Den bm12 inducerbara Modell av systemisk lupus erythematosus (SLE) i C57BL / 6 möss

JoVE Journal
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Systemisk lupus erythematosus (SLE) är en komplex autoimmun sjukdom som karakteriseras prototypically av antinukleära antikroppar (ANA) produktion och glomerulonefrit. Många andra följdsjukdomar, inklusive huden, hjärt-lung och leverskador är förknippade med sjukdomen hos vissa individer. Prevalensskattningar i USA varierar kraftigt, från 150,000-1,500,000 1,2, med särskilt hög förekomst hos kvinnor och minoriteter 3. Även om etiologin av SLE har varit svårt att urskilja, är det tänkt att uppstå från samspelet mellan olika genetiska och miljömässiga faktorer, som kulminerar i systemisk autoimmunitet.

Många djurmodeller har använts för att studera faktorer som leder till insjuknande och progression. Klassiska musmodeller av SLE innefattar genetiskt predisponerade musstammar inkluderande NZB x NZW F1 modellen och dess NZM derivat, MLR / lpr-stam, och BXSB / Yaa-stam, och inducerbara system, såsom pristane och kronisk graft-versus-host-sjukdom (cGVHD) modeller 4. Tidiga rapporter om autoantikroppsproduktion i GVHD modeller använt olika musstammar eller hamster stammar för förälder till F1 överföringar 5 - 8; mer vanligaste metoderna som används för att studera lupusliknande sjukdom omfattar i dagsläget DBA / 2 förälder → (C57BL / 6 x DBA / 2) F1 och bm12 överföringsmodell som beskrivs här. Varje modell har sina egna varningar, men de i allmänhet har en gemensam uppsättning funktioner som korrelerar med kliniska tecken på mänskliga sjukdomar. De oftast rapporterade parametrarna i musmodeller innefattar splenomegali, lymfadenopati, nefrit, ANA produktion, och på cellnivå, expansionen av T follikulära hjälparceller (TFH), germinala center (GC) B-celler och plasmaceller.

Den inducerbara bm12 modellen uppnås genom adoptiv överföring av lymfocyter från lA bm12 B6 (C) - H2 - Ab1 bm12 / KhEgJ (bm12) möss, en stam identical till C57BL / 6 med undantag för 3 aminosyrasubstitutioner på MHC klass II, i IA b C57BL / 6 (B6) möss. Alloactivation donator CD4 T-celler från mottagare APC leder till cGVHD med symtom nära liknar SLE. Specifikt innefattar dessa expansion av donatorhärledda TFH, expansion av mottagarens härledda GC B-celler och plasmaceller, och produktion av ANA inklusive för anti-dsDNA, anti-ssDNA, anti kromatin, och anti-RBC-antikroppar 9. Med tiden recipientmöss utveckla glomerulonefrit associerad med IgG-insättningar i den glomerulära, interstitiell och kärl regioner i njurarna 10. Vi har nyligen visat att, i likhet med human sjukdom, finns det också en kritisk roll för typ I-IFN i denna modell 11. Noterbart är de avgörande kriterierna för human SLE ​​omfatta utveckling av nefrit kompatibel med SLE i närvaro av anti-dsDNA-antikroppar 12, som båda är framträdande dragen i denna musmodell.

Det finns seVeral fördelar med bm12 modell över de spontana modeller. Klassiska modeller som utvecklar SLE-liknande tecken spontant förlita sig på antingen hybrid musstammar, inavlade musstammar inte på B6 bakgrund, eller stora genetiska loci på B6 bakgrund, som gör korsar att knockout eller på annat genetiskt modifierade möss svårt och tidskrävande. Med bm12 inducerbara modellen, kan genetiskt modifierade möss fungera som antingen givaren eller mottagaren, vilket gör att mer snabb identifiering av den cellulära utrymmet där vissa gener kan vara viktigt för sjukdom. Dessutom är sjukdomsutveckling i bm12 modellen mycket snabbare, kräver endast två veckor tills utseendet på ANA, jämfört med flera månader för de flesta spontana modeller. Dessutom i motsats till de spontana modeller som utvecklar sjukdomen vid olika tidpunkter, sjukdomens debut och progression i bm12 → B6 modell är starkt synkroniserade. Detta gör det möjligt för generering av lämplig storlek kohorter som kan Be används för interventionella eller terapeutiska strategier i något skede av sjukdomsutvecklingen.

Det som följer är ett detaljerat protokoll för initiering SLE-liknande autoimmunitet genom adoptiv överföring av bm12 lymfocyter till C57BL / 6-möss, eller genetiska varianter på B6 bakgrunden. Dessutom beskriver vi en flödescytometrisk färgningsprotokollet för att räkna TFH, GC B-celler, och typer plasmaceller celler i samband med sjukdom hos människor. Viktigt, kan dessa protokoll också användas för att karakterisera sjukdom hos de flesta musmodeller av SLE och identifiera TFH, GC B-celler och plasmaceller i andra sjukdomsmodeller.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Djur Arbetet utfördes under specifika patogenfria förhållanden i enlighet med de riktlinjer som fastställts av Föreningen för bedömning och ackreditering av försöksdjurs Care International och vår Institutional Animal Care och användning kommittén (IACUC).

OBS: Införliva möss som uttrycker en kongena markör såsom CD45.1 antingen givaren eller mottagaren djur om möjligt, eftersom det möjliggör övervakning av givar graft effektivitet och specifik expansion av donator CD4 T-cellpopulationen. Om överväger att använda annat genetiskt modifierade möss som donator eller mottagare, se till att stammen är korrekt återkorsas till B6 bakgrunden, eller överförda celler kan avvisas-detta kommer att tas upp mer i detalj i de representativa resultat och diskussions sektioner.

OBS: Följande förfaranden detaljvolymer för avverkning 4 donator bm12 möss, vilket bör ge tillräckligt med celler att injicera 12-16 möss. Sextill tolv veckor gamla bm12 möss ge cirka 100 till 140.000.000 lymfocyter med cirka 25% CD4 T-celler. Om börjar med olika antal möss, eller olika musstammar, skala volymer uppåt eller nedåt i enlighet med detta. C57BL / 6-möss ger i allmänhet liknande utbyten med närmare endast 20% CD4-T-celler.

OBS: Utför alla steg vid RT och använda RT media för att undvika värme och köldchock, vilket kan försämra den långsiktiga lymfocytviabiliteten. Utför vävnads skörd och vävnads processteg i en vävnadsodling huva med aseptisk teknik. All media i detta protokoll är IMDM med 10% värmeinaktiverat FBS, om inget annat anges, och kommer helt enkelt kallad "komplett medium."

1. ny metod för Genotyping bm12 Möss

OBS: En kort restriktion digest-baserat protokoll för genotypning finns här, som ett enkelt och billigt alternativ till sekvensering, som är för närvarande den enda publicerade genotypning metodför dessa möss.

  1. Isolera genomiskt DNA från mus svansar. Se en tidigare JUPITER artikeln för detaljerade protokoll på musens svans klippning och generering av cDNA från svansen smälter 13.
  2. Utföra en omvänd-transkriptas polymeriserad kedjereaktion (PCR) 14 för att förstärka en gemensam 474 bp DNA-fragment från MHC-II IA B och IA bm12 användning av primers och termocykling villkor som anges i tabell 1.
  3. Utför begränsning smälta på ~ 7 ul av PCR-produkten med hjälp av enzymet PsuI, eller en av dess isoschizomers (BstX2I, BstYI, MflI eller XhoII), som skär vild typ IA b men inte IA bm12 mutant. Följ smälta protokoll som tillhandahålls av tillverkaren, vilket kommer att ange en blandning av vatten, buffert och enzym och en inkubation av 5 min. till flera timmar vid 37 ° C 15.
  4. Ladda smälta produkten och kördes på 1% polyakrylamidgel med etidiumbromid 14 för 30-45 min. på 150V-men optimala inställningar spänning och tid kommer att variera beroende på PCR gelapparat används. Visualisera DNA-band med en UV-illuminator. Representativa resultat visas i Figur 1.

Figur 1
Figur 1. Representant bm12 genotypningsförfaranden resultat.
För att identifiera möss homozygota för IA bm12 / bm12 var svans-DNA screenades för bm12 av PCR / begränsning smälta genotypning (steg 1). Homozygot vildtyp (IA b / b) DNA ger två band vid 227 och 247 bp (visualiseras som ett tjockt band vid ~ 250 bp); homozygot bm12 (IA bm12 / bm12) DNA ger ett band på 474 bp; och heterozygot (IA bm12 / b) DNA ger två band vid ~ 250 och 474 bp. Klicka här för att se en större version av denna siffra.

2. Skörde DonatorCeller

  1. Sacrifice donatormöss använder Institutional Animal Care och användning kommittén (IACUC) -godkända primära och sekundära dödshjälp metoder. Exempelvis euthanize möss genom kvävning med CO2, följt av cervikal dislokation.
  2. Använd aseptisk teknik, skörd mjälte och lymfkörtlar (ytlig livmoderhalscancer, underkäken, brachial, armhålan, mesenteriska, och inguinal) i 15 ml rör innehållande 10 ml komplett medium som i 11-13.
    OBS: Se tidigare rapporter för detaljerad lymfkörtel dissektion protokoll 16 - 18. Denna modell är också framgångsrika med användning av endast mussplenocyter för överföring, men tillsatsen av lymfkörtlar signifikant reducerar det erforderliga antalet donatormöss.
  3. Skapa en encelliga suspension genom mosa lymfvävnader som samlats in i steg 2.2 till 70 um cell silar med hjälp av kolven från en spruta. För bättre avkastning, inte överbelasta silar användningsområden ~ 6 silar för varje 4möss bearbetas och skölj silar ofta medan bearbetning. Kombinera vävnader från 4 möss i två 50 ml koniska rör och sedan centrifugera cellerna under 5 min vid 400 xg och dekan supernatanten.
  4. Resuspendera cellerna från båda koniska rör i 50 ml komplett media och transfer till nya koniska rör. Håll detta rör vid RT.
    OBS: Fett följer de sidor av röret, och om röret inte ersätts, kan de slutliga cellulära utbyten lida.

3. Givarcellräkning

OBS: För att bevara den högsta lönsamheten, röda blodkroppar (RBC) lys av hela provet rekommenderas inte.

  1. Blanda enda cell avstängning från steg 2,4 väl, ta bort 1 ml och överför den till en separat 50 ml konisk. Avsätt återstående, orörda celler (49 ml) vid RT medan räkna.
  2. Tillsätt 3 ml av en ammonium-kloridbaserat röda blodkroppar lysbuffert till cellprovet 1 ml donator. Blanda försiktigt under 1 minut. genom att gunga, fyll till 50 ml med fullständigt medium, ennd centrifugera under 5 min. vid 400 xg och dekantera supernatanten.
  3. Resuspendera RBC-lyserade celler i 10 ml komplett media och räkna (t.ex., med trypanblått med hjälp av en hemocytometer). Multiplicera resultatet med 49-detta är det totala antalet celler som finns kvar i det icke-lyserade prov som avsattes. Släng RBC-lyserade celler.

4. Donor Cell Märkning och / eller CD4 T Cell Rening

  1. Om så önskas, rena CD4 T-celler i detta skede, även om detta inte är nödvändigt. Dessutom, om så önskas, etikett celler med CFSE, såsom i 19, eller andra spårningscell färgämnen, varav ett exempel visas i figur 4 av resultat sektionen ombudet.
    OBS: För CD4 T-cell rening, är negativ magnetisk selektion rekommenderas, eftersom den kan uppnå hög renhet och lämnar celler orörda med hög viabilitet, såsom beskrivs i 20. Det är viktigt att endotoxinfri buffertar används; Därför, i stället för BSA, gör separation buffert with 2% FBS och den rekommenderade koncentrationen av EDTA.

5. Injektion av givar bm12 celler

  1. Efter att ha räknat donatorlymfocyter i steg 3 (och renad eller märkt såsom i steg 4, som önskas), centrifugera cellerna under 5 min vid 400 x g. Dekantera supernatanten och återsuspendera cellerna i PBS vid 120 miljoner lymfocyter per ml (eller 30 miljoner renade CD4 T-celler per ml). Överför celler till en steril 5 ml rundbottnad röret, eller något annat sterilt tube som lätt rymmer en 1 ml spruta försedd med en 27,5 Gx 13 mm nål.
  2. Före injektion, avsätta ett litet urval av givarceller från steg 5,1 vid 4 ° C för flöde färgning för att bestämma procentandelen CD4 T-celler i prover från givare. Fläck dessa prover såsom beskrivits i Steg 8 använda minimala panelantikroppen (tabell 2).
    OBS: Om celler från olika musstammar används som separata givare, är detta en viktig faktor, och om CD4-T-cell-procenttal variera avsevärt, purförgasning kan krävas.
  3. Blanda cellerna försiktigt men grundligt. Detta kan göras genom att pipettera celler upp och ned med hjälp av en 1 ml spruta utan fastsatt kanyl. Efter blandning, rita celler i en ml sprutan. Fäst nålen efter avlägsnande av eventuella luftbubblor. Håll nålen av medan priming sprutan bidrar till att upprätthålla cellernas livskraft.
  4. Injicera 250 | il per mus (som är lika med 30 miljoner lymfocyter, eller 7,5 miljoner renade CD4 T-celler per mus) intraperitonealt, såsom beskrivs i 21.
    OBS: I experiment som visas här och i vårt tidigare arbete 11 är varje mus injicerades med 30 miljoner totalt lymfocyter från bm12 donatorer, i stället för de 100 miljoner totalt splenocyter som traditionellt används. I opublicerade data från vårt labb, observerades ingen skillnad i serum anti-dsDNA vid dag 14 efter injektioner av 30 eller 100 miljoner lymfocyter per mus. Även om detta reducerar signifikant antalet möss som behövs för experiment, utveckling av nefrit with detta antal celler inte har bedömts.

6. Bestäm Ympning Effektivitet

OBS 1: Det här avsnittet beskriver hur du bestämma graden av donatorcellen ympning i mottagaren vid dag 3 för att identifiera eventuella möss som kan ha mottagit suboptimala injektioner (t.ex. är transplantatet i en mus <10% av den som ses hos alla andra möss från samma grupp). Dessa data kan också hjälpa till att avgöra om celler från en genetiskt modifierad musstam avvisas vid senare tidpunkter (för detaljer, se representativa resultat avsnitt, figur 6).

OBS 2: Det här avsnittet är endast möjlig om givare och mottagare är från möss på olika kongena bakgrunder, till exempel, när du använder CD45.1 bm12 givare och CD45.2 C57BL / 6 mottagare, eller när givarceller är märkta med en cell spårning färgämne. Viktigt vid 3 dagar efter injektion, har CD4-T-celler genomgått minimal expansion (see representativt resultat avsnitt, Figur 4), så skillnader observerats i graden av ympning beror på variationer i injektioner, inte expansion.

  1. Söva möss med 4% isofluran eller andra IACUC-godkänd metod. Testa bakre foten reflexer för att säkerställa musen är ordentligt sövda innan du fortsätter med bloddragningen.
  2. Harvest 100-200 il blod med hjälp av en IACUC-godkänd metod, såsom retroorbital punktering i 22. Samla blod i individuella 0,5 ml mikrocentrifugrör innehållande en antikoagulant, såsom plasma uppsamlingsrören hänvisas till i tabellen material, som innehåller lyofiliserade dikalium EDTA. Efter blodinsamling, tryck lätt till musen ögat med hjälp av en steril handduk eller gasbinda för att säkerställa att det slutar att blöda, sedan placera musen tillbaka i sitt hem bur där det kommer att finnas kvar tills den slutliga vävnadsskörden (steg 7).
    OBS: Lämna inte möss utan uppsikt tills möss har återfått tillräckligt medvetandebibehålla ventrala VILA, och kommer inte tillbaka möss till sällskap med andra tills återhämtat sig helt.
  3. Ta blodvolymen till 500 pl med 21 ° C PBS och överför till konisk botten mikrocentrifugrör, sedan långsamt låg bakom 200 pl 21 ° C med hög densitet cellseparationslösning med en 200 l pipett, var noga med att minimera blandning mellan de två faserna ( se Material Tabell för rekommenderade lösningar). Centrifugera cellerna vid 700 xg under 20 min vid 20-25 ° C med centrifugbroms inställd på låg.
  4. Ta bort översta lagret som innehåller lymfocyter med 1 ml pipett och förflyttas till en ny mikrocentrifugrör innehållande 800 pl kall fullständigt medium. Vortexa försiktigt för att blanda celler. Centrifugera cellerna vid 700 xg under 5 minuter vid 4 ° C och dekantera supernatanten.
  5. Resuspendera cellerna i 200 pl komplett media, transfer till en 96-brunns U-bottenplatta, och fläck för flödescytometri som beskrivs i steg 8 med hjälp av en minimal panel antikropp (tabell 2) för att bestämma than relativa förekomsten av celltransplantat CD4 T som en procentandel av PBMC.

7. Slut Tissue Harvest

OBS: De experiment som beskrivs i avsnittet resultat skördades 14 dagar efter injektion av donatorceller (eller i vissa fall mindre tid), eftersom de fokuserar på den inledande utvecklingen av TFH celler och plasmaceller; men eftersom denna modell är en kronisk GVHD modell av SLE, sjukdom kan övervakas vid mycket senare tidpunkter. Den optimala tidsramen kommer att bero på forskning fråga som ställs i varje enskilt experiment.

  1. Vid en förutbestämd tidpunkt efter injektion av bm12 donatorceller (steg 5,4), offra möss med användning av en IACUC-godkänd metod för eutanasi. Kvävning med CO2, följt av blodtappning rekommenderas. Halsdislokation kan fungera som en sekundär metod för eutanasi, men detta kan minska bloddragningen utbyte.
  2. Blöt buken av musen lätt med en spray flaska innehållande 70%etanol. Gör ett litet, ytlig snitt med kirurgisk sax approximativt 1 cm ovanför genitalier. Dra tillbaka huden på buken mot bröstbenet, var noga med att hålla peritoneal fascia intakt.
    OBS: Sjuka möss brukar vistas med 0,5-3 ml ascites vid dag 14, som, även om den ännu inte har karakteriserats väl, kan mätas och analyseras som en extra parameter sjukdom.
  3. Montera en 5 ml spruta med en 18 G nål. Stick in nålen i det nedre högra kvadranten av buken med nålen riktad uppåt mot djurets huvud och vid 15 ° vinkel mot planet av fascia. Placera nålspetsen nära blindtarmen för att förhindra nålen från att bli igensatta med tarmen medan aspire ascites.
  4. Rotera försiktigt musen på sin sida, sedan sakta dra ascites i sprutan. När ascites har återvunnits, ta bort sprutan och registrera aspirera volym, baserat på de volym markeringarna på sidan av SyriNBE.
  5. Discharge askites i en 5 ml rundbottnad, som förvaras på is under senare bearbetning.
  6. Skörd blod via dragning från den nedre hålvenen (IVC) väsentligen såsom i 22. Med hjälp av tråkiga pincett, försiktigt flytta tarmarna till vänster sida av musen, avslöja IVC. Sätt i en 27,5 G-nål monterad på en 1 ml spruta i IVC och långsamt dra 400-500 il blod.
  7. För att minimera hemolys, långsamt injicera blod i en 0,5 ml mikro serum eller plasmauppsamlingsröret. För senare serum analys av ANA med ELISA, hålla blod på is.
  8. Dissekera och erhålla ytterligare relevanta vävnader (mjälte och, om så önskas, lymfkörtlarna och njurarna, i synnerhet om att samla in vid senare tidpunkter och glomerulonefrit görs). Avlägsna mjälten genom att försiktigt placera tarmarna tillbaka mot den högra sidan av djuret, och drar i bukspottkörteln, vilket är mjälten primära bindväv.
  9. Ta bort eventuella bukspottkörteln kvar, sedan vägamjältar på en hög precision balans omedelbart efter dissekering, som brutto splenomegali är en vanlig rapporterad parameter i musmodeller av SLE. Placera lymfoidvävnadema i enskilda 1,5 ml rör fyllda med 1 ml komplett medium på is. Fix njurar i 10% neutral formalin eller knäppa frysa njurar för senare histologi som i 23.
  10. Centrifug blod inom 2 timmar för insamling under 3 min. vid 10000 xg (4 ° C). Avlägsna serumet och förvara vid -80 ° C för senare analys av ANA genom ELISA. Se tidigare rapporter för detaljerade ANA ELISA-protokoll 24,25. Butiks serum i multipel 10-20 pl alikvoter för att minimera frysnings / upptiningscykler, och tillåta ett större antal framtida analyser.
  11. Centrifug Ascites 400 xg under 5 minuter. Avlägsna supernatanten med en 1 ml pipett och delprov i flera 0,5 ml rör. Freeze supernatanten vid -80 ° C för senare analys av antinukleära antikroppar (ANA) eller andra lösliga inflammatoriska mediatorer.
  12. Resuspendera cellulär fract jon i cirka 1 ml fullständigt medium och överföra 200 ^ till en 96-brunnars U-bottenplatta för flöde färgning (såsom i steg 8).
  13. Mosa varje mjälte genom 70 um cell silar i separata rör och skölj med komplett medium. Resuspendera splenocyter med 1 ml kall RBC lys buffert under 1 minut. och blanda försiktigt genom att gunga. Bringa volymen till 10 ml med kall fullständigt medium och centrifugera i 5 minuter vid 400 xg och dekan supernatanten.
  14. Resuspendera cellpelleten i 5 ml komplett medium och räkna med en hemocytometer. Justera volymen så att 200 pl komplett medium innehåller 1-3 miljoner celler. Börja färgning för flödescytometri (Steg 8) med användning av en utsträckt panel (tabell 2) för att kvantifiera donator CD4 T-cell och mottagare B-cellsdifferentiering och expansion.
    OBS! Beroende på vilken lasern, fotomultiplikatorrör (PMT) och filteruppsättning kombinationer finns, som separerar cellanalys panelen T- och B i flera paneler kan vara nödvändig.
ve_title "> 8. Flow Färgning

  1. Överföring 1-3 miljoner splenocyter i 200 pl komplett medium i enskilda 5 ml rundbottnade rör, eller i separata brunnar i en 96-brunnars U-bottenplatta.
    OBS: Med användning av en 96-brunnar är ett effektivt sätt att färga multipla prover, men se till tallrik prover i varannan brunn för att förhindra korskontaminering. En 96-brunnar kan följaktligen hålla 24 prover.
  2. Centrifugera plattan vid 500 xg under 3 min., Sedan flick supernatant från plattan i lämplig (biologiskt) behållare.
  3. Resuspendera cellen pellets med 100 pl buffertflöde (1% FBS i PBS) innehållande en fastställbara livskraft färgämne på tillverkarens rekommenderade koncentration och renad anti-CD16 / anti-CD32-antikropp cocktail på 1 mikrogram / ml. Inkubera i 10 minuter vid 20-25 ° C, tillsätt sedan 100 | il kall komplett medium för att släcka viabilitet färgämne.
    OBS: Splenocyter från sjuka möss innehåller vanligtvis relativt höga antalet döda eller döende celler;Därför är införandet av en lönsamhets färgämne rekommenderas för att undvika icke-specifik märkning av döende celler, vilket resulterar i renare, mer tillförlitliga uppgifter antikropp. På liknande sätt är anti-CD16 / anti-CD32 cocktail inkluderas för att blockera icke-specifik fluorescensmärkt antikropp-bindning genom Fc-receptorer.
  4. Centrifugera plattan vid 500 xg under 3 min., Sedan flick supernatant från plattan i biologiskt behållare. Resuspendera cellerna i 200 | il buffertflöde. Centrifugera plattan vid 500 xg under 3 min., Sedan flick supernatant från plattan i biologiskt behållare.
  5. Resuspendera cellerna i 50 | il buffertflöde innehållande antikropp cocktail (tabell 2). Inkubera under 20 minuter vid 4 ° C, tillsätt sedan 150 | il flödesbuffert. Upprepa tvättsteg 8,4.
  6. Resuspendera cellerna med 100 | il 2% paraformaldehyd i PBS. Inkubera under 30 minuter vid 4 ° C, tillsätt sedan 100 | il flödesbuffert. Centrifugera plattan vid 500 xg under 3 min., Sedan flick supernatant från plattan i biologiskt behållare.
  7. Resuspeai 200 pl buffertflöde, överföring till flödesröret insatser eller standardflödesrören, lägga till en extra flödesbuffert 100-200 pl, och förvara vid 4 ° C i mörker tills förvärva på flödescytometer.
  8. Förvärva på en flödescytometer utrustad med lämpliga lasrar och PMTs för de valda antikropps panelerna inom flera dagars färgning. Spela in ljusspridning framåt bredd och / eller höjd utöver översända spridningsområdet, sidospridning område, och området av de fluorescerande parametrar utnyttjas. För tillförlitliga resultat, förvärva ≥1,000 givarceller i varje WT prov, eller motsvarande totala antalet lymfocyter i genetiskt modifierade eller på annat sätt manipulerade möss som visar minimal expansion av givarceller, där insamling av så många händelser som inte är genomförbar.
    OBS: Flödescytometri analyser beskrivs i detalj i resultaten sektionen den representativa (figurerna 3 - 6).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Sjuka möss utvecklar splenomegali i så lite som 14 dagar, uppvisar mjälte 2-3 gånger större än friska möss när det gäller massa och cellularitet (Figur 2).

Splenocyter sekventiellt gated på ljusspridning (FSC-A genom SSC-A), eliminering av dubletter (FSC-W eller -H av FSC-A), levande celler (låg färgning av lönsamheten färg) och CD4 + TCRβ + (figur 3A). Donatorceller skiljer sig från mottagarceller som bygger på CD45.1 och CD45.2 (Figur 3B, nere till vänster). Givarceller anta huvudsakligen ett T follikulär hjälpar (TFH) cellfenotyp, såsom kännetecknas av uppreglering av PD-1, CXCR5, Bcl-6, och ICOS (Figur 3B, C). En del av den mottagande CD4 T-cellpopulation differentierar också i TFH (Figur 3B, nederst till höger). Efter en inledande die-off och / eller migration av överförda celler, är utbyggnaden av donatorhärledda TFH logaritmisk, rU NDER 10-20 miljoner celler i mjälten hos möss 14 dagar efter injektion (Figur 3D).

CFSE-märkning av överförda lymfocyter visade att donator CD4 T-celler differentierar till TFH tidigt efter aktivering; i stort sett alla delade celler observerades vid dag 3, 7, och 14 uppreglerade CXCR5 och PD-1 (Figur 4). Spridningen topp profiler tyder också på att en relativt låg andel av givar CD4 T-celler genomgick alloactivation och division. Vid dag 14, de flesta av de detekterbara givarceller är sådana som har delat utöver det maximala antalet divisioner mätbara av CFSE.

Expansionen av donatorhärledda TFH åtföljs av en motsvarande ackumulering av endogena GC B-celler och plasmaceller (figur 5A). Plasma cellackumulering i mjälten är fördröjd jämfört med den för TFH, inte uppvisar någon ökning jämfört naiva djur på dagarna 3 eller 7 (figur 5B). Accordingly, antinukleära antikroppar är inte lätt detekterbara före dag 9 (data ej visade), men tillförlitligt kan kvantifieras på dag 14 11.

Genom att använda kongena markörer, har vi observerat avstötning av donatorceller i flera stammar. Även om detta är ett vanligt problem när möss inte är tillräckligt återkorsas till C57BL / 6 bakgrund, observerade vi också avvisande när bm12 celler överfördes till B6.PL- Thy1 a / ​​CyJ (CD90.1) möss som allmänt anses vara fullt tillbakakorsade. Därför är möss rutinmässigt screenas vid dag ~ 3 genom flöde färgnings blodprov att bedöma effektiviteten av den initiala CD4 T-cellstransplantat; Vi vet från CFSE spridning experiment som transplanterade cellerna har expanderat väldigt lite i detta tidiga tidpunkt. Dessa resultat jämförs sedan med resultat som erhållits från dagen 14 skörd. I ett exempel Vid avslag, var 30 miljoner CD45.1 + bm12 lymfocyter överförs till Cardif - / - Möss som hade återkorsas till C57BL / 6-möss under 12 generationer. På dag 5, alla möss visade motsvarande ympning (2-3% av cirkulerande CD4 T-celler), men efter dag 14, var bm12 givarceller helt utslagen ur den genetiskt modifierade mottagaren (Figur 6).

Figur 2
Figur 2. Spleen tillväxt kinetik efter injektion av bm12 lymfocyter. Mjältar vägdes på en hög precision balans direkt efter excision (vänster). Levande cellantal bestämdes genom räkning med en hemocytometer med användning av trypanblått för att utesluta döda celler (till höger). Resultaten avbildas som medelvärde ± SEM, där n = 9, 4, 3, och 6, respektive. Klicka här för att se en större version av denna siffra.

jpg "/>
Figur 3. Analys av T follikulär hjälparceller expansion i bm12 modellen CD45.1 + bm12 lymfocyter SLE. Överfördes till C57BL / 6 mottagare och mjältar analyserades 14 dagar senare. (A) representant grindstrategi visar "lymfocyter" (första panel), "enstaka celler" (andra panel), "levande celler" (tredje panel), och "CD4 T-celler" (fjärde panel). (B) Donor celler skiljer sig från mottagarens CD4 T-celler från CD45.1 och CD45.2 färgning och analyserades för uttryck av PD-1 och CXCR5. (C) givarceller anta TFH fenotyp, såsom indikeras av uppregleringen av flera proteiner som vanligen förknippas med TFH. (D) Typiska resultat som visar expansionen av donator-härledda TFH (definierat som CD4 * CD45.1 + PD-1 + CXCR5 + levande celler) vid dagarna 3, 7, och 14 efter överföring. Resultaten avbildas ens medelvärde ± SEM, där n = 5, 4, 3, och 6, respektive. Klicka här för att se en större version av denna siffra.

Figur 4
Figur 4. PD-1 och CXCR5 uppregleras på celler som delar sig. Bm12 celler märktes med CFSE före insprutning i C57BL / 6-mottagare. Representativa flödes tomter visas för donator CD4 T-celler vid 3, 7, och 14 dagar efter injektionen. Klicka här för att se en större version av denna siffra.

Figur 5
Figur 5. Utbyggnad av mjälte plasmaceller och GC B-celler. (A) Representativa flödes tomter från naiva musmjältar, eller de frånmöss 14 dagar efter CD45.1 + bm12 överföring. Plasmaceller definieras som CD138 + CD19 låg levande celler (toppanelerna). GC B-celler är en delmängd av CD19 + B-celler, som uttrycker GL-7 och Fas (bottenpanelema). (B) Quantitave uppgifter som visar ansamling av mjälte plasmaceller över tiden. Resultaten avbildas som medelvärde ± SEM, där n = 5, 4, 3, och 6, respektive. Klicka här för att se en större version av denna siffra.

Figur 6
Figur 6. Bm12 transplantat avvisas av vissa genetiskt modifierade mottagarmössen. CD45.1 + bm12 lymfocyter överfördes till antingen genetiskt modifierade möss (övre paneler) eller C57BL / 6 (nedre paneler) recipientmöss. Möss åderläts vid 5 dagar efter injektion och bedömdes med avseende effektivitet transplantatet. Splenocyts från samma möss analyserades 14 dagar senare. Klicka här för att se en större version av denna siffra.

Primer Namn Sekvens (5 '- 3') Glödgningstemperatur
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
Segment Antal cykler Temperatur Varaktighet
1 1 95 ° C 2 min.
2 40 95 ° C 15 sek.
* 65 till 0,5 ° C / steg 15 sek.
72 ° C 45 sek.
3 1 72 ° C 10 min.

Tabell 1:. Primers och termocykling villkor för bm12 genotypning Optimala termocykling villkor kommer att bero på de exakta reagens och instrument som används. Dessa betingelser har optimerats för en termocykler med förmåga att förändra glödgningstemperatur vid varje steg, även om det protokoll kan också arbeta med användning av en statisk glödgningstemperatur.

Tabell 2
Tabell 2:. Antikropps paneler för mjälten TFH, GC B och identifiering plasmacell med flödescytometri Presenteras är paneler vi har använt med framgångför att bedöma effektiviteten transplantat på dag 3 (till vänster) och en analys av T- och B-celler på dag 14 efter bm12 cellinjektion (mitten). Dessa har optimerats för ett LSRII med 5 lasrar (355, 405, 488, 561 och 640 nm). Rekommenderat filtersatser för varje fluorokrom listas (till höger), även om dessa inte kan vara det bästa alternativet för varje maskin. Beroende på vilken lasern, PMT, och filteruppsättning kombinationer finns, som separerar cellanalys panelen T- och B i flera paneler kan vara nödvändig.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den bm12 inducerbara modellen är ett relativt enkelt och effektivt sätt att studera de cellulära och molekylära processer i SLE. Kronisk aktivering av adoptivt överförda CD4 T-celler riktade mot självantigener leder till ansamling av TFH, GC B-celler och plasmaceller, som kan mätas med flödescytometri, såsom beskrivits här. Framtida studier med denna modell kan snabbt och enkelt förhöra roll gener och nya behandlingar i autoimmuna germinala centrum processer som liknar de som förekommer hos patienter med SLE, och i slutändan styr den patologiska ackumulering av autoantikroppar. Vidare kan flödescytometrisk analys som beskrivs här användas för att studera ytterligare musmodeller som involverar utvecklingen av immunoglobuliner, inklusive, men inte begränsade till autoimmunitet, infektion och allergi.

Liksom alla djurmodeller för mänskliga sjukdomar, har denna modell också sina begränsningar. Med tanke på den hastighet med vilken sjukdom develops och dess storlek, inte alla som är inblandade i utvecklingen av SLE-gener är sannolikt kommer att krävas för patogenicitet i denna modell. Dessutom måste man vara noga med att utesluta avstötning när data tyder på minimal expansion av TFH i genetiskt modifierade mottagare. Kongena markörer bör användas för att bekräfta förekomsten av givarceller vid skörd särskilt eftersom mottagarceller också kan differentiera till TFH (figur 3B), som annars skulle kunna maskera avsaknaden av givarceller. Med hjälp av kongena markörer, vi observerade fullständigt avskaffande av donatorceller som uppenbarligen hyste avstötningsantigener dag 14 (figur 6). Vi har framgångsrikt använt CD45.1 + bm12 och CD45.2 + bm12 möss som givare och CD45.1 + BoyJ (B6.SJL- Ptprc a PEPC b / BoyJ) och CD45.2 + C57BL / 6-möss som mottagare (Siffror 3, 6, 7, och opublicerade data). Emellertid vildtyp kongenaCD90.1 + celler från B6.PL- Thy1 a / ​​CyJ musstam inte ympa väl, nor CD90.2 + bm12 celler transplantat brunn i en CD90.1 + mottagarens (opublicerade data), ett fenomen som är uppenbarligen inte unikt för denna modell 26.

Antingen C57BL / 6 eller bm12 möss kan fungera som donator eller mottagaren, som initialt av Morris et al. 9 Men i vårt labb finner vi överföringen av bm12 celler i B6 möss producerar mer konsekvent expansion av T-celler och B-celler populationer på dag 14. Dessutom bör givar- och mottagarländerna möss från olika grupper vara köns- och åldersmatchade. Även experiment som rapporteras i den första beskrivningen av bm12 modellen fann ingen signifikant skillnad i någon parameter sjukdom mellan manliga → manliga och kvinnliga → kvinnliga överföringar 9, är manliga → kvinnliga överföringar inte rekommenderas, eftersom man antigen (HY) uttrycks av överförda CD4 T-celler kan inducera transplantat RejeInsatser i kvinnliga mottagare 27.

När du väljer antikroppar och fluorokromer för kongena markörer, bör det noteras att givarceller blir positivt för mottagaren kongena markören i varierande grad, så att en CD45.2 - grind skulle inte utgör hela CD45.1 + transplantat. Fenomenet illustreras tydligt vid en jämförelse av CD45.2 uttryck genom CD45.1 + naiva, CD45.1 + givare och CD45.2 + mottagande CD4 T-celler (Figur 7). Notably givarceller tycks också att uppreglera uttryck av sina egna kongena markör, jämfört med naiva kontroller (Figur 7). Liknande resultat ses också med CD45.2 + bm12 överföring till CD45.1 + BoyJ möss (data visas ej). Förmodligen, förvärv av mottagarens CD45 resultat från trogocytosis 28 av aktiverade CD4 T-celler efter upprepad interaktion med mottagare B-celler. Faktum är att den bm12 lägetL kan visa sig vara ett användbart verktyg för att studera processen för trogocytosis in vivo.

Figur 7
Figur 7. donatorceller förvärva mottagare CD45 kongena markör. CD45.1 + bm12 lymfocyter överfördes till CD45.2 + C57BL / 6 mottagare. Givare, mottagare, och naiva (CD45.1 +) CD4 T-celler bedöms för CD45.1 och CD45.2 uttryck 14 dagar efter överföringen. Klicka här för att se en större version av denna siffra.

Det har visat sig att överföringen av renade bm12 CD4 T-celler i C57BL / 7 möss är tillräcklig för att initiera sjukdom 29; Men utvecklar motsvarande sjukdom när hela lymfocyter överförs, och rening inte nödvändigtvis att studera beroende sjukdom vid T ceLL-inneboende genexpression. Eisenberg och kollegor, visade tydligt att antikroppsproducerande cell i bm12 modellen är nästan uteslutande av mottagarens ursprung 30. Vidare är begränsad till den "vårdande" av B-celler under deras utveckling, vilket kan räknas av genom tillsats av exogent IL-4 31 kravet på mottagarens CD4-T-celler 10, även om våra data tyder på att mottagaren T-celler kan delta något i germinal centrum svar, eftersom en del av dem utveckla en TFH fenotyp (Figur 3B, längst ner till höger).

En kritisk beslut som måste göras för varje bm12 experiment är när man ska skörda vävnader för analys. Naturligtvis beslutet beror på exakt vilka faktorer som är viktiga för den aktuella studien, som kan variera. Experimenten beskrivs här ta upp till 14 dagar, eftersom de fokuserar på den inledande utvecklingen av TFH celler och plasmaceller; men eftersom denna modell är en kroniskGVHD modell av SLE, kan sjukdomen övervakas mycket längre. I själva verket, vissa kliniska funktioner i SLE, inklusive glomerulonefrit, utvecklas senare. Proteinuri har upptäckts så tidigt som två veckor efter injektion, men når toppnivåer på 4-8 veckor efter injektion 10,31. Dessutom, analyser flödescytometrisk beskrivs här har optimerats för experiment som varar 2 veckor. Vi finner ett stort antal GC B-celler och plasmaceller vid denna tidpunkt; men med tanke på extra tid, kan en stor del av ANA-utsöndrar plasmaceller uppehålla sig i benmärgen 32. Dessutom plasmaceller identifierats av detta flöde färgning panel sannolikt även omfatta plasmablasts-in för att skilja mellan dessa två celltyper, skulle ytterligare antikroppar krävas. TFH expansionen förmodligen når en topp någon gång efter fönstret 14-dagars som vi har fokuserat. Men för att vår kunskap, har inga studier rapporterat bm12 donatorcellantalet mer än 2 veckor, eller användningd kongena markörer för att spåra adoptivt överförda cellerna.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics