मूंगफली में aflatoxins की आरएनएआई की मध्यस्थता नियंत्रण: विधि मूंगफली में mycotoxin उत्पादन और ट्रांसजीन अभिव्यक्ति का विश्लेषण करने के लिए /

Environment
 

Summary

हम कवक Aspergillus flavus में एफ्लाटॉक्सिन-संश्लेषण जीन मुंह बंद करने के लिए आरएनए हस्तक्षेप का संकेत होते हैं कि मूंगफली के बीज में aflatoxins और transgene अभिव्यक्ति के विश्लेषण के लिए एक विधि का प्रदर्शन। पौधों में mycotoxins के आरएनएआई की मध्यस्थता नियंत्रण पहले से नहीं बताया गया है।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Arias, R. S., Dang, P. M., Sobolev, V. S. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem. J. Vis. Exp. (106), e53398, doi:10.3791/53398 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

संयुक्त राष्ट्र के खाद्य और कृषि संगठन दुनिया में खाद्य फसलों का 25% aflatoxins साथ दूषित कर रहे हैं कि अनुमान है। यही कारण है कि भोजन के 100 लाख टन से नष्ट कर दिया या प्रत्येक वर्ष गैर मानव उपभोग के लिए भेज दिया जा रहा है प्रतिनिधित्व करता है। Aflatoxins सामान्य रूप से अनाज, नट्स, रूट फसलों और अन्य कृषि उत्पादों में कवक Aspergillus flavus और parasiticus द्वारा संचित शक्तिशाली कार्सिनोजन हैं। मूंगफली पौधों में शाही सेना के हस्तक्षेप (आरएनएआई) द्वारा पांच एफ्लाटॉक्सिन-संश्लेषण जीन का मुंह बंद के साथ टीका निम्नलिखित एफ्लाटॉक्सिन संचय नियंत्रित करने के लिए इस्तेमाल किया गया था flavus। ये आम तौर पर एफ्लाटॉक्सिन-अनुकूल परिस्थितियों के तहत कुछ बीज, और बड़े क्षेत्र प्रयोगों के पारंपरिक तरीकों का उत्पादन के रूप में पहले, कोई विधि, व्यक्ति मूंगफली ट्रांसजेनिक घटनाओं में आरएनएआई की प्रभावशीलता का विश्लेषण करने के लिए एक विकल्प नहीं थे अस्तित्व में। क्षेत्र में, स्वाभाविक रूप से दूषित बीज पाने की संभावना, 1/1 करने के लिए अक्सर 1/100 हैइसके अलावा 000, एफ्लाटॉक्सिन संदूषण समान रूप से वितरित नहीं किया गया है। हमारे विधि वास्तविक समय पीसीआर (आरटी पीसीआर) के लिए कार्रवाई की छोटे टुकड़े या छोटे आरएनए अनुक्रमण के साथ, ट्रांसजेनिक घटना के अनुसार कुछ बीज का उपयोग करता है, और अल्ट्रा-प्रदर्शन तरल क्रोमैटोग्राफी (UPLC) द्वारा एफ्लाटॉक्सिन संचय के विश्लेषण के लिए। आरएनएआई व्यक्त मूंगफली लाइनों 288-72 और 288-74, 14,000 एनजी तक जमा कि नियंत्रण की तुलना में एफ्लाटॉक्सिन बी 1 में 100% की कमी (p≤0.01) और बी 2 के लिए आए थे। जी -1 एफ्लाटॉक्सिन बी 1 जब की aflatoxigenic के साथ टीका flavus। संदर्भ के रूप में, संयुक्त राज्य अमेरिका में मानव उपभोग के लिए स्वीकार्य aflatoxins की अधिकतम कुल 20 एनजी है। जी -1। इस प्रोटोकॉल ट्रांसजेनिक मूंगफली बीज और उसके मूल्यांकन के लिए तरीकों में aflatoxins की आरएनएआई की मध्यस्थता नियंत्रण के आवेदन का वर्णन है। हम मूंगफली और अन्य फसलों के प्रजनन में अपने आवेदन विज्ञान के इस महत्वपूर्ण क्षेत्र में तेजी से उन्नति लाएगा का मानना ​​है कि, चिकित्सा और मानव पोषण, और काफी प्रमुख खाद्य फसलों में aflatoxins, और संभवतः अन्य mycotoxins नियंत्रित करने के लिए अंतरराष्ट्रीय प्रयास में योगदान करेगा।

Introduction

लगभग 4.5 अरब लोगों को लंबे समय से aflatoxins 1, प्रकृति 2 में जाना जाता है सबसे शक्तिशाली carcinogens को उजागर कर रहे हैं। ये mycotoxins मक्का, कसावा, चावल, नट, अनाज और मसाले सहित दुनिया 3, में खाद्य फसलों का 25% दूषित। 4। बच्चों को 5 में stunting कारण aflatoxins, प्रतिरक्षा प्रणाली को 6 ख़राब मानव बायोप्सी 7.8 में हेपैटोसेलुलर-कार्सिनोमा के 58% में मौजूद हैं, और aflatoxicosis 9,10 की आवधिक प्रकोप के दौरान सैकड़ों लोगों को मार डालते हैं। Aflatoxins सामान्य रूप से Aspergillus flavus और द्वारा उत्पादित polyketide व्युत्पन्न mycotoxins हैं parasiticus; aflatoxins बी 1 और बी 2 द्वारा उत्पादित कर रहे हैं flavus, ए, जबकि parasiticus भी जी 1 और जी 2 पैदा करता है। इन यौगिकों और UPLC से उनकी जुदाई दिखा एक वर्णलेख की रासायनिक संरचना चित्रा 1 में दिखाया जाता है।

आकृति 1
चित्रा 1. Aflatoxins और आरएनएआई डालने के शीर्ष पर:। चार सबसे आम polyketide व्युत्पन्न aflatoxins की रासायनिक संरचना (बाएं) और (दाएं) वर्णलेख का उदाहरण: बी 1, बी 2, जी 1 और जी 2, एसपरजिलस parasiticus, द्वारा उत्पादित ।। flavus बी 1 और बी 2 नीचे का उत्पादन: आरएनएआई में जीन टुकड़े के योजनाबद्ध तीरों के तहत संख्या Aspergillus flavus जीनोम में जीन-टुकड़ा परिग्रहण संख्या रहे हैं, p5XCAPD मूंगफली परिवर्तन के लिए प्रयोग किया जाता है का निर्माण; PIV2: आलू Intron; बीपी: आधार जोड़े; RT_5X_1 और RT_5X_2:। वास्तविक समय पीसीआर प्राइमर साइटों यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

गणना 4 पर आधारित है, तो कारण मूंगफली में aflatoxins को निर्यात में आर्थिक नुकसान अकेले $ 450,000,000 अमरीकी डॉलर से अधिक एनजी। जी -1 यूरोपीय संघ के 11 में मानव उपभोग के लिए अनुमति एफ्लाटॉक्सिन की सीमा। Aflatoxins 60 वर्ष 12 के लिए जाना जाता रहा है; कई कृषि पद्धतियों अन्य कवक उपभेदों 13,14 के आवेदन सहित उनके प्रभाव को कम करने के लिए विकसित किए गए हालांकि, हालांकि, नियंत्रण की कोई सुसंगत विधि मौजूद है, और प्रतिरोधी संयंत्र किस्मों उपलब्ध नहीं हैं। यहां तक ​​कि रोगज़नक़ आक्रमण के लिए अनुकूल परिस्थितियों में, mycotoxin संचय अप्रत्याशित है और एक सामान्य वितरण का पालन नहीं करता, क्योंकि aflatoxins के प्रतिरोध के लिए परीक्षण संयंत्र जर्मप्लाज्म, विशेष रूप से कठिन है। इस प्रकार, प्रयोगों आमतौर पर बीज और 100-1,700 जी के कई नमूने के सैकड़ों डेटा 15,16 की परिवर्तनशीलता को कम करने, बड़े रोपण क्षेत्रों की आवश्यकता होती है।

शाही सेना के हस्तक्षेप था1998 17 में पता चला; और "मुंह बंद" का लाभ वर्तमान में नए आवेदनों की संख्या, उदा में पता लगाया जा रहा है।, मेटास्टैटिक स्तन कैंसर के 18, यकृत कैंसर के 19, माइलॉयड ल्यूकेमिया 20, और कीड़ों 21 और नेमाटोड 22 लोगों के खिलाफ पौध संरक्षण खिलाफ मानव चिकित्सा में। पौधों में, आरएनए हस्तक्षेप का संकेत भी संयंत्र मेजबान 25 के साथ निकट संपर्क में हैं कि कवक रोगजनकों के अंदर, 23,24 मुंह बंद प्रणालीगत posttranscriptional जीन के लिए जिम्मेदार होने के छोटे दखल शाही सेना (siRNA) और उच्च आणविक भार शाही सेना के साथ, सेल करने के लिए सेल यात्रा कर सकते हैं। फंगल रोगज़नक़ जीनों के संयंत्र की मध्यस्थता मुंह बंद करने पर आरएनएआई की प्रभावशीलता इन के लिए, कुछ संयंत्र pathosystems में वर्णित किया गया है, पौधों (पत्ते) के हवाई भागों में लक्षणों के दृश्य परीक्षा सलाद 26 में रोग मात्रा का ठहराव, यानी, oomycete Bremia अनुमति गेहूं में Puccinia 28 में p> 27 और फ्यूजेरियम। उससे भी ज्यादा मुश्किल पत्ते, (बीज) पर हमला किया अंगों मिट्टी के कई इंच के तहत कर रहे संक्रमण का कोई लक्षण दिखाने के रूप में मूंगफली में पौधों में mycotoxins, विशेष रूप से aflatoxins नियंत्रित करने के लिए आरएनएआई प्रभाव का मूल्यांकन करने के लिए है, संक्रमण की घटना अप्रत्याशित है, और केवल रासायनिक है विश्लेषण aflatoxins की उपस्थिति निर्धारित कर सकते हैं। इसके अलावा, मूंगफली में प्रत्येक ट्रांसजेनिक घटना सामान्य रूप से कुछ बीज (संयंत्र प्रति 4-6) पैदा करता है; इसलिए, बड़े क्षेत्र भूखंडों में एक नहीं, एफ्लाटॉक्सिन संचय विशेषता, पूरी फसल सीज़न चलने, और बीज के सैकड़ों प्रयोग करने के लिए परंपरागत परीक्षण संभव नहीं है। एक विधि कम से कम एक सप्ताह में विश्लेषण करने के लिए यहाँ वर्णन किया गया है, केवल कुछ बीज का उपयोग कर transgene की उपस्थिति के लिए और एक नहीं एफ्लाटॉक्सिन संचय विशेषता के लिए आरएनएआई मूंगफली बीज,।

Protocol

1. आणविक निर्माण और मूंगफली परिवर्तन

  1. पांच के डीएनए टुकड़े का मिश्रण flavus जीन, AFL2G_07223 (aflS या aflJ), AFL2G_07224 (aflR), AFL2G_07228 (aflC / pksA / pksL1), AFL2G_07731 (pes1) और AFL2G_05027 (एफ्लाटॉक्सिन तपका पंप, aflep)। इस के लिए, निम्न प्राइमरों और ultramers का उपयोग करें: डीआईआर -1, लघु Dir1-आर, डीआईआर-2-उल्टे, लघु Dir2-आर, DirAll-NCO-RV, और DirAll-BamEco-परिवार कल्याण, 1 टेबल।
    1. निर्माता के अनुसार डीएनए पोलीमरेज़ का उपयोग, (94 डिग्री सेल्सियस से 45 सेकंड के 5 चक्र, 55 डिग्री सेल्सियस 30 सेकंड, 68 डिग्री सेल्सियस 15 सेकंड के द्वारा पीछा किया, 95 डिग्री सेल्सियस 2 मिनट 25 μl प्रतिक्रिया) 5 पीसीआर चक्र से डीआईआर-1 डबल कतरा बनाओ निर्देश और प्राइमर लघु Dir1 आर 3 'की अधिकता CCCGT छोड़ने के लिए। इन चरणों को दोहराएँ डीआईआर -1 के पूरक एक 3 'की अधिकता ACGGG छोड़ने के लिए प्राइमर लघु Dir2-आर का उपयोग डीआईआर-2-उल्टे डबल कतरा बनाने के लिए।
    2. दो 199 बीपी fragme ligateनिर्माता के निर्देशों के अनुसार टी -4 डीएनए Ligase साथ एनटीएस। पीसीआर 1.1.1 का उपयोग कर प्राइमरों DirAll-CACC-परिवार कल्याण और DirAll-NCO-RV (तालिका 1) में संकेत के रूप में जिसके परिणामस्वरूप 393 बीपी टुकड़ा बढ़ाना, और प्लाज्मिड P2 + 4ENTR बनाने के लिए pENTR1A में मानक तकनीक का उपयोग कर उत्पाद क्लोन।
    3. PCAPD 29 में p2 + 4ENTR recombine: प्लाज्मिड p5XCAPD बनाने के लिए निर्माता के निर्देशों के अनुसार एलआर clonase द्वितीय एंजाइम मिश्रण का उपयोग (एन सी बी आई परिग्रहण KC176455.1), और आंशिक अनुक्रमण के द्वारा पीछा मानक तकनीक का उपयोग कोलाई DH5α में बदलना। नोट: पूरा आरएनएआई डालने तालिका 1 में दिखाया गया है।
  2. पहले से 30 रिपोर्ट के रूप में प्लाज्मिड p5XCAPD साथ एग्रोबैक्टीरियम तनाव C58C1 30 को बदलने के लिए, और इस प्रकार के रूप मूंगफली पौधों को बदलने के लिए जिसके परिणामस्वरूप जीवाणु का उपयोग करें:
    1. 50 मिलीलीटर लेग-रसा 500 के साथ पूरक, 30 डिग्री सेल्सियस p5XCAPD शरण एग्रोबैक्टीरियम पर आगे बढ़ें इस के लिए प्रयोगमाइक्रोग्राम प्रति मिलीलीटर -1 स्ट्रेप्टोमाइसिन, 25 माइक्रोग्राम प्रति मिलीलीटर -1 जेंटामाइसिन, 10 माइक्रोग्राम प्रति मिलीलीटर -1 केनामाइसिन, और एक आयुध डिपो 260 तक पहुँचने तक 250 rpm पर संस्कृति हिला।
    2. जीवाणु निलंबन में 100 माइक्रोन के 1 घंटे के लिए acetosyringone, और जगह के साथ 50 मिलीलीटर एबी कम से कम मध्यम 31 में 10 मिनट, resuspend के लिए centrifugation (6000 XG) द्वारा एग्रोबैक्टीरियम कोशिकाओं फसल 10-14 दिन पुरानी पौध Exp27-1516, धावक से explants प्रकार मूंगफली प्रजनन लाइन। ब्लाट 3 मिमी 30 मिनट के बाद सोख्ता कागज पर explants सूखी, और शूट प्रेरण मध्यम (सिम) [एमएस नमक 32, 3% सुक्रोज, 20 माइक्रोन benzylaminopurine (सी.डी.), 10 माइक्रोन thidiazuron (TDZ), पीएच 5.8, 0.3 पर उन्हें जगह तीन दिनों के लिए अंधेरे में एंटीबायोटिक दवाओं के बिना% Gellan गम]।
    3. 33 से पहले रिपोर्ट के रूप में ऊतक चयन और उत्थान करो। 2 महीने के लिए द्वि-साप्ताहिक स्थानान्तरण के साथ शूटिंग के गठन के लिए (500 माइक्रोन cefotaxime और 100 माइक्रोन केनामाइसिन) सिम के लिए ऊतकों ले जाएँ। फिर जगहशूट-बढ़ाव मध्यम (SEM) पर गोली मारता के विस्तार [5 माइक्रोन सी.डी., 1 माइक्रोन gibberellic एसिड (जीए) 3], कई महीनों के लिए द्वि-साप्ताहिक।
    4. व्यक्तिगत मार, 2 सेमी आकार में, जड़-प्रेरण माध्यम में (रिम) की जगह [1/2 एमएस, 1.5% सुक्रोज, 5 माइक्रोन α-नेफ़थलीन-एसिटिक एसिड (NAA), 2.5 माइक्रोन इण्डोल-butyric एसिड (आईबीए)], तो पौध acclimate और ग्रीन हाउस को हस्तांतरण।

साधना Aflatoxin संश्लेषण जीन के आरएनएआई शरण मूंगफली संयंत्रों की 2. पहचान

  1. आरएनएआई के साथ (पहले वर्णित के रूप में) 200 μl क्षालन परिवर्तन की प्रक्रिया के अधीन थे कि मूंगफली पौधों की युवा पत्तियों से डीएनए निकालने के लिए निर्माता के निर्देशों के अनुसार के साथ एक रोबोट वर्कस्टेशन में उपयोग संयंत्र मिनी किट रीढ़ के रूप में है जो p5XCAPD (चित्रा 1) का निर्माण जीन मुंह बंद करने के लिए प्लाज्मिड pCAPD 29।
  2. वर्णित previ के रूप में पीसीआर (एसटीएन पीसीआर) नेस्ट एकल ट्यूब से डीएनए नमूने स्क्रीनously 34 चयन मार्कर NPTII पता लगाने के लिए और आरएनएआई p5XCAPD से डालें। Clonally यह पहली पीढ़ी में परीक्षण के लिए पर्याप्त बीज का उत्पादन करने के लिए कटौती (3-4 नोड्स) पीसीआर सकारात्मक पौधों से प्रचार।
    1. डीएनए के चार 2 गुना dilutions का उपयोग करें (50-100 एनजी μl -1 कमजोर पड़ने से पहले) सभी एसटीएन पीसीआर प्रतिक्रियाओं में। 5'-AGGCTATTCGGCTATGACTG -3 'और PCAPD 6446R: 5'-CGTCAAGAAGGCGATAGAAG -3', और आंतरिक प्राइमरों PCAPD 5730F: 5'-ACTGGGCACAACAGACAATC -3 'और PCAPD 6249R: 5'-ATATTCGGCAAGCAGGCATC- NPTII के लिए, बाहरी प्राइमरों PCAPD 5714F उपयोग 3 '।
    2. 5'-CCTAACAGAACTCGCCGTAA -3 'और DirAll-NCO-RV: 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG -3', और आंतरिक प्राइमरों Probe_5027_Fw: 5'-gtatttgtgaccatgtttctg -3 एसटीएन पीसीआर प्रतिक्रियाओं में डालने आरएनएआई का पता लगाने के लिए बाहरी प्राइमरों 35S-PDSFw उपयोग 'और Probe_7228_Rv: 5'-GGACGGATAGTAAACTGCGG -3'।
  3. एसटीएन पीसीआर सकारात्मक पौधों से और चुनाव की फसल मूंगफली फली trol पौधों उसी स्थिति में हो। महत्वपूर्ण कदम: पौधों आरएनएआई पौधों के रूप में एक ही स्थिति और एक ही मौसम में उगाया जाता है कि नियंत्रण सुनिश्चित करें। जल विस्फोट एक दबाव वॉशर के साथ फली कम तीव्रता पर या 35 (चित्रा (भूरे और काले रंग पीला, नारंगी,) समूह में एक परिपक्वता बोर्ड और अलग फली पर फली रखकर Mesocarp का रंग, exocarp हटाने का निर्धारण करने के लिए हाथ से नोच 2)।

चित्र 2
विश्लेषण के लिए मूंगफली फली के 2. तैयारी चित्रा। वाम: मूंगफली एक अनिश्चित वृद्धि संयंत्र है के रूप में फसल में पाया विभिन्न मूंगफली आकार; केंद्र: exocarp के पानी के दबाव को हटाने के लिए धातु टोकरी में मूंगफली रखकर; अधिकार: एक मूंगफली प्रोफ़ाइल बोर्ड (पीला, नारंगी, भूरे और काले) पर Mesocarp रंग से परिपक्वता समूहों।98fig2large.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

3. प्रायोगिक सेटअप

  1. पीले हल्स, इस प्रक्रिया को निकालें और अलग से भूरे रंग के बीज। । 2 टेबल के अनुसार प्रयोग में उपयोग करने के लिए बीज की संख्या की गणना मूंगफली लाइन और नमूना तिथि के अनुसार तीन बीज टुकड़े (1 बीज टुकड़ा = आधा गर्भदल) की एक न्यूनतम सांख्यिकीय विश्लेषण करते हैं और मानक त्रुटि को कम करने के लिए आवश्यक है कि ध्यान दें।
नाम अनुक्रम
डीआईआर -1 5'-
GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTCGTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAATCCCCTGCATCTACGCGCACGCATC
ACTTGGGGTACCCGT -3 '
लघु Dir1-आर 5'-फॉसफोरस-TACCCCAAGTGATGCGTGCGCG -3 '
डीआईआर-2-औंधा 5'- GGTTATTGGGTGCAGAATGGTAAACCACCCAACAGTACGCGAAATG
TCAATTCCAGAGTCCCAAACCTCCCTACCGTGGCCTGGACGGATAG
TAAACTGCGGAGCTTGGGAACAAAATCCGCTGTCTGATCGCCGAAG
AGAAAGAGTTGCCTTGATTGAGCCGCATCGAGGACAGGTTGTGTTG
CTGTTGATAGACGGG -3 '
लघु Dir2-आर 5'-फॉसफोरस-CTATCAACAGCAACACAACC -3 '
DirAll-CACC-FW 5'-CACCGCCAGCTCAAAAGTGCGATGC -3 '
DirAll-NCO-आर.वी. 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG -3 '
DirAll-BamEco-FW 5'-ATGGGATCCGAATTCGCCAGCTCAAAAGTGCGATGC -3 '
पूरा आरएनएआई डालने 5'- GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTC / GTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAAT / CCCCTGCATCTACGCGCACGCAT
CACTTGGGGTACCCGTCTATCAACAGCAACACAACCTGTCCTCGAT
GCG / GCTCAATCAAGGCAACTCTTTCTCTTCGGCGATCAGACAGCG
GATTTTGTTCCCAAGCTCCGCAGTTTACTATCCGTCCA / GGCCACGG
TAGGGAGGTTTGGGACTCTGGAATTGACATTTCGCGTACTGTTGGG
TGGTTTACCATTCTGCACCCAATAACC -3 '

टेबल आरएनएआई p5XCAPD निर्माण फॉसफोरस का निर्माण करने के लिए इस्तेमाल 1. oligonucleotides और ultramers: 5 'अंत phosphorylated; "/" पाँच जीन टुकड़ों का इस्तेमाल किया अलग करता है; पूरा आरएनएआई सम्मिलित करें: p5XCAPD फार्म के लिए 2 उल्टे दोहराता रूप में इस्तेमाल किया अनुक्रम।

  1. वे एक बाँझ बीकर के नीचे कवर इतना है कि एक परत में पूरे मूंगफली के बीज रखें। बीज को कवर किया और फिर एक ही समाधान के एक बराबर मात्रा में जोड़ने के लिए 75% इथेनॉल / पानी (वी / वी) समाधान जोड़ें। 30 सेकंड के लिए परिवेश के तापमान पर सेते हैं और फिर बाँझ विआयनीकृत पानी (SDW) से कुल्ला।
  2. इस प्रकार के रूप में इथेनॉल में इलाज बीज युक्त बीकर 2% हाइपोक्लोराइट जोड़ें: तो, बीज कवर एक ही समाधान के एक बराबर मात्रा जोड़ने और 5 मिनट के लिए सेते करने के लिए पर्याप्त 2% हाइपोक्लोराइट समाधान जोड़ें। महत्वपूर्ण कदम: करने के लिए SDW बराबर की मात्रा के साथ अच्छी तरह से तीन बार कुल्ला इस्तेमाल किया हाइपोक्लोराइट की मात्रा (चित्रा 3 से 5 गुना)।

चित्र तीन
3. प्रायोगिक स्थापना चित्रा। शीर्ष पर: पहले और हाइपोक्लोराइट के बाद मूंगफली के बीज की सतह नसबंदी, बीज कोट (टेस्टा) को हटाने, मिडिल: भ्रूण और भ्रूण के निकट से देखने को हटाने, तो आधे में अंकुर कटौती, नीचे: आधा बीजपत्र बाँझ आसुत जल में, बाँझ शोषक पर सोख्ता कागज, पानी अगर, और अगर सतह पर आधा बीजपत्र के रखने (कट ओर ऊपर की तरफ) पर छात्रों। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

  1. अनुमति दें सतह निष्फल बीज 2 घंटे के लिए SDW में डूबे हुए आत्मसात करने के लिए। एक बाँझ पेट्री डिश पर बीज प्लेस संदंश के साथ बीज कोट हटाने, बीजपत्र अलग, और एक छुरी के साथ भ्रूण को हटा दें। ध्यान दें:भ्रूण त्याग या नए संयंत्रों को पुनर्जीवित करने के लिए इस्तेमाल किया जा सकता है।
  2. एक छुरी का उपयोग कर छमाही में प्रत्येक गर्भदल कट। निर्जलीकरण से बचने के लिए, सभी बीज कार्रवाई कर रहे हैं जब तक बाँझ पानी में कटौती बीज टुकड़े रखने के लिए।
  3. बाँझ पानी अगर युक्त पेट्री डिश तैयार किया है (1.5% अगर / पानी, w / v), प्रत्येक तीन बीज टुकड़े के लिए एक। संदंश का उपयोग अगर में छोटे छात्रों बनाओ, पानी / अगर प्लेटों पर (ऊपर कटौती चेहरा) संक्षिप्त बाँझ कागज तौलिए पर बीज टुकड़े के लिए अतिरिक्त पानी दाग, और फिर बीज टुकड़े जगह है।
  4. 10 दिनों के लिए 25 डिग्री सेल्सियस से बढ़ी Czapek की अगर मध्यम में aflatoxigenic Aspergillus flavus NRRL 3357 की एक ताजा संस्कृति से, एक रुधिरकोशिकामापी के साथ गिना μl SDW प्रति 50,000 बीजाणुओं, के निलंबन की तैयारी।
  5. बीजाणुओं आरएनएआई (चित्रा 4) बंदरगाहों कि बीज ऊतक के संपर्क सुनिश्चित करने के लिए, किनारों पर अपवाह परहेज प्रत्येक आधा-गर्भदल टुकड़ा की कटौती सतहों पर बीजाणु निलंबन के 2 μl रखें।

    चित्रा 4
    एफ्लाटॉक्सिन विश्लेषण के लिए चित्रा 4. टीका और ऊष्मायन। शीर्ष: आधा अंकुर, बीजाणु निलंबन के साथ टीका, और Aspergillus 24 घंटा ऊष्मायन के बाद आधे गर्भदल पर फुई विकास flavus नीचे: छोड़ दिया:। 48 घंटा के ऊष्मायन 1.5% अगर पर; केंद्र: 1.5% अगर पर 72 घंटे के लिए ऊष्मायन; सही:। गलत प्रयोगात्मक स्थापना के उदाहरण के लिए, 0.5% अगर पर 72 घंटे के लिए ऊष्मायन यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

    1. नमूना तक अंधेरे में 30 डिग्री सेल्सियस पर टीका और गैर-टीका आधा बीजपत्र युक्त पेट्री डिश सेते हैं।

    Aflatoxin विश्लेषण और जीन एक्सप्रेशन के लिए 4. सैम्पलिंग

    1. में नमूने एकत्रहर एक टुकड़ा (आधा गर्भदल) जा रहा है दोहराने, आरटी पीसीआर के लिए और एफ्लाटॉक्सिन विश्लेषण के लिए दोनों, ऊष्मायन के 24, 48 और 72 घंटा (वैकल्पिक 96 घंटा) पर तीन प्रतियों। प्रत्येक नमूने की तारीख पर अलग प्लेटों से यादृच्छिक पर नमूने उठाओ। एक ऊतक का उपयोग करना, धीरे शीशियों या टेस्ट ट्यूब में बीज टुकड़े रखने से पहले अगर और अतिरिक्त कवक spores को हटा दें।
    2. एफ्लाटॉक्सिन विश्लेषण के लिए, -80 डिग्री सेल्सियस पर एक 4 मिलीलीटर कांच पेंच टोपी शीशी और दुकान में प्रत्येक को दोहराने (एक टुकड़ा) जगह है। नोट: aflatoxins की रासायनिक स्थिरता को देखते हुए, नमूने (वर्तमान प्रयोगों आमतौर पर 1-2 महीने में) कई महीनों के लिए इस हालत में संग्रहित किया जा सकता है।
    3. आरटी पीसीआर जगह के लिए पहले से ही प्रत्येक को दोहराने (एक टुकड़ा) दो स्टेनलेस स्टील मोती (2.5 मिमी व्यास) और तीन zirconium मोती (2 मिमी व्यास) युक्त ट्यूबों पीस 2 मिलीलीटर तैयार किया।
    4. तुरंत सभी नमूने (अधिमानतः तरल नाइट्रोजन में) फ्रीज और प्रसंस्करण जब तक -80 डिग्री सेल्सियस पर उन्हें रखने के लिए।

    व्यक्तिगत आधा सी 5. Aflatoxin विश्लेषणotyledon मोहरे

    1. का प्रयोग flavus इस विश्लेषण के लिए नमूने टीका। लगभग 30 मिनट के लिए परिवेश के तापमान के नमूने लाने जोड़ने के चार खंडों (आमतौर पर 2-3 मिलीलीटर, w / v) मेथनॉल, (जो बाद में गणना के लिए रिकॉर्ड रखने के लिए) टोपियां बंद करें, और हे सेते की / एन (~ 16 घंटा) में आंदोलन के बिना अंधेरा।
    2. एक मिलान 1.5 मिलीलीटर प्रोपलीन minicolumn में एक मिलाना की जगह अल 23 बुनियादी 200 मिलीग्राम जोड़ सकते हैं और पहले 36 में वर्णित के रूप में एक और मिलाना के साथ यह टोपी; तो, eluate के संभव वाष्पीकरण से बचने के लिए काफी करीब कॉलम के तहत एक अति उच्च प्रदर्शन तरल Chomatographer (UPLC) autosampler शीशी जगह है।
    3. एक डिस्पोजेबल गिलास टेस्ट ट्यूब (प्लास्टिक का उपयोग नहीं करते हैं) में, 4.1 चरण में प्राप्त मेथनॉल निकालने के 0.5 मिलीलीटर जगह 0.5 मिलीलीटर acetonitrile जोड़ने, पिपेट द्वारा मिश्रण और 4.2 कदम में तैयार स्तंभ में मिश्रण के 0.5 मिलीलीटर लागू होते हैं। (दबाव लागू नहीं है) गंभीरता से autosampler शीशी में क्षालन की अनुमति दें। क्षालन आमतौर पर 2-4 मिनट, करीब वें लेता हैई शीशी तुरंत सेप्टा के साथ एक UPLC संगत टोपी का उपयोग। परिवेश के तापमान पर शीशियों रखें और एक UPLC पर एक ही दिन उन्हें विश्लेषण।
    4. Aflatoxins के विभाजन के लिए, एक मेल UPLC चतुर्धातुक विलायक प्रबंधक, UPLC नमूना प्रबंधक, UPLC फ्लोरोसेंट डिटेक्टर से लैस एक UPLC साधन में (ए flavus का उपयोग करते समय बी 1 और बी 2) एफ्लाटॉक्सिन मानकों के साथ नमूना eluates और autosampler शीशियों युक्त जगह autosampler शीशियों, और एक सी 18 2.1 मिमी x 50 मिमी, 1.7 माइक्रोन स्तंभ।
      1. 0.30 मिलीलीटर मिनट के प्रवाह की दर पर पानी / MeOH / सीएच 3 सीएन (64:23:13, वी / वी / वी) के मिश्रण से बना एक isocratic मोबाइल चरण -1 का उपयोग करें। निर्माता के निर्देशों 37 के अनुसार, एफ्लाटॉक्सिन एकाग्रता की सटीक गणना के लिए एक स्थिर आधारभूत जुदाई आश्वस्त chromatograms प्राप्त करते हैं।
      2. उनके बड़े पैमाने पर स्पेक्ट्रल डेटा प्राप्त करने और प्रकाशित आंकड़ों के 38 के साथ तुलना करके aflatoxins की पहचान की पुष्टि। एक मैं का उपयोगजाल मास स्पेक्ट्रोमीटर पर एक ईएसआई इंटरफेस और निर्माता के निर्देशों के अनुसार इसी सॉफ्टवेयर के साथ सुसज्जित है।
    5. Aflatoxins बी 1, बी 2 के वाणिज्यिक मानकों इसी के अलग-अलग मात्रा में इंजेक्शन के द्वारा प्राप्त अंशांकन घटता के संदर्भ द्वारा aflatoxins की सांद्रता का निर्धारण करते हैं, जी 1 और जी 2 UPLC निर्माता ने सुझाव दिया है और सॉफ्टवेयर 37 से निर्धारित होता है।
    6. प्लेस बीज टुकड़े पहले से ही उनके सूखी वजन निर्धारित करने के लिए हे / एन (~ 16 घंटा) lyophilization के लिए अलग-अलग कांच की शीशियों में मेथनॉल के साथ निकाली गई। फिर, में एनजी। बीज टुकड़ा की सूखी वजन के जी -1 एफ्लाटॉक्सिन एकाग्रता की गणना।
    7. आंकड़ों के विश्लेषण के लिए, लॉग इन करने एफ्लाटॉक्सिन परिणाम परिवर्तित (एनजी। जी -1 1), मतलब की तुलना के लिए Tukey के परीक्षण के बाद।

    6. जीन एक्सप्रेशन, नमूनों की आरटी पीसीआर प्रसंस्करण

    1. नलियों शामिल पीस 2 मिलीलीटर ले लो40 सेकंड के लिए 3100 rpm पर एक मनका मिल homogenizer में उन्हें पीस (विगलन के बिना) तुरंत -80 डिग्री सेल्सियस फ्रीजर से नमूने हैैं, और उसके बाद निर्माता के निर्देशों के अनुसार Trizol का उपयोग करते हुए शाही सेना निकासी के लिए आगे बढ़ें।
    2. एक एक कर, 1 ग्राम शाही सेना और oligo डीटी और यादृच्छिक hexamers के बराबर मात्रा का उपयोग करते हुए प्रत्येक नमूने से सीडीएनए तैयार: सीडीएनए के 8 कमजोर पड़ने और (पहले 39 में वर्णित के रूप में) आरटी पीसीआर में प्रतिक्रिया प्रति 2 μl का उपयोग करें।
      1. आरएनएआई डालने उपयोग प्राइमरों की अभिव्यक्ति का पता लगाने के लिए: RT_5X_1_105F: 5'GGTGGCATTGGACCGTCTTG -3 ', RT_5X_1_232R: 5'-CGCATCGAGGACAGGTTGTG -3'; और RT_5X_2_95F: 5'-CCATGTTTCTGGTGGCATTG -3 ', RT_5X_2_229R: 5'-ATCGAGGACAGGTTGTGTTG -3'।
      2. चयन मार्कर NPTII की अभिव्यक्ति का पता लगाने के लिए, उपयोग प्राइमरों: RT_NPTII_1_6871F: 5'-CTCGCTCGATGCGATGTTTC -3 ', RT_NPTII_1_7004R: 5'-GCAGGATCTCCTGTCATCTC -3'। Actin-परिवार कल्याण:: गृह व्यवस्था जीन एक्टिन मानकीकरण के लिए, और प्राइमरों का उपयोग CACATGCCATCCTTCGATTG; एक्टिन-RV: CCAAGGCAACATATGCAAGCT 40।
    3. एक्टिन अभिव्यक्ति के लिए मानकीकृत डेल्टा डेल्टा सी टी विधि 41 से परिणामों का विश्लेषण। नियंत्रण अपने हाथ में गुना वृद्धि के रूप में परिणाम दर्शाते हैं।

Representative Results

प्लाज्मिड p5XCAPD pCAPD 29 के व्युत्पन्न के रूप में बनाया है, और मूंगफली पौधों को बदलने के लिए इसका इस्तेमाल किया गया था; इस सदिश के एफ्लाटॉक्सिन-संश्लेषण जीनों के पांच छोटे टुकड़ों के उल्टे दोहराता, 70-80 बीपी प्रत्येक वहन एक Intron (चित्रा 1) द्वारा अलग flavus। AFL2G_07224 (aflR), AFL2G_07223 (aflS या aflJ), AFL2G_05027 (एफ्लाटॉक्सिन तपका पंप, aflep), AFL2G_07228 (aflC / pksA / pksL1), और AFL2G_07731 (pes1) के टुकड़े एक करने के लिए चित्रा 1 अनुरूप पर नंबर, निर्माण के लिए इस्तेमाल किया गया ब्रॉड संस्थान, कैम्ब्रिज, एमए, और साहित्य 42 में flavus जीनोम एनोटेशन। 99 मूंगफली लाइनों की कुल परिवर्तन की प्रक्रिया के माध्यम से जाने के बाद पुनर्जीवित किया गया था, 50 पीसीआर एसटीएन पीसीआर से पता लगाया NPTII के लिए सकारात्मक थे, और 33 लाइनों पीसीआर सकारात्मक और उत्पादित बीज थे। केवल सात पीसीआर सकारात्मक लाइनों clonally प्रचारित और presen द्वारा परीक्षण किया गयाएफ्लाटॉक्सिन संचय के लिए टी विधि, सभी सात 60% और नियंत्रण की तुलना में 100% से भी कम एफ्लाटॉक्सिन संचय के बीच पता चला है। यहाँ हम उन सात लाइनों में से दो के परिणाम दिखाते हैं। व्यक्तिगत ट्रांसजेनिक घटनाओं आमतौर पर कुछ बीज उत्पादन के रूप में, एक पद्धति अभी भी पैरामीट्रिक सांख्यिकीय विश्लेषण करने में सक्षम होने के साथ ही बीज की एक न्यूनतम संख्या का उपयोग करने के लिए विकसित किया गया था। नमूना तैयार करने और प्रायोगिक स्थापना के एक फ़्लोचार्ट चित्रा 5 और 1 टेबल में दिखाया गया है। ट्रांसजेनिक बीजों की पहली पीढ़ी के लिए आम तौर पर hemizygous है, यह सेल के लिए सेल और छोटे दखल शाही सेना के प्रणालीगत आंदोलन (siRNA) उत्पन्न उम्मीद है कि शाही सेना के हस्तक्षेप के माध्यम से संयंत्र भर में एफ्लाटॉक्सिन-संश्लेषण मुंह बंद प्रदान करना चाहिए।

चित्रा 5
विधि की चित्रा 5. योजनाबद्ध फ़्लोचार्ट मुंह बंद करने में आरएनएआई की प्रभावशीलता का विश्लेषण करने के लिए मूंगफली के बीज में एसपरजिलस एफ्लाटॉक्सिन-संश्लेषण जीनों। काम के प्रवाह का ग्राफिक प्रतिनिधित्व जीन अभिव्यक्ति या एफ्लाटॉक्सिन विश्लेषण के लिए मूंगफली नमूने प्रसंस्करण है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

एसटीएन पीसीआर द्वारा परीक्षण किया जब आरएनएआई मूंगफली लाइनों 288-72 और 288-74 NPTII चयन निर्माता की उपस्थिति देखी गई, जेल वर्गों चित्रा 6 (ऊपर) में दिखाया गया है, मूल चित्रों के अनुरोध पर लेखकों से उपलब्ध हैं। यह दो जीन एम आर (क्लोरैमफेनिकॉल प्रतिरोध) और पौधों पर अज्ञात प्रभाव का CcdB (विष) के उल्टे दोहराता encodes के बाद प्लाज्मिड pCAPD परिवर्तन की एक नियंत्रण के रूप में इस्तेमाल नहीं किया गया था। पीसीआर नकारात्मक मूंगफली लाइन 288-9 और उत्थान की प्रक्रिया के माध्यम से चला गया और आरएनएआई लाइनों के रूप में एक ही परिस्थितियों में हो गया था, जो दूसरों को नकारात्मक चोर के रूप में इस्तेमाल किया गयाtrol।

चित्रा 6
चित्रा ट्रांसजेनिक्स 6. जांच और आरएनएआई की रियल टाइम को अभिव्यक्ति डालने के शीर्ष एकल-ट्यूब, ट्रांसजेनिक मूंगफली लाइनों आरएनएआई 288-72 और आरएनएआई 288-74, सकारात्मक पौधों की नेस्टेड पीसीआर का पता लगाने। नियंत्रण: डब्ल्यू (पानी), पीपी (सकारात्मक संयंत्र), मुरली (मास्टर मिश्रण), पी (प्लाज्मिड p5XCAPD); । अंशों / 2 1/4 1/8 1/16 1 डीएनए नीचे के 2 गुना dilutions प्रतिनिधित्व करते हैं: वास्तविक समय पीसीआर आरएनएआई की अभिव्यक्ति का पता लगाने डालने (प्राइमर सेट: RT_5X_1, RT_5X_2, चित्रा 1 के रूप में, अपरिपक्व पर ( पीला) और 24 और 48hr ऊष्मायन पर ट्रांसजेनिक लाइनों की (ब्राउन) बीजपत्र परिपक्व, ग्रे लाइन: सी टी = 1. Histograms तीन जैविक नमूने का मतलब है और मानक त्रुटि सलाखों (टी) का प्रतिनिधित्वतीन तकनीकी प्रतिकृति के साथ। आरएनएआई डालने के रिश्तेदार मात्रा का ठहराव एक आंतरिक नियंत्रण और 5.2.2 और 5.3 में वर्णित के रूप में गणना की transgene की तुलनात्मक गुना अभिव्यक्ति के रूप में गृह व्यवस्था जीन एक्टिन के संबंध में सामान्यीकृत था। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

एफ्लाटॉक्सिन संचय के संयंत्र मेजबान आरएनएआई की मध्यस्थता संभावित नियंत्रण की प्रभावशीलता की जांच करने के लिए, Aspergillus flavus NRRL 3357 के हौसले से काटा conidia भ्रूण और टेस्टा हटा दिया गया था, जिसमें से आधा बीजपत्र की कटौती की सतह पर लागू किया गया (आंकड़े 3, 4)। जीनोम अनुक्रम और p5XCAPD डिजाइन करने के लिए आधार था कर दिया गया है, जिसके लिए flavus NRRL 3357, कृपया यूएसडीए-एआरएस-NPRL पर डॉ हॉर्न द्वारा प्रदान किया गया। 30 डिग्री सेल्सियस पर 24, 48 और 72 घंटे के बाद आधा गर्भदल के परिणामस्वरूप कवक आक्रमण शो है एन चित्रा 4 में। टीका आधा बीजपत्र के नमूने, 72, 48, 24 में एकत्र किए गए थे ऊष्मायन के 96 घंटे, और नियंत्रण रेखा-एमएस द्वारा मुख्य चार aflatoxins बी 1, बी 2, जी 1 और जी 2 UPLC प्रयोग करने के लिए विश्लेषण किया और इस बात की पुष्टि ; परिणाम चित्रा 6 में दिखाया जाता है। Aflatoxin सांद्रता संशोधनों 36 के साथ प्रकाशित एक विधि का उपयोग निर्धारित किया गया है। 96 घंटा ऊष्मायन में बीजपत्र क्योंकि कवक संक्रमण के बिखर शुरू करते हैं। आरएनएआई लाइन 288-72 अपरिपक्व बीजपत्र में और परिपक्व लोगों में सबसे अधिक नमूने तारीखों में सभी नमूने तारीखों में नियंत्रण से aflatoxins के काफी निचले स्तर का प्रदर्शन किया। आरएनएआई लाइन 288-74 सबसे नमूना तारीखों में aflatoxins की काफी कम स्तर से पता चला। Tukey के परीक्षण के महत्व का स्तर 7 चित्रा के ग्राफिक में तारों के साथ संकेत कर रहे हैं।

g7.jpg "/>
चित्रा 7. Aflatoxins Aspergillus flavus साथ ऊष्मायन (24, 48, 72 और 96 घंटा) के बाद आधे मूंगफली बीजपत्र में बी 1 और बी 2 नियंत्रण: 288-9 गैर ट्रांसजेनिक लाइन के बीज; आरएनएआई: आरएनएआई 288-72 और आरएनएआई 288-74, आरएनएआई p5XCAPD के लिए ट्रांसजेनिक से बीज पाँच एफ्लाटॉक्सिन-संश्लेषण जीनों को चुप करने के लिए। (ए) परिपक्व बीज में एफ्लाटॉक्सिन बी 1 (ब्राउन); (बी) Aflatoxin बी 2 परिपक्व बीज; अपरिपक्व बीज (पीला) और अपरिपक्व बीज में (डी) Aflatoxin बी 2 में (सी) Aflatoxin बी 1। डुप्लिकेट जैविक नमूने की इसी मानक त्रुटि सलाखों (टी) के साथ मतलब मूल्यों का प्रतिनिधित्व कर रहे। सांख्यिकीय महत्वपूर्ण मतभेद की Tukey परीक्षण *: 0.05 ≤ पी, **: पी ≤ 0.01, ***: पी ≤ 0.001।एस: //www.jove.com/files/ftp_upload/53398/53398fig7large.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

कुल मिलाकर, आरएनएआई 288-72 प्रयोग (24-96 घंटा ऊष्मायन), एफ्लाटॉक्सिन बी 2 में एक 94% -100% की कमी, और नियंत्रण की तुलना में एफ्लाटॉक्सिन बी 1 में 90% -100% की कमी के दौरान पता चला है। आरएनएआई 288-74 एफ्लाटॉक्सिन बी 1, 7 चित्रा में एफ्लाटॉक्सिन बी 2 और 60% -100% की कमी में एक 63% -100% की कमी देखी गई।

आरएनएआई डालने की अभिव्यक्ति की वास्तविक समय पीसीआर का पता लगाने के लिए इस्तेमाल किया प्राइमर चित्र 1 में दिखाया गया है। मूंगफली का बीज बीजपत्र उनके प्राकृतिक सुरक्षा साधनों को हटाने के लिए और सबसे अधिक से अवगत कराया क्षेत्र पर आरएनएआई की संभावित प्रभाव का पता लगाने के लिए सक्षम होने के लिए, भ्रूण के बिना विश्लेषण किया गया कवक आक्रमण, बीजपत्र। सी टी पर चार गुना आरएनएआई की अभिव्यक्ति डालने RT_5X_1 सेट प्राइमर द्वारा लाइन 288-74 के अपरिपक्व बीजपत्र (पीला) में पाया गया था (चित्रा 1, 6)। आरएनएआई डालने की अभिव्यक्ति 24 घंटा में, या 48 घंटा ऊष्मायन, चित्रा 6 (नीचे) पर परिपक्व या अपरिपक्व बीजपत्र पर परिपक्व बीजपत्र में पता नहीं था।

मूंगफली लाइन नमूने का समय आरटी पीसीआर के लिए नमूने एफ्लाटॉक्सिन विश्लेषण के लिए नमूने (टीका) एनबीज का भूरा रंग
(गैर टीका)
निरसित 1 निरसित 2 निरसित 3 निरसित 1 निरसित 2 निरसित 3
आरएनएआई (पीला) 24 घंटा 1 1 1 1 1 1 4.5
48 घंटा 1 1 1 1 1
72 घंटा 1 1 1 1 1 1
नियंत्रण 24 घंटा 1 1 1 1 1 1 4.5
(पीला) 48 घंटा 1 1 1 1 1 1
72 घंटा 1 1 1 1 1 1

तालिका 2। छोटा सा नमूना सेटअप का उदाहरण आरएनएआई मूंगफली के बीज में जीन की अभिव्यक्ति और एफ्लाटॉक्सिन संचय का विश्लेषण करने के लिए। पूर्ण अभिव्यक्ति के विश्लेषण और एक परिपक्वता समूह के लिए aflatoxins (यानी।, पीला), तीन नमूने बार (24, 48 और 72 घंटा) के साथ तीन प्रतियों में, 4.5 बीज की आवश्यकता होती है, तालिका में प्रत्येक नंबर एक आधा गर्भदल प्रतिनिधित्व करता है।

Discussion

संयंत्र मेजबान पौधों में mycotoxin संचय की आरएनएआई की मध्यस्थता नियंत्रण की व्यवहार्यता दिखा कोई प्रकाशनों देखते हैं, कवक रोगज़नक़ों में जीन का मुंह बंद करने हालांकि, 27,43 प्रदर्शन किया गया है आरएनएआई की मध्यस्थता। पत्तियों भूमिगत फली की फंगल संक्रमण पर कोई लक्षण नहीं दिखाई के रूप में मूंगफली में इन अध्ययनों के लिए एक सीमित कारक, व्यक्तिगत पौधों में एक नहीं, एफ्लाटॉक्सिन संचय फेनोटाइप मूल्यांकन करने के लिए एक विधि का अभाव था। इसके अलावा, aflatoxins की नहीं-सामान्य रूप से वितरित संचय, और रासायनिक विश्लेषण 15,16 के लिए बड़े नमूने के लिए की जरूरत है एक ही पौधे पर संभावित आरएनएआई प्रभाव की मात्रा का ठहराव रुकावट है। यहाँ प्रस्तुत विधि तीन प्रतियों में तीन 24 घंटा अंतराल नमूनों (तालिका 1, चित्रा 7) प्रदर्शन करने के लिए पाँच बीज का उपयोग कर 72 घंटा प्रयोगों के होते हैं। बीज की कोई कम से कम 100 ग्राम की आवश्यकता है कि ठेठ एफ्लाटॉक्सिन विश्लेषण की तुलना में हमारे विधि individua के लिए विशेष रूप से उपयुक्त हैशुरू में दो या तीन फली से अधिक नहीं है जो उत्पादन मूंगफली पौधों के एल ट्रांसजेनिक घटनाओं।

एफ्लाटॉक्सिन संश्लेषण की शाही सेना की मध्यस्थता मुंह बंद आनुवंशिक रूप से Aspergillus flavus और बदलने के द्वारा प्रदर्शन किया गया है parasiticus। AflR में एफ्लाटॉक्सिन उत्पादन का एक मुख्य नियामक है इसलिये flavus और ए parasiticus 44,45, यह पौधों में शाही सेना की मध्यस्थता मुंह बंद करने के लिए एक दिलचस्प लक्ष्य बन जाता है। हालांकि, aflR में आनुवंशिक विविधताओं Aspergillus प्रजातियों 46 के बीच में दिखाया गया है, और संयंत्र की मेजबानी में उत्पादित आरएनएआई संकेत के साथ मिलान कोई सही अनुक्रम है, अगर वहाँ उन आनुवंशिक वेरिएंट मुंह बंद करने से बच सकता है। इस प्रकार, aflR वेक्टर p5XCAPD में मुंह बंद करने के लिए लक्ष्यों में से एक था, लेकिन केवल एक ही नहीं था। में पेश aflR जीन के उल्टे दोहराता flavus और परिवर्तन से parasiticus कम या कोई उत्पाद और मुंह बंद करने के परिणामस्वरूपaflatoxins 47 के आयन (मैकडॉनल्ड्स एट अल।, 2005b)। इसके अलावा, मुंह बंद aflD जीन में करने के लिए 98% से एफ्लाटॉक्सिन उत्पादन रोका flavus और प्रत्यक्ष परिवर्तन 48 में parasiticus। हमारी प्रणाली में सफलता की संभावना बढ़ाने के लिए, मूंगफली में एफ्लाटॉक्सिन उत्पादन में शामिल पांच जीनों के उल्टे दोहराने के टुकड़े के साथ तब्दील हो गया था flavus। यहाँ यह एफ्लाटॉक्सिन संश्लेषण मार्ग में कई जीन मुंह बंद करने के लिए है कि लक्ष्य p5XCAPD, 90% एफ्लाटॉक्सिन बी 1 और बी 2 के -100% निचले स्तर का उपयोग कर लाइन 288-72 में प्राप्त किया गया है कि दिखाया गया है, और 60-100% निचले स्तर में जमा है आधा बीजपत्र के साथ inoculated थे जब नियंत्रण, की तुलना में लाइन 288-74 flavus, 7 4 आंकड़े। सबसे महत्वपूर्ण बात, इस विधि पैरामीट्रिक आंकड़े को लागू करने से 288-74 नियंत्रण बनाम प्रयोग भर लाइनों 288-72, द्वारा एफ्लाटॉक्सिन संचय में सांख्यिकीय महत्वपूर्ण मतभेदों का पता चलाtics, चित्रा 7। छोटा सा नमूना आकार को देखते हुए, यह इन प्रयोगों के एक उच्च संकल्प, उच्च प्रदर्शन और की तुलना में तीन गुना अधिक संवेदनशीलता से पांच गुना है जो UPLC द्वारा विश्लेषण किया गया aflatoxins पता लगाने के लिए एक शक्तिशाली तरीका इस्तेमाल करने के लिए आवश्यकता को रेखांकित करने के लिए महत्वपूर्ण है एचपीएलसी 49।

आरएनएआई की अभिव्यक्ति डालने 288-74 में केवल 24 घंटा ऊष्मायन पर अपरिपक्व बीजपत्र (पीला) में पाया गया था। आरएनएआई डालने 24 घंटा में 288-74 के परिपक्व बीजपत्र पर आरटी पीसीआर से पता नहीं था, या 48 घंटा, चित्रा 6 पर किसी भी परिपक्वता समूह पर। यह एक ही घटना अन्य आरएनएआई ट्रांसजेनिक मूंगफली लाइनों में मनाया गया (एरियस, रुपये, 2015 अप्रकाशित), आमतौर पर आरएनएआई टेप केवल 24 घंटा में अपरिपक्व बीजपत्र पर पता चला रहे थे जहां। शाही सेना के नमूने सीडीएनए संश्लेषण से पहले DNase साथ इलाज किया गया, डेटा एक्टिन अभिव्यक्ति के स्तर पर और मनाया गया डीएनए संदूषण का कोई सबूत के लिए सामान्यीकृत थे। डीएनए नमूनों में मौजूद होना चाहिए था, यह चाहिएके रूप में अच्छी तरह से 48 घंटे के नमूने में पाया है, लेकिन लगातार यह मामला नहीं था कर दिया गया है। 35S-प्रमोटर के नियंत्रण के तहत अभिव्यक्ति हमेशा एक समान नहीं है; यह पर्यावरण की स्थिति 50, ऊतक और विकास मंच 51,52 के प्रकार से प्रभावित हो सकते हैं। इसी समय, शाही सेना के हस्तक्षेप के मार्ग में, mRNA के क्षय की दर और siRNA क्षय की दर काफी 53 अलग-अलग हो सकते हैं। यह शाही सेना के हस्तक्षेप के तंत्र द्वारा mRNA का तेजी से क्षरण 48 घंटा ऊष्मायन पर mRNA पता लगाने को रोका जा सकता था कि संभव है। 48 घंटा में अभिव्यक्ति की अनुपस्थिति कम 35S-प्रमोटर संचालित प्रतिलेखन की वजह से था या नहीं, या पासा खेलनेवाला द्वारा dsRNA की तेज गिरावट के जवाब दिए जाने की बनी हुई है। इस प्रकार, उच्च throughput अनुक्रमण द्वारा छोटे RNAs का पता लगाने के आरएनएआई 54 के माध्यम से जगह लेने की प्रक्रिया पर एक बेहतर जानकारी देंगे इन प्रयोगों में। हालांकि, आरएनए मुंह बंद करने में मुख्य रूप से photosynt से फ्लोएम के माध्यम से, प्रणालीबद्ध फैलता है के बाद से55 (इस मामले मूंगफली के बीज में) डूब sucrose के लिए, एफ्लाटॉक्सिन-संश्लेषण का मुंह बंद करने डालने आरएनएआई की स्थानीय अभिव्यक्ति के बिना बीज में हो सकते हैं स्रोतों से नफरत है। अधिक से अधिक शोध के बीज में एफ्लाटॉक्सिन संचय को रोकने के लिए आवश्यक छोटे दखल RNAs (siRNAs) की दहलीज स्तर निर्धारित करने के लिए किया जाना बना रहता है। यह आरएनएआई की दोनों, mRNA अभिव्यक्ति (चित्रा 6) के निर्माण के तथ्य यह है कि जोर देना जरूरी है, और aflatoxins बी 1 और बी 2 (चित्रा 7) के संचय बनाम अपरिपक्व (पीला) के लिए अलग-अलग परिणाम दिखाया। परिपक्व (ब्राउन) बीजपत्र। मूंगफली पौधों वह यह है कि वे फसल परिपक्वता फली की एक श्रृंखला, चित्रा 2 में मौजूद है, अनिश्चित वृद्धि की है। इसके अलावा, विभिन्न परिपक्वता समूहों से बीज, उनकी रासायनिक संरचना में भिन्न होते हैं जैसे।, 2.4% अपरिपक्व बीज में सुक्रोज, और 1.9% में एक ही क्षेत्र की स्थिति 56,57 के तहत परिपक्व बीज। इस प्रकार, वास्तविक efficienc समझने के लिएएफ्लाटॉक्सिन संचय की शाही सेना की मध्यस्थता नियंत्रण के y, यह अलग से परिपक्वता समूहों का विश्लेषण करने के लिए महत्वपूर्ण है।

मूंगफली के बीज के एक प्राकृतिक रक्षा उत्पादन यौगिकों और बीज और पर्यावरण की स्थिति 58-61 की परिपक्वता के आधार पर उनके रिश्तेदार मात्रा की विविधता में बदलता है जो Phytoalexins का उत्पादन होता है, और यह बीजपत्र 62 की तुलना में भ्रूण में विशेष रूप से अधिक है। भ्रूण भी (अप्रकाशित एरियस रुपये,) न्यूक्लिक एसिड, बीजपत्र से दोनों डीएनए और आरएनए की काफी उच्च सांद्रता है। मूंगफली का बीज परिपक्व रूप में, उनके शरीर विज्ञान और रासायनिक संरचना में परिवर्तन 63 होते हैं। Fungistatic गतिविधि 64 के साथ मूंगफली टेस्टा प्रपत्र सघन टैनिन में फिनोलिक एंटीऑक्सीडेंट; टैनिन और phenolic यौगिकों की अपनी सामग्री परिपक्वता 65 के साथ बढ़ जाती है, क्योंकि यह भी 35 काला करने के लिए पीले रंग की परिपक्वता चरणों, दर्शाता है कि Mesocarp रंग में स्पष्ट है। टी के प्रकार, उपस्थितिउनके रोगाणुरोधी संपत्तियों दिया एस्टा या प्रयोग में भ्रूण, कवक विकास सीमित है और इसलिए इसलिए, वे हटा दिया गया है, आरएनएआई मुंह बंद करने के प्रभाव को जरुरत से ज्यादा हो सकता था। इसके अलावा, टेस्टा और भ्रूण को हटाने के भ्रूण अधिक Phytoalexins और अधिक आरएनए सामग्री होगा किया जाता है कि आधे अंकुर के रूप में, विश्लेषण में अंतर के स्रोतों की सीमा में मदद करता है।

परिपक्वता समूहों और इन प्रयोगों में टेस्टा और भ्रूण को हटाने के द्वारा विश्लेषण करने के लिए इसके अलावा, यह कुछ और टिप्पणियों बाहर बात करने के लिए महत्वपूर्ण है: एक) का परिणाम है अप करने के लिए 96 घंटे ऊष्मायन के लिए दिखाए गए हैं, हालांकि यह कोई 72 से अधिक उपयोग करने के लिए सिफारिश की है बीज 96 घंटा के द्वारा अपमानित पाने के रूप में मानव संसाधन, अनुरूप परिणाम प्राप्त करने के लिए; और ख) एक ही बीज से आधा बीजपत्र, यादृच्छिक पर नमूना है, हालांकि पूरी तरह से स्वतंत्र नमूने का गठन नहीं है, जबकि आरटी पीसीआर और ट्रांसजेनिक घटनाओं के भीतर एफ्लाटॉक्सिन संचय बीज के बीच न्यूनतम भिन्नता देखी गई। इसके अलावा, एक सटीक कवक बीजाणु, inoculum मात्रा गिनती2 μl की है, और किनारों पर टपकता परहेज बीजपत्र की कटौती की सतह पर बीजाणुओं के आवेदन अंकुरित बीजाणुओं संयंत्र के ऊतकों को उजागर कर रहे हैं सुनिश्चित करने के लिए महत्वपूर्ण हैं। प्लेटों पर पानी / अगर चित्रा 4 (नीचे) की अंतिम सीमा पर दिखाया (v / डब्ल्यू), नरम अगर बीजाणुओं का अपवाह का कारण बनता है 1.5% से कम होना चाहिए। ; एक विशेष ट्रांसजेनिक घटना से सीमित हो उपलब्धता बीज चाहिए, नमूने के बजाय तीन प्रतियों प्राप्त करने के इसी तरह के परिणाम की (यानी, चित्रा 7) दो प्रतियों में किया जा सकता है हालांकि, तीन प्रतियों के नमूने मानक त्रुटि को कम करने में मदद मिलेगी। इस पद्धति का ही सीमा है कि यह एफ्लाटॉक्सिन का पता लगाने / मात्रा का ठहराव के लिए एक बेहद संवेदनशील प्रणाली (UPLC) की आवश्यकता है, लेकिन एक ही समय में यह कम संवेदनशील तरीकों से aflatoxins नहीं पाया जा चाहिए आरएनएआई के प्रभाव overestimating की संभावना कम कर देता है।

अंत में, इस विधि से पहली बार के लिए अध्ययन करने के लिए एक विश्वसनीय दृष्टिकोण प्रदान करता हैaflatoxins के नियंत्रण में आरएनएआई का असर। कम से कम एक सप्ताह के लिए एक पूरी फसल मौसम से एक प्रयोग के लिए समय को कम करने, इस विधि काफी शमन और / या aflatoxins के उन्मूलन की दिशा में आरएनएआई मूंगफली / एसपरजिलस pathosystem पर अनुसंधान को गति देगा।

Materials

Name Company Catalog Number Comments
Primers, oligonucleotides DNA Technologies, Coralville, IA, USA n/a
Dneasy Plant Mini Kit Qiagen, Valencia, CA 69106
Czapek Dox agar medium Oxoid, by Thermo Fisher Scientific, Waltham, MA CM0095
Agar Thermo Fisher Scientific, Waltham, MA BP 1423
Freezer -80 °C n/a n/a
Aluminum Oxide, Al2O3 Fisher Scientific A941
SPE Reservoirs 1.5 ml Grace Davison Discovery Scientific 210011
Frits for 1.5 ml SPE reservoir Grace Davison Discovery Scientific 211401
Autosampler vials Waters Corporation, Milford, MA 186005221
Waters Acquity Ultra-Performance Liquid-Chromatography (UPLC) instrument; UPLC-H-Class Quaternary Solvent Manager; UPLC Sample Manager; UPLC Fluorescent detector (FLR); UPLC BEH C18 2.1 mm x 50 mm, 1.7 mm column Waters Corporation, Milford, MA
Finnigan LCQ Advantage MAX ion trap mass spectrometer, with Xcalibur version 1.4 software Thermo Electron Corp., San Jose, CA
Aflatoxin standards, B1, B2, G1 and G2 Sigma-Aldrich, St. Louis, MO A6636; A9887; A0138; A0263
Systat Software 12.2 SYSTAT Software Inc., Point Richmond, CA
Trizol reagent Invitrogen, CA 15596-018
SuperScript III First Strand Synthesis Super Mix Invitrogen, CA 11752-050
ABI 7500 Real-Time PCR Lifetechnologies, Grand Island, NY 4406984
Luria Broth-Miller Fisher Scientific R453642
pENTR1A Invitrogen, CA A10462
LR Clonase II enzyme mix Invitrogen, CA 11791-020
T4 DNA Ligase NEB Biolabs M0202L
Gelrite Sigma-Aldrich, St. Louis, MO G1919
Acetosyringone Sigma-Aldrich, St. Louis, MO D134406
QIAcube robot workstation Qiagen, Valencia, CA 9001292
Antibiotics: kanamycin, cefotaxime, gentamicin; streptomycin Goldbio, St. Louis, MO cef.: C-104-25; kan: K-120-5; gent.: G-400-1; strep.: S-150-50
Platinum Taq DNA Polymerase High Fidelity Invitrogen, CA 11304-029

DOWNLOAD MATERIALS LIST

References

  1. Williams, J. H., et al. Human aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions. The American Journal of Clinical Nutrition. 80, 1106-1122 (2004).
  2. American Association for Cancer Research: AACR. An evaluation of chemicals and industrial processes associated with cancer in humans based on human and animal data: IARC Monographs Volumes 1 to 20. Cancer Research. 40, 1-12 (1980).
  3. Turner, P. C. The molecular epidemiology of chronic aflatoxin driven impaired child growth. Scientifica. (2013).
  4. Rasooly, R., Hernlem, B., He, X., Friedman, M. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells. Toxins (Basel). 5, 1447-1461 (2013).
  5. Gong, Y. Y., et al. Determinants of aflatoxin exposure in young children from Benin and Togo, West Africa: the critical role of weaning. International Journal of Epidemiology. 32, 556-562 (2003).
  6. Eaton, D. L., Groopman, J. D. The toxicology of aflatoxins: human health, veterinary, and agricultural significance. Academic Press. (1994).
  7. Murugavel, K. G., et al. Prevalence of aflatoxin B1 in liver biopsies of proven hepatocellular carcinoma in India determined by an in-house immunoperoxidase test. Journal of Medical Microbiology. 56, 1455-1459 (2007).
  8. Wang, J. S., et al. Hepatocellular carcinoma and aflatoxin exposure in Zhuqing Village, Fusui County, People's Republic of China. Cancer Epidemiology, Biomarkers & Prevention. 10, American Association for Cancer Research. 143-146 (2001).
  9. Azziz-Baumgartner, E., et al. Case-control study of an acute aflatoxicosis outbreak, Kenya, 2004. Environmental Health Perspectives. 113, 1779-1783 (2005).
  10. Lye, M. S., Ghazali, A. A., Mohan, J., Alwin, N., Nair, R. C. An outbreak of acute hepatic encephalopathy due to severe aflatoxicosis in Malaysia. American Journal of Tropical Medicine and Hygiene. 53, 68-72 (1995).
  11. Villers, P. Aflatoxins and safe storage. Frontiers in Microbiology. 5, 158 (2014).
  12. Kensler, T. W., Roebuck, B. D., Wogan, G. N., Groopman, J. D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences. 120, S28-S48 (2011).
  13. Dorner, J. W., Cole, R. J., Wicklow, D. T. Aflatoxin reduction in corn through field application of competitive fungi. Journal of Food Protection. 62, 650-656 (1999).
  14. Cotty, P. J., Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic-pathway enzymes. Applied and Environmental Microbiology. 60, 2248-2251 (1994).
  15. Whitaker, T. B. Standardisation of mycotoxin sampling procedures: an urgent necessity. Food Control. 14, 233-237 (2003).
  16. Whitaker, T. B., Dorner, J. W., Giesbrecht, F. G., Slate, A. B. Variability among aflatoxin test results on runner peanuts harvested from small field plots. Peanut Science. 31, 59-63 (2004).
  17. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  18. Rafael, D., et al. EMT blockage strategies: Targeting Akt dependent mechanisms for breast cancer metastatic behaviour modulation. Current Gene Therapy. (2015).
  19. Li, G., Chang, H., Zhai, Y. P., Xu, W. Targeted silencing of inhibitors of apoptosis proteins with siRNAs: a potential anti-cancer strategy for hepatocellular carcinoma. Asian Pacific. Journal of Cancer Prevention: APJCP. 14, 4943-4952 (2013).
  20. Koldehoff, M. Targeting bcr-abl transcripts with siRNAs in an imatinib-resistant chronic myeloid leukemia patient: challenges and future directions. Methods in Molecular Biology. 1218, 277-292 (2015).
  21. Zhang, J., et al. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science. 347, 991-994 (2015).
  22. Ajjappala, H., Chung, H. Y., Sim, J. S., Choi, I., Hahn, B. S. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta. 241, 773-787 (2015).
  23. Jose, A. M., Hunter, C. P. Transport of sequence-specific RNA interference information between cells. Annual Review of Genetics. 41, 305-330 (2007).
  24. Vazquez, F., Hohn, T. Biogenesis and biological activity of secondary siRNAs in plants. Scientifica. Hindawi Publishing Corporation. (2013).
  25. Tinoco, M. L. P., Dias, B. B. A., Dall'Astta, R. C., Pamphile, J. A., Aragao, F. J. L. In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biology. 8, (2010).
  26. Govindarajulu, M., Epstein, L., Wroblewski, T., Michelmore, R. W. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce. Plant Biotechnology Journal. (2014).
  27. Yin, C., Jurgenson, J. E., Hulbert, S. H. Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Molecular Plant-Microbe Interactions. 24, 554-561 (2011).
  28. Ghag, S. B., Shekhawat, U. K., Ganapathi, T. R. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium. wilt in banana. Plant Biotechnology Journal. 12, 541-553 (2014).
  29. Filichkin, S. A., et al. Efficiency of gene silencing repeats vs. transitive RNAi in Arabidopsis: direct inverted vectors. Plant Biotechnology Journal. 5, 615-626 (2007).
  30. Sciaky, D., Montoya, A. L., Chilton, M. D. Fingerprints of Agrobacterium Ti Plasmids. Plasmid. 1, 238-253 (1978).
  31. Clark, D. J., Maaloe, O. DNA Replication and Division Cycle in Escherichia coli. Journal of Molecular Biology. 23, 99-112 (1967).
  32. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum. 15, 473-497 (1962).
  33. Srinivasan, T., Kumar, K. R. R., Kirti, P. B. Establishment of efficient and rapid regeneration system for some diploid wild species of Arachis. Plant Cell Tissue and Organ Culture. 101, 303-309 (2010).
  34. Gomes, A. L. V., et al. Single-tube nested PCR using immobilized internal primers for the identification of dengue virus serotypes. Journal of Virology Methods. 145, 76-79 (2007).
  35. Williams, E. J., Drexler, J. S. A non-destructive method for determining peanut pod maturity. Peanut Science. 8, 134-141 (1981).
  36. Sobolev, V. S., Dorner, J. W. Cleanup procedure for determination of aflatoxins in major agricultural commodities by liquid chromatography. Journal of AOAC International. 85, 642-645 (2002).
  37. Empower Software, Getting Started Guide. Waters Corporation. Milford, MA. Available from: http://sites.chem.colostate.edu/diverdi/C431/experiments/high%20pressure%20liquid%20chromatography/references/Empower%20getting%20started%2071500031203rA.pdf (2002).
  38. Biselli, S., Hartig, L., Wegner, H., Hummert, C. Analysis of Fusarium. toxins using LC-MS-MS: Application to various food and feed matrices. LC GC North America. 23, 404-413 (2005).
  39. Arias, R. S., Sobolev, V. S., Orner, V. A., Dang, P. M., Lamb, M. C. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential. Plant Pathology. 63, 353-363 (2014).
  40. Dang, P. M., Chen, C. Y., Holbrook, C. C. Evaluation of five peanut (Arachis hypogaea) genotypes to identify drought responsive mechanisms utilising candidate-gene approach. Functional Plant Biology. 40, 1323-1333 (2013).
  41. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative C-T method. Nature Protocols. 3, 1101-1108 (2008).
  42. Amaike, S., Keller, N. P. Aspergillus flavus. Annual Review of Phytopathology. 49, 107-133 (2011).
  43. Nowara, D., et al. HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell. 22, 3130-3141 (2010).
  44. Woloshuk, C. P., et al. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Applied and Environmental Microbiology. 60, 2408-2414 (1994).
  45. Price, M. S., et al. The aflatoxin pathway regulator AflR induces gene transcription inside and outside of the aflatoxin biosynthetic cluster. FEMS Microbiology Letters. 255, 275-279 (2006).
  46. Ehrlich, K. C., Montalbano, B. G., Cotty, P. J. Sequence comparison of aflR from different Aspergillus. species provides evidence for variability in regulation of aflatoxin production. Fungal Genetics and Biology. 38, 63-74 (2003).
  47. McDonald, T., Brown, D., Keller, N. P., Hammond, T. M. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Molecular Plant Microbe Interactions. 18, 539-545 (2005).
  48. Abdel-Hadi, A. M., Caley, D. P., Carter, D. R., Magan, N. Control of aflatoxin production of Aspergillus flavus. and Aspergillus parasiticus. using RNA silencing technology by targeting aflD. (nor-1) gene. Toxins (Basel). 3, 647-659 (2011).
  49. Swartz, M. E. Ultra performance liquid chromatography (UPLC): An introduction: Separation Science Redefined. LCGC North America. Suppl ement 8. 8-14 (2005).
  50. Maghuly, F., Khan, M. A., Fernandez, E. B., Druart, P., Watillon, B., Laimer, M. Stress regulated expression of the GUS-marker gene (uidA) under the control of plant calmodulin and viral 35S promoters in a model fruit tree rootstock: Prunus incisa x serrula. Journal of Biotechnology. 135, 105-116 (2008).
  51. de Mesa, M. C., Santiago-Doménech, N., Pliego-Alfaro, F., Quesada, M. A., Mercado, J. A. The CaMV 35S promoter is highly active on floral organs and pollen of transgenic strawberry plants. Plant Cell Reports. 23, 32-38 (2004).
  52. Sunilkumar, G., Mohr, L., Lopata-Finch, E., Emani, C., Rathore, K. S. Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Molecular Biology. 50, 463-474 (2002).
  53. Groenenboom, M. A. C., Maree, A. F. M., Hogeweg, P. The RNA silencing pathway: The bits and pieces that matter. PLoS Computational Biology. 1, 155-165 (2005).
  54. Zhao, D., Song, G. Q. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants. Plant Science: an International Journal of Experimental Plant Biology. 228, 39-47 (2014).
  55. Kamthan, A., Chauduri, A., Kamthan, M., Datta, A. Small RNAs in plants: recent development and application for crop improvement. Frontiers in Plant Science. 6, 208 (2015).
  56. Manda, A., Bodapati, P. N., Rachaputi, N. C., Wright, G., Fukai, S. Aflatoxins and their relationship with sugars in peanut (Arachis hypogaea L). 4th International Crop Science Congress, 2004, Available from: http://www.cropscience.org.au/icsc2004/poster/5/1/3/625_manda.htm (2004).
  57. Uppala, S. S. Factors affecting pre-harvest aflatoxin contamination of peanut (Arachis hypogaea L). Auburn University. (2011).
  58. Sobolev, V. S. Localized production of phytoalexins by peanut (Arachis hypogaea) kernels in response to invasion by Aspergillus species. Journal of Agricultural and Food Chemistry. 56, 1949-1954 (2008).
  59. Sobolev, V. S., Guo, B. Z., Holbrook, C. C., Lynch, R. E. Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes. Journal of Agricultural and Food Chemistry. 55, 2195-2200 (2007).
  60. Sobolev, V. S., Neff, S. A., Gloer, J. B. New stilbenoids from peanut (Arachis hypogaea) seeds challenged by an Aspergillus caelatus strain. Journal of Agricultural and Food Chemistry. 57, 62-68 (2009).
  61. Dorner, J. W., Cole, R. J., Sanders, T. H., Blankenship, P. D. Interrelationship of kernel water activity, soil temperature, maturity, and phytoalexin production in preharvest aflatoxin contamination of drought-stressed peanuts. Mycopathologia. 105, 117-128 (1989).
  62. Sobolev, V. S. Production of phytoalexins in peanut (Arachis hypogaea) seed elicited by selected microorganisms. Journal of Agricultural and Food Chemistry. 61, 1850-1858 (2013).
  63. Basha, S. M. M., Cherry, J. P., Young, C. T. Changes in free amino acids, carbohydrates, and proteins of maturing seeds from various peanut (Arachis hypogaea L.) cultivars. Cereal Chemistry. 53, 586-596 (1976).
  64. Lansden, J. A. Aflatoxin inhibition and fungistasis by peanut tannins. Peanut Science. 9, 17-20 (1982).
  65. Yen, G. C., Duh, P. D., Tsai, C. L. Relationships between antioxidant activity and maturity of peanut hulls. Journal of Agricultural and Food Chemistry. 41, 67-70 (1993).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics