक 0.5 मिलीलीटर microcentrifuge सीरम या प्लाज्मा संग्रह ट्यूब में रक्त इंजेक्षन। एलिसा द्वारा अनस के बाद के सीरम विश्लेषण के लिए, बर्फ पर खून रहते हैं।
  8. (वांछित, लिम्फ नोड्स और गुर्दे, विशेष रूप से बाद में समय अंक और स्तवकवृक्कशोथ पर एकत्रित रन हो जाएगा तो, प्लीहा और) काटना और अतिरिक्त प्रासंगिक ऊतकों प्राप्त करते हैं। धीरे आंतों वापस जानवर के दाईं ओर की ओर रखने, और तिल्ली के प्राथमिक संयोजी ऊतक है जो अग्न्याशय, पर खींच कर तिल्ली निकालें।
  9. शेष किसी भी अग्न्याशय निकालें, तो तौलनासकल तिल्ली का बढ़ना एसएलई के माउस मॉडल में एक सामान्य सूचना पैरामीटर के रूप में है, तुरंत विच्छेदन के बाद एक उच्च परिशुद्धता संतुलन पर Spleens। बर्फ पर 1ml पूरा मीडिया के साथ भरा व्यक्ति 1.5 मिलीलीटर ट्यूबों में लसीकावत् ऊतकों रखें। 10% तटस्थ बफर formalin में गुर्दे को ठीक करें या 23 के रूप में बाद में ऊतक विज्ञान के लिए गुर्दे फ्रीज तस्वीर।
  10. 3 मिनट के लिए संग्रह के 2 घंटे के भीतर अपकेंद्रित्र खून। 10,000 XG (4 डिग्री सेल्सियस) पर। एलिसा द्वारा एना के बाद के विश्लेषण के लिए -80 डिग्री सेल्सियस पर सीरम और दुकान निकालें। विस्तृत एना एलिसा प्रोटोकॉल 24,25 के लिए पिछली रिपोर्टों को देखें। एकाधिक 10-20 μl aliquots में स्टोर सीरम / फ्रीज पिघलना चक्र कम करने, और भविष्य परीक्षणों की एक बड़ी संख्या की अनुमति है।
  11. अपकेंद्रित्र 5 मिनट के लिए 400 XG जलोदर। मिलीलीटर 0.5 कई ट्यूबों में एक 1 मिलीलीटर pipet और विभाज्य के साथ सतह पर तैरनेवाला निकालें। परमाणु विरोधी एंटीबॉडी (अनस) या अन्य घुलनशील भड़काऊ मध्यस्थों के बाद के विश्लेषण के लिए -80 डिग्री सेल्सियस पर सतह पर तैरनेवाला रुक।
  12. Resuspend सेलुलर Fract में लगभग 1 मिलीलीटर पूरा मीडिया आयन और (चरण 8 के रूप में) का प्रवाह धुंधला के लिए एक 96 अच्छी तरह से यू-नीचे प्लेट के लिए 200 μl हस्तांतरण।
  13. अलग ट्यूबों में 70 माइक्रोन सेल झरनी के माध्यम से प्रत्येक तिल्ली मुहब्बत और पूरा मीडिया से कुल्ला। 1 मिनट के लिए 1 मिलीलीटर ठंड आरबीसी lysis बफर के साथ splenocytes Resuspend। और कमाल द्वारा धीरे मिश्रण। 400 XG पर 5 मिनट के लिए ठंड पूरा मीडिया और सेंट्रीफ्यूज के साथ 10 मिलीलीटर मात्रा लाओ और सतह पर तैरनेवाला छानना।
  14. 5 मिलीलीटर में Resuspend सेल गोली पूरा मीडिया और एक hemocytometer का उपयोग गिनती। पूरा मीडिया के 200 μl 1-3 मिलियन सेल शामिल हैं कि इस तरह की मात्रा समायोजित करें। दाता सीडी 4 टी सेल और प्राप्तकर्ता बी सेल भेदभाव और विस्तार यों की एक विस्तारित पैनल (तालिका 2) का उपयोग फ्लो (चरण 8) के लिए धुंधला हो जाना शुरू करते हैं।
    नोट: क्या लेजर पर निर्भर करता है, photomultiplier ट्यूब (पीएमटी), और फिल्टर सेट संयोजन कई पैनलों में टी और बी सेल विश्लेषण पैनल को अलग करने के लिए आवश्यक हो सकता है, उपलब्ध हैं।
ve_title "> 8। प्रवाह धुंधला

  1. स्थानांतरण, या एक 96 अच्छी तरह से यू-नीचे की थाली की अलग कुओं में दौर नीचे ट्यूब के अलग-अलग 5 मिलीलीटर में 200 μl पूरा मीडिया में 1-3 मिलियन splenocytes।
    नोट: एक 96 अच्छी तरह से थाली का उपयोग कर कई नमूने दाग, लेकिन पार प्रदूषण को रोकने के क्रम में हर दूसरे को अच्छी तरह से नमूने थाली करने के लिए देखभाल करने के लिए एक कारगर तरीका है। एक 96 अच्छी तरह से थाली 24 नमूने तदनुसार पकड़ कर सकते हैं।
  2. 3 मिनट के लिए 500 XG पर अपकेंद्रित्र थाली।, उचित (Biohazard) कंटेनर में थाली से तो झाड़ू सतह पर तैरनेवाला।
  3. निर्माता की सिफारिश की एकाग्रता और 1 ग्राम / मिलीलीटर में विरोधी CD16 / विरोधी CD32 एंटीबॉडी कॉकटेल शुद्ध पर एक फिक्स व्यवहार्यता डाई युक्त (पीबीएस में 1% FBS) के प्रवाह बफर के 100 μl के साथ सेल छर्रों Resuspend। तो व्यवहार्यता डाई बुझाने के लिए 100 μl ठंड पूरा मीडिया जोड़ने, 20-25 डिग्री सेल्सियस पर 10 मिनट के लिए सेते हैं।
    नोट: रोगग्रस्त चूहों से Splenocytes आम तौर पर मृत या मर कोशिकाओं के अपेक्षाकृत उच्च संख्या में होते हैं;इसलिए, एक व्यवहार्यता डाई का समावेश है, कोशिकाओं को मरने के क्लीनर, अधिक विश्वसनीय आंकड़े में जिसके परिणामस्वरूप की गैर विशिष्ट एंटीबॉडी लेबलिंग से बचने के लिए सिफारिश की है। इसी तरह, विरोधी CD16 / विरोधी CD32 कॉकटेल एफसी रिसेप्टर्स से बाध्यकारी गैर विशिष्ट fluorescently लेबल एंटीबॉडी ब्लॉक करने के लिए शामिल किया गया है।
  4. 3 मिनट के लिए 500 XG पर अपकेंद्रित्र थाली।, Biohazard कंटेनर में थाली से तो झाड़ू सतह पर तैरनेवाला। 200 μl प्रवाह बफर में Resuspend कोशिकाओं। 3 मिनट के लिए 500 XG पर अपकेंद्रित्र थाली।, Biohazard कंटेनर में थाली से तो झाड़ू सतह पर तैरनेवाला।
  5. 50 μl प्रवाह बफर युक्त एंटीबॉडी कॉकटेल में Resuspend कोशिकाओं (तालिका 2)। 4 डिग्री सेल्सियस पर 20 मिनट के लिए सेते हैं, तो 150 μl प्रवाह बफर जोड़ें। दोहराएँ धोने कदम 8.4।
  6. पीबीएस में 100 μl 2% paraformaldehyde के साथ कोशिकाओं Resuspend। 4 डिग्री सेल्सियस पर 30 मिनट के लिए सेते हैं, तो 100 μl प्रवाह बफर जोड़ें। 3 मिनट के लिए 500 XG पर अपकेंद्रित्र थाली।, Biohazard कंटेनर में थाली से तो झाड़ू सतह पर तैरनेवाला।
  7. Resuspeएन डी 200 μl प्रवाह बफर में, ट्यूब सम्मिलित करता है या मानक प्रवाह ट्यूबों प्रवाह प्रवाह पर प्राप्त करने तक अंधेरे में 4 डिग्री सेल्सियस पर एक अतिरिक्त 100-200 μl प्रवाह बफर, और स्टोर जोड़ने के लिए स्थानांतरण।
  8. कोशिकामापी धुंधला के कई दिनों के भीतर चुना एंटीबॉडी पैनल के लिए उचित लेजर और PMTs से लैस एक प्रवाह पर मोल। इसके अलावा में रिकार्ड आगे तितर बितर चौड़ाई और / या ऊंचाई बिखराव क्षेत्र, ओर तितर बितर क्षेत्र, और उपयोग फ्लोरोसेंट मापदंडों के क्षेत्र आगे करने के लिए। विश्वसनीय परिणामों के लिए, ≥1,000 दाता प्रत्येक गुम्मट नमूने में कोशिकाओं, या तो कई घटनाओं का संग्रह संभव नहीं हो सकता है, जहां दाता कोशिकाओं के न्यूनतम विस्तार चलता है कि आनुवंशिक रूप से संशोधित या अन्यथा चालाकी से चूहों में कुल लिम्फोसाइटों के एक बराबर संख्या हासिल।
    नोट: विश्लेषण (- 6 आंकड़े 3) प्रतिनिधि परिणाम अनुभाग में विस्तार से वर्णित हैं प्रवाह cytometry।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

रोगग्रस्त चूहों द्रव्यमान और कोषमयता (चित्रा 2) के मामले में spleens 2-3 बार स्वस्थ चूहों के आकार का प्रदर्शन, के रूप में छोटा रूप में 14 दिनों में तिल्ली का बढ़ना विकसित करना।

Splenocytes क्रमिक रूप से प्रकाश तितर बितर (एसएससी-ए से एफएससी-ए) पर gated हैं, दोहरी (एफएससी-ए द्वारा FSC डब्ल्यू या एच), व्यवहार्य कोशिकाओं (व्यवहार्यता डाई की कम धुंधला), और सीडी 4 + TCRβ + (चित्रा के उन्मूलन 3 ए)। दाता कोशिकाओं CD45.1 और CD45.2 (चित्रा 3 बी, नीचे बाएँ) के आधार पर प्राप्तकर्ता कोशिकाओं से प्रतिष्ठित हैं। पीडी -1, CXCR5, बीसीएल 6, और ICOS (चित्रा 3 बी, सी) के अपरेगुलेशन द्वारा विशेषता के रूप में दाता कोशिकाओं मुख्य रूप से, एक टी कूपिक सहायक (Tfh) सेल phenotype अपनाने। प्राप्तकर्ता सीडी 4 टी सेल की आबादी के एक हिस्से को भी Tfh (चित्रा 3 बी, नीचे सही) में differentiates। का तबादला कोशिकाओं का एक प्रारंभिक मरने के बंद और / या प्रवास के बाद, दाता व्युत्पन्न Tfh के विस्तार लघुगणक, आर हैचूहों के spleens में 10-20 मिलियन कोशिकाओं eaching 14 दिनों इंजेक्शन (चित्रा 3 डी) के बाद।

स्थानांतरित कर लिम्फोसाइटों के CFSE लेबलिंग सीडी 4 टी कोशिकाओं जल्दी सक्रियता के बाद Tfh में अंतर यह है कि दाता का प्रदर्शन किया; अनिवार्य रूप से सभी विभाजित कोशिकाओं दिनों 3, 7 पर मनाया, और 14 CXCR5 और पीडी -1 (चित्रा 4) upregulated। प्रसार शिखर प्रोफाइल भी दाता सीडी 4 टी कोशिकाओं की एक अपेक्षाकृत कम प्रतिशत alloactivation और विभाजन कराना पड़ा कि सुझाव। 14 दिन से, पहचाने जाने दाता कोशिकाओं के सबसे CFSE से औसत दर्जे का डिवीजनों की अधिकतम संख्या परे विभाजित किया है कि उन लोगों के हैं।

दाता व्युत्पन्न Tfh के विस्तार अंतर्जात जीसी बी कोशिकाओं और प्लाज्मा कोशिकाओं (चित्रा 5 ए) की एक इसी संचय के साथ है। तिल्ली में प्लाज्मा सेल संचय दिन 3 या 7 (चित्रा 5 ब) पर भोले पशुओं पर कोई वृद्धि का प्रदर्शन, Tfh की तुलना में देरी हो रही है। Accordingly, परमाणु विरोधी एंटीबॉडी से पहले दिन 9 (नहीं दिखाया डेटा) के लिए आसानी से पहचाने जाने नहीं हैं, लेकिन मज़बूती से 14 दिन 11 पर मात्रा निर्धारित किया जा सकता है।

Congenic मार्कर के उपयोग के माध्यम से, हम कई उपभेदों में दाता कोशिकाओं की अस्वीकृति मनाया गया है। इस चूहों पर्याप्त C57BL 6 / पृष्ठभूमि को backcrossed नहीं कर रहे हैं जब एक आम समस्या है, वहीं bm12 कोशिकाओं आम तौर पर पूरी तरह से माना जाता है कि B6.PL- Thy1 एक / CYJ (CD90.1) चूहों में स्थानांतरित कर दिया गया है, हम भी अस्वीकृति मनाया backcrossed। इसलिए, चूहों को नियमित प्रारंभिक सीडी 4 टी सेल भ्रष्टाचार की क्षमता का आकलन करने के लिए प्रवाह धुंधला रक्त के नमूनों से दिन ~ 3 पर जांच कर रहे हैं; हम कोशिकाओं इस प्रारंभिक समय बिंदु पर बहुत कम का विस्तार किया है grafted कि CFSE प्रसार प्रयोगों से पता है। इन परिणामों के दिन 14 फसल से प्राप्त परिणामों की तुलना में तो कर रहे हैं। अस्वीकृति का एक उदाहरण मामले में, 30 लाख CD45.1 + bm12 लिम्फोसाइट Cardif में स्थानांतरित कर दिया गया - / - 12 पीढ़ियों के लिए C57BL / 6 चूहों को backcrossed गया था, जो चूहों। 5 दिन में सभी चूहों बराबर ग्राफ्टिंग (सीडी 4 टी कोशिकाओं घूम की 2-3%) प्रदर्शित है, लेकिन 14 दिन से, bm12 दाता कोशिकाओं को पूरी तरह आनुवंशिक रूप से संशोधित प्राप्तकर्ता (चित्रा 6) से सफाया कर रहे थे।

चित्र 2
चित्रा 2. प्लीहा वृद्धि कैनेटीक्स bm12 लिम्फोसाइटों के इंजेक्शन के बाद। Spleens सीधे छांटना (बाएं) के बाद एक उच्च परिशुद्धता संतुलन पर तौला गया। लाइव सेल नंबर (दाएं) मृत कोशिकाओं को बाहर trypan नीले रंग का उपयोग कर एक hemocytometer के साथ की गणना के द्वारा निर्धारित किया गया है। परिणाम SEM, ± मतलब के रूप में चित्रित कर रहे हैं, जहां एन = 9, 4, 3, और 6, क्रमशः। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

JPG "/>
एसएलई। CD45.1 + bm12 लिम्फोसाइटों के bm12 मॉडल में टी कूपिक सहायक सेल विस्तार की चित्रा 3. विश्लेषण C57BL 6 / प्राप्तकर्ताओं में स्थानांतरित कर दिया गया और spleens 14 दिन बाद विश्लेषण किया गया। (ए) "लिम्फोसाइट" (पहली पैनल), "एकल कक्षों" (दूसरे पैनल), "जीवित कोशिकाओं" (तीसरे पैनल), और "सीडी 4 टी कोशिकाओं" (चौथे पैनल) दिखा प्रतिनिधि gating रणनीति। (बी) के दाता कोशिकाओं CD45.1 और CD45.2 धुंधला द्वारा प्राप्तकर्ता सीडी 4 टी कोशिकाओं से प्रतिष्ठित और पीडी -1 और CXCR5 की अभिव्यक्ति के लिए विश्लेषण कर रहे हैं। सामान्यतः Tfh के साथ जुड़े कई प्रोटीन के अपरेगुलेशन द्वारा संकेत के रूप में (सी) दाता कोशिकाओं, Tfh फेनोटाइप अपनाने। (डी) दिन 3, 7, और 14 पद हस्तांतरण (सीडी 4 + CD45.1 + पीडी -1 + CXCR5 + जीवित कोशिकाओं के रूप में परिभाषित) दाता व्युत्पन्न Tfh के विस्तार दिखा ठेठ परिणाम। परिणाम चित्रित कर रहे हैं एकएस ± SEM मतलब है, जहां एन = 5, 4, 3, और 6, क्रमशः। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. पीडी -1 और CXCR5 विभाजित कोशिकाओं पर upregulated हैं। Bm12 कोशिकाओं से पहले C57BL 6 / प्राप्तकर्ताओं में इंजेक्शन के लिए CFSE के साथ लेबल रहे थे। प्रतिनिधि प्रवाह भूखंडों 3, 7 पर दाता सीडी 4 टी कोशिकाओं के लिए दिखाया गया है, और 14 दिनों के इंजेक्शन के बाद कर रहे हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5. प्लीहा प्लाज्मा कोशिकाओं और जीसी बी कोशिकाओं का विस्तार। (ए) भोले माउस spleens से प्रतिनिधि प्रवाह भूखंडों, या से उन14 दिनों CD45.1 + bm12 स्थानांतरण के बाद चूहों। प्लाज्मा कोशिकाओं CD138 + CD19 कम जीवित कोशिकाओं (शीर्ष पैनल) के रूप में परिभाषित कर रहे हैं। जीसी बी कोशिकाओं जीएल-7 और फैस (नीचे पैनल) व्यक्त जो CD19 + बी कोशिकाओं की एक सबसेट हैं। (बी) Quantitave डेटा समय के साथ प्लीहा प्लाज्मा कोशिकाओं के संचय दिखा। परिणाम SEM, ± मतलब के रूप में चित्रित कर रहे हैं, जहां एन = 5, 4, 3, और 6, क्रमशः। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 6
चित्रा 6 Bm12 ग्राफ्ट कुछ आनुवंशिक रूप से संशोधित प्राप्तकर्ता चूहों से खारिज कर रहे हैं। CD45.1 + bm12 लिम्फोसाइट आनुवंशिक रूप से संशोधित चूहों (शीर्ष पैनल) या C57BL 6 / (नीचे पैनल) प्राप्तकर्ता चूहों या तो में स्थानांतरित कर दिया गया। चूहे 5 दिनों के बाद इंजेक्शन पर लहूलुहान और भ्रष्टाचार दक्षता के लिए मूल्यांकन किया गया। Splenocyteएक ही चूहों से 14 दिनों के बाद विश्लेषण किया गया। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

प्राइमर का नाम अनुक्रम (5 '- 3') Annealing तापमान
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 डिग्री सेल्सियस
Bm12R GGGCAGAGGGCAGAGGTGAG
खंड चक्रों की संख्या तापमान अवधि
1 1 95 डिग्री सेल्सियस 2 मिनट।
2 40 95 डिग्री सेल्सियस 15 सेकंड।
* 65-0.5 डिग्री सेल्सियस / कदम 15 सेकंड।
72 डिग्री सेल्सियस 45 सेकंड।
3 1 72 डिग्री सेल्सियस दस मिनट।

तालिका 1:। प्राइमरों और bm12 जीनोटाइपिंग के लिए thermocycling शर्तों इष्टतम thermocycling शर्तों सटीक इस्तेमाल अभिकर्मकों और उपकरणों पर निर्भर करेगा। प्रोटोकॉल भी एक स्थिर annealing तापमान का उपयोग कर काम कर सकते हैं, हालांकि इन शर्तों, हर कदम पर annealing तापमान बदलने में सक्षम एक thermocycler के लिए अनुकूलित किया गया है।

सारणी 2
तालिका 2:। हम सफलतापूर्वक इस्तेमाल किया है पैनलों प्लीहा Tfh, जीसी बी और प्रवाह cytometry द्वारा प्लाज्मा सेल की पहचान के लिए एंटीबॉडी के पैनल प्रस्तुत कर रहे हैं3 दिन (बाएं) और bm12 सेल इंजेक्शन (मध्य) के बाद 14 दिन में टी और बी कोशिकाओं के विश्लेषण पर भ्रष्टाचार दक्षता का आकलन करने के लिए। इन 5 लेजर (355, 405, 488, 561, और 640 एनएम) के साथ एक LSRII के लिए अनुकूलित किया गया है। इन हर मशीन के लिए सबसे अच्छा विकल्प नहीं हो सकता है, हालांकि प्रत्येक fluorochrome के लिए अनुशंसित फिल्टर सेट, (दाएं) में सूचीबद्ध हैं। क्या लेजर, पीएमटी, और फिल्टर सेट संयोजन पर निर्भर करता है कई पैनलों में टी और बी सेल विश्लेषण पैनल को अलग करने के लिए आवश्यक हो सकता है, उपलब्ध हैं।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

bm12 inducible मॉडल एसएलई के सेलुलर और आणविक प्रक्रियाओं का अध्ययन करने के लिए एक अपेक्षाकृत आसान और कारगर तरीका है। स्व प्रतिजनों के खिलाफ निर्देशित adoptively का तबादला सीडी 4 टी कोशिकाओं की जीर्ण सक्रियण यहाँ वर्णित है, प्रवाह cytometry द्वारा मापा जा सकता है, जो Tfh, जीसी बी कोशिकाओं, और प्लाज्मा कोशिकाओं के संचय की ओर जाता है। जल्दी और आसानी से एसएलई के साथ रोगियों में होने वाली उन जैसे लगते हैं, और अंततः स्वप्रतिपिंडों के रोग संचय को नियंत्रित करने वाले स्व-प्रतिरक्षित कीटाणु केंद्र प्रक्रियाओं में उम्मीदवार जीन और उपन्यास उपचारों की भूमिका से पूछताछ कर सकते हैं इस मॉडल का उपयोग भविष्य के अध्ययन। इसके अलावा, यहां वर्णित प्रवाह cytometric विश्लेषण सहित इम्युनोग्लोबुलिन का विकास शामिल है कि अतिरिक्त माउस मॉडल का अध्ययन करने के लिए प्रयोग किया जाता है, लेकिन औतोइम्मुिनित, संक्रमण और एलर्जी के लिए सीमित नहीं किया जा सकता।

मानव रोग के सभी पशु मॉडल की तरह, इस मॉडल को भी अपनी सीमाएं हैं। जो रोग गतिविधियों के साथ गति को देखते हुएऑप्स और इसका परिमाण, एसएलई के विकास में शामिल सभी जीनों इस मॉडल में pathogenicity के लिए आवश्यक होने की संभावना नहीं कर रहे हैं। डेटा आनुवंशिक रूप से संशोधित प्राप्तकर्ताओं में Tfh की न्यूनतम विस्तार का सुझाव है तो इसके साथ ही, देखभाल भ्रष्टाचार अस्वीकृति बाहर शासन करने के लिए लिया जाना चाहिए। Congenic मार्कर प्राप्तकर्ता कोशिकाओं को भी अन्यथा दाता कोशिकाओं के अभाव मुखौटा सकता है जो Tfh (चित्रा 3 बी), में अंतर कर सकते, खासकर जब से फसल में दाता कोशिकाओं की उपस्थिति की पुष्टि करने के लिए इस्तेमाल किया जाना चाहिए। Congenic मार्कर का उपयोग करना, हम स्पष्ट रूप से 14 दिन (6 चित्रा) द्वारा अस्वीकृति एंटीजन harbored कि दाता कोशिकाओं के पूर्ण उन्मूलन के लिए मनाया। हम सफलतापूर्वक दाताओं के रूप में CD45.1 + bm12 और CD45.2 + bm12 चूहों का इस्तेमाल किया है, और प्राप्तकर्ता (आंकड़ों के रूप में CD45.1 + BoyJ (B6.SJL- Ptprc एक Pepc बी / BoyJ) और CD45.2 + C57BL / 6 चूहों 3, 6, 7, और अप्रकाशित डेटा)। हालांकि, जंगली प्रकार congenicB6.PL- Thy1 एक / CYJ माउस तनाव से CD90.1 + कोशिकाओं, जाहिर नहीं है कि एक घटना में अच्छी तरह से भ्रष्टाचार, और न ही एक CD90.1 + प्राप्तकर्ता (अप्रकाशित डेटा) में भ्रष्टाचार के साथ-साथ CD90.2 + bm12 कोशिकाओं नहीं करते इस मॉडल 26 के लिए अद्वितीय।

या तो C57BL 6 / या bm12 चूहों के रूप में शुरू में मॉरिस एट अल द्वारा रिपोर्ट दाता या प्राप्तकर्ता के रूप में काम कर सकते हैं। 9 हालांकि, हमारी प्रयोगशाला में हम -6 चूहों में bm12 कोशिकाओं के हस्तांतरण टी सेल और बी सेल की अधिक सुसंगत विस्तार का उत्पादन मिल दिन 14. पर आबादी इसके अलावा, विभिन्न समूहों से दाता और प्राप्तकर्ता चूहों gender- और उम्र से मिलान किया जाना चाहिए। Bm12 मॉडल की पहली वर्णन में रिपोर्ट प्रयोगों पुरुष → पुरुष और महिला → महिला स्थानान्तरण 9 के बीच किसी भी बीमारी पैरामीटर में कोई महत्वपूर्ण अंतर पाया गया है, पुरुष → महिला स्थानान्तरण पुरुष प्रतिजन (हरियाणा) के रूप में की सलाह दी स्थानांतरित कर सीडी 4 टी कोशिकाओं द्वारा व्यक्त नहीं कर रहे हैं भ्रष्टाचार reje उत्पन्न हो सकता हैमहिला प्राप्तकर्ताओं 27 में ction।

गेट पूरे CD45.1 + भ्रष्टाचार का गठन नहीं होगा - congenic मार्करों के लिए एंटीबॉडी और fluorochromes के चयन, यह दाता कोशिकाओं इस तरह के एक CD45.2 कि, डिग्री बदलती करने के लिए प्राप्तकर्ता congenic मार्कर के लिए सकारात्मक हो जाते हैं कि ध्यान दिया जाना चाहिए। घटना स्पष्ट रूप से CD45.1 + भोले, CD45.1 + दाता, और CD45.2 + प्राप्तकर्ता सीडी 4 टी कोशिकाओं (चित्रा 7) द्वारा CD45.2 अभिव्यक्ति की तुलना में यह साफ है। विशेष रूप से, दाता कोशिकाओं को भी भोले नियंत्रण (चित्रा 7) की तुलना में, अपने स्वयं के congenic मार्कर की अभिव्यक्ति upregulate करने लगते हैं। इसी तरह के परिणाम भी CD45.1 + BoyJ चूहों में CD45.2 + bm12 हस्तांतरण के साथ देखा जाता है (डेटा) नहीं दिखाया। मुमकिन है, सक्रिय सीडी 4 टी कोशिकाओं द्वारा trogocytosis 28 से प्राप्तकर्ता CD45 परिणामों के अधिग्रहण प्राप्तकर्ता बी कोशिकाओं के साथ बातचीत दोहराया बाद। वास्तव में, bm12 मोडएल विवो में trogocytosis की प्रक्रिया के अध्ययन में एक उपयोगी उपकरण साबित हो सकता है।

चित्रा 7
चित्रा 7. दाता कोशिकाओं के अधिग्रहण प्राप्तकर्ता CD45 congenic मार्कर। CD45.1 + bm12 लिम्फोसाइट CD45.2 + C57BL 6 / प्राप्तकर्ताओं में स्थानांतरित कर दिया गया। दाता, प्राप्तकर्ता, और भोले (CD45.1 +) सीडी 4 टी कोशिकाओं 14 दिनों के स्थानांतरण के बाद CD45.1 और CD45.2 अभिव्यक्ति के लिए मूल्यांकन कर रहे हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

यह C57BL / 7 चूहों में शुद्ध bm12 सीडी 4 टी कोशिकाओं के हस्तांतरण की बीमारी 29 को आरंभ करने के लिए पर्याप्त है कि दिखाया गया है; हालांकि, बराबर रोग पूरे लिम्फोसाइट स्थानांतरित कर रहे हैं जब विकसित करता है, और शुद्धि जरूरी टी सीई पर रोग निर्भरता का अध्ययन करने की आवश्यकता नहीं हैटू-आंतरिक जीन अभिव्यक्ति। इसन्ब्र्ग और उनके सहयोगियों ने स्पष्ट रूप से bm12 मॉडल में एंटीबॉडी के उत्पादन सेल लगभग विशेष रूप से प्राप्तकर्ता मूल 30 की है कि प्रदर्शन किया। इसके अलावा, प्राप्तकर्ता सीडी 4 टी कोशिकाओं 10 के लिए आवश्यकता हमारे डेटा कि प्राप्तकर्ता का संकेत मिलता है, हालांकि टी कोशिकाओं भाग ले सकते हैं, बंद सेट बहिर्जात आईएल 4 31 के अलावा द्वारा किया जा सकता है, जो उनके विकास के दौरान बी कोशिकाओं की 'पोषण' तक सीमित है कुछ हद तक कीटाणु केंद्र जवाब में, उनमें से कुछ एक Tfh फेनोटाइप (चित्रा 3 बी, नीचे सही) का विकास कर के रूप में।

विश्लेषण के लिए ऊतकों फसल के लिए जब हर bm12 प्रयोग के लिए बनाया जाना चाहिए कि एक महत्वपूर्ण निर्णय है। बेशक निर्णय कारकों भिन्न हो सकते हैं, जो वर्तमान अध्ययन, के लिए महत्वपूर्ण हैं कि क्या वास्तव में इस पर निर्भर करता है। वे Tfh कोशिकाओं और प्लाज्मा कोशिकाओं के प्रारंभिक विकास पर ध्यान केंद्रित करने के रूप में यहाँ वर्णित प्रयोगों, 14 दिन तक का समय लग; हालांकि, इस मॉडल के बाद से एक पुरानी हैएसएलई की GVHD मॉडल, रोग बहुत लंबे समय तक नजर रखी जा सकती है। वास्तव में, स्तवकवृक्कशोथ सहित एसएलई के कुछ नैदानिक ​​सुविधाओं, बाद में विकसित करना। प्रोटीनमेह के बाद इंजेक्शन 10,31 4-8 सप्ताह में चोटी के स्तर के रूप में जल्दी के रूप में 2 सप्ताह के बाद इंजेक्शन का पता चला है, लेकिन पहुंचता है किया गया है। इसके अतिरिक्त, प्रवाह cytometric यहाँ वर्णित विश्लेषण 2 सप्ताह तक चलने वाले प्रयोगों के लिए अनुकूलित किया गया है। हम इस समय बिंदु पर जीसी बी कोशिकाओं और प्लाज्मा कोशिकाओं के एक काफी संख्या में मिल; , अतिरिक्त समय दिया है, हालांकि, एना स्रावित प्लाज्मा कोशिकाओं का एक बड़ा प्रतिशत अस्थि मज्जा 32 में निवास कर सकते हैं। इसके अलावा, इस प्रवाह को धुंधला पैनल द्वारा की पहचान प्लाज्मा कोशिकाओं की संभावना भी plasmablasts में इन दो प्रकार की कोशिकाओं के बीच भेद करने के क्रम में शामिल हैं, अतिरिक्त एंटीबॉडी की आवश्यकता होगी। Tfh विस्तार संभवतः हम ध्यान केंद्रित किया है, जिस पर 14 दिन की खिड़की के बाद कुछ बिंदु पर एक शिखर तक पहुँचता है। हालांकि, हमारे ज्ञान करने के लिए, कोई अध्ययन 2 सप्ताह से परे दाता सेल नंबर bm12 की सूचना दी है, या उपयोगडी congenic मार्कर adoptively का तबादला कोशिकाओं को ट्रैक करने के लिए।

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics